The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016935	Paenibacillus mucilaginosus 3016, complete sequence	8739048	1641032	1714652	8739048	tail,head,terminase,capsid,protease,portal,integrase,transposase	Bacillus_phage(25.0%)	80	1644133:1644154	1706516:1706537
WP_014368957.1|1641032_1642259_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.7	8.7e-113
WP_014368958.1|1642245_1642677_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	44.6	4.4e-11
WP_013914840.1|1642695_1644093_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
1644133:1644154	attL	TTTGCCCCCTTTTTGCCCCCCA	NA	NA	NA	NA
WP_014368959.1|1644156_1645311_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	75.7	2.5e-170
WP_014368960.1|1645264_1645807_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_014368961.1|1645882_1646653_-	DUF1829 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	37.5	2.9e-37
WP_187297997.1|1646678_1647128_-	hypothetical protein	NA	Q4ZCB9	Staphylococcus_virus	41.2	2.8e-08
WP_014368962.1|1647234_1647612_-	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	52.1	1.1e-13
WP_014368963.1|1647768_1647996_+	helix-turn-helix transcriptional regulator	NA	A0A1L2JY14	Aeribacillus_phage	70.3	2.7e-20
WP_014368964.1|1648044_1648314_+	hypothetical protein	NA	A0A1B1P7U4	Bacillus_phage	59.3	2.7e-27
WP_014368965.1|1648470_1648707_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014368966.1|1648699_1648957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368967.1|1649116_1649395_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	45.5	1.4e-15
WP_014368968.1|1649481_1649682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148279666.1|1649812_1650004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368969.1|1649990_1650863_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	46.8	4.6e-68
WP_014368970.1|1650865_1651765_+	recombination protein RecT	NA	W8EBF6	Geobacillus_phage	54.6	1.1e-69
WP_014368972.1|1651968_1652967_+	replication protein	NA	W8EKA2	Geobacillus_phage	56.8	2.4e-36
WP_014368973.1|1652944_1654222_+	AAA family ATPase	NA	I6S783	Marinomonas_phage	30.4	1.1e-44
WP_014368975.1|1654412_1654574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368976.1|1654573_1654759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368977.1|1654751_1655240_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A0C5AFC9	Paenibacillus_phage	47.6	4.8e-30
WP_014368978.1|1655245_1655911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368980.1|1656811_1656958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368981.1|1657177_1657507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014368983.1|1657905_1658283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368984.1|1658650_1659334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014368985.1|1659480_1659717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368986.1|1659823_1660165_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	48.3	9.4e-25
WP_041619058.1|1660281_1660905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368988.1|1661124_1661625_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	59.7	1.1e-45
WP_014368989.1|1661624_1663349_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	53.1	4.3e-174
WP_014368990.1|1663381_1664647_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	46.1	9.0e-81
WP_014368991.1|1664603_1665308_+|head,protease	HK97 family phage prohead protease	head,protease	E2ELI4	Clostridium_phage	50.9	2.4e-35
WP_014368992.1|1665309_1666476_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	49.6	2.7e-100
WP_014368993.1|1666492_1666804_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_081484308.1|1666793_1667000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014368995.1|1666980_1667331_+|head	phage head closure protein	head	A6M954	Geobacillus_virus	36.9	7.4e-17
WP_014368996.1|1667299_1667689_+	HK97 gp10 family phage protein	NA	W8CZ44	Bacillus_phage	44.4	5.0e-22
WP_041619061.1|1667685_1668048_+	DUF3168 domain-containing protein	NA	Q2I8F3	Bacillus_phage	53.1	5.6e-28
WP_014368998.1|1668051_1668666_+|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	41.5	2.1e-35
WP_014368999.1|1668689_1669088_+	hypothetical protein	NA	A0A0S2SXM1	Bacillus_phage	43.9	6.6e-22
WP_014369000.1|1669074_1670688_+	fibronectin type III domain-containing protein	NA	A0A2D1GD28	Mycobacterium_phage	46.5	8.4e-07
WP_014369001.1|1670743_1671046_+	hypothetical protein	NA	A0A0S2SXQ2	Bacillus_phage	45.7	6.4e-09
WP_014369002.1|1671242_1675685_+|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	35.4	1.4e-75
WP_014369003.1|1675677_1676529_+|tail	phage tail family protein	tail	A0A2I7SBZ7	Paenibacillus_phage	32.6	6.8e-40
WP_014369004.1|1676531_1677659_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	32.6	1.1e-50
WP_014369005.1|1677660_1679373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369006.1|1679384_1679660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369007.1|1679680_1679824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369008.1|1679854_1680193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369010.1|1681594_1681990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369012.1|1682264_1682900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014369013.1|1683385_1683952_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_148279737.1|1684059_1684926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369015.1|1685051_1685525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369016.1|1685521_1686067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369017.1|1686124_1686322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014369019.1|1687281_1688052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014369020.1|1689079_1689496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148279668.1|1689510_1689618_+	signal peptide protein	NA	NA	NA	NA	NA
WP_063720036.1|1689614_1689695_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_014369021.1|1689727_1691398_+	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_014369022.1|1691429_1693460_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.6	2.1e-26
WP_014369023.1|1693479_1694049_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_014369024.1|1694134_1696453_+	histidine kinase	NA	NA	NA	NA	NA
WP_014369025.1|1696530_1698060_+	DUF4118 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.7	8.8e-14
WP_014369026.1|1698056_1698758_+	response regulator	NA	NA	NA	NA	NA
WP_014369027.1|1699108_1699438_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014369029.1|1699796_1700120_+	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_014369030.1|1700159_1700918_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	9.0e-28
WP_014369031.1|1700917_1701688_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_148279669.1|1701707_1702271_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014369033.1|1703482_1703866_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014369034.1|1703862_1704690_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_014369035.1|1705254_1706052_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_013914865.1|1707679_1709755_+	serine hydrolase	NA	A0A023ZXL4	Mycobacterium_phage	23.0	3.2e-06
1706516:1706537	attR	TTTGCCCCCTTTTTGCCCCCCA	NA	NA	NA	NA
WP_014369036.1|1710604_1711261_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014368330.1|1713096_1713774_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	43.0	4.9e-41
WP_014368331.1|1713944_1714652_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	59.7	1.9e-75
>prophage 2
NC_016935	Paenibacillus mucilaginosus 3016, complete sequence	8739048	3407286	3417726	8739048		Staphylococcus_phage(50.0%)	10	NA	NA
WP_013916445.1|3407286_3407718_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.7	4.2e-22
WP_014370016.1|3408318_3409431_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	40.3	3.7e-54
WP_013916447.1|3409469_3410138_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.4	7.0e-40
WP_013916448.1|3410202_3411441_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.0	9.3e-115
WP_013916449.1|3411477_3411948_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.4	5.8e-41
WP_013916450.1|3411990_3412776_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.6	6.3e-08
WP_013916451.1|3412744_3413362_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.6	1.4e-15
WP_013916452.1|3413484_3414168_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_014370017.1|3414316_3414826_+	GerW family sporulation protein	NA	NA	NA	NA	NA
WP_014370018.1|3415260_3417726_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.6	9.8e-23
>prophage 3
NC_016935	Paenibacillus mucilaginosus 3016, complete sequence	8739048	6455366	6492424	8739048	tail,terminase,capsid,integrase,plate	Listeria_phage(24.14%)	54	6459149:6459164	6493874:6493889
WP_014371562.1|6455366_6456866_-	hypothetical protein	NA	D2IYX8	Enterococcus_phage	31.6	1.5e-13
WP_014371563.1|6456881_6457520_-	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	41.1	1.9e-42
WP_014371564.1|6457516_6458692_-|plate	baseplate J/gp47 family protein	plate	A0A1L2JY69	Aeribacillus_phage	43.3	1.1e-85
WP_014371565.1|6458681_6459053_-	DUF2634 domain-containing protein	NA	A8ATI1	Listeria_phage	36.1	3.4e-12
WP_014371566.1|6459049_6459433_-	hypothetical protein	NA	NA	NA	NA	NA
6459149:6459164	attL	CCGCTCCGCGACAACC	NA	NA	NA	NA
WP_014371567.1|6459432_6460329_-	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	33.0	1.2e-34
WP_014371568.1|6460325_6460631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081484367.1|6460630_6460801_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014371570.1|6461210_6463292_-|tail	phage tail tape measure protein	tail	A8ATA7	Listeria_phage	34.3	4.0e-41
WP_148279711.1|6463291_6463471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371571.1|6463439_6463739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371572.1|6463783_6464188_-	DUF3277 family protein	NA	A0A1L2K2P1	Aeribacillus_phage	49.2	7.7e-26
WP_014371573.1|6464200_6465217_-	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	44.6	8.0e-72
WP_014371574.1|6465222_6465702_-	hypothetical protein	NA	A0A2D1GQ35	Lysinibacillus_phage	31.8	1.5e-07
WP_148279712.1|6465694_6466090_-	hypothetical protein	NA	A0A1L2JY57	Aeribacillus_phage	33.6	4.0e-11
WP_041619526.1|6466068_6466686_-	hypothetical protein	NA	A8ATG9	Listeria_phage	43.8	5.3e-34
WP_014371577.1|6466694_6467057_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_014371578.1|6467071_6467485_-	hypothetical protein	NA	A8ATG7	Listeria_phage	39.4	7.6e-13
WP_014371579.1|6467484_6468381_-	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	50.5	7.3e-77
WP_014371580.1|6468397_6468880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371581.1|6468883_6469996_-	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	52.6	6.7e-72
WP_014371582.1|6470070_6471081_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_041619253.1|6471223_6471511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371584.1|6471727_6473098_-|capsid	minor capsid protein	capsid	A0A1I9SES4	Klebsiella_phage	30.6	1.3e-13
WP_187297971.1|6473094_6474465_-	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	47.4	5.0e-109
WP_014371586.1|6474499_6475783_-|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	76.6	1.8e-193
WP_014371587.1|6475769_6476294_-|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	47.4	3.4e-26
WP_014371589.1|6476844_6477090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371590.1|6477200_6477812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371591.1|6478154_6478526_-	hypothetical protein	NA	A0A2I7SC40	Paenibacillus_phage	49.6	9.2e-34
WP_014371593.1|6478905_6479259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014371594.1|6479318_6479492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371595.1|6479488_6479911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371596.1|6479913_6480072_-	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	45.8	2.9e-05
WP_014371597.1|6480084_6480234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371598.1|6480238_6480910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371599.1|6480916_6481405_-	hypothetical protein	NA	A0A0C5AFC9	Paenibacillus_phage	48.3	3.9e-32
WP_014371600.1|6481397_6481583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371601.1|6481582_6481744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371603.1|6481933_6483211_-	AAA family ATPase	NA	Q38152	Bacillus_phage	30.5	2.1e-45
WP_014371604.1|6483210_6484194_-	replication protein	NA	W8EKA2	Geobacillus_phage	49.2	4.5e-27
WP_148279756.1|6484218_6484833_-	3'-5' exonuclease	NA	M1I8M0	Bacillus_virus	38.2	4.0e-18
WP_014371607.1|6485029_6485929_-	recombination protein RecT	NA	W8EBF6	Geobacillus_phage	54.5	2.6e-66
WP_014371608.1|6485931_6486804_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	45.7	9.6e-66
WP_014371609.1|6486920_6487127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371610.1|6487211_6487505_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	48.1	4.4e-15
WP_014371613.1|6488051_6488291_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014371614.1|6488432_6488711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014371615.1|6488676_6488901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041619257.1|6488911_6489139_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081484346.1|6489298_6489670_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	61.2	7.3e-15
WP_014371617.1|6489679_6490744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081484347.1|6490843_6491332_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_014371618.1|6491338_6492424_+|integrase	site-specific integrase	integrase	A0A173G9H3	Propionibacterium_phage	23.7	4.2e-18
6493874:6493889	attR	CCGCTCCGCGACAACC	NA	NA	NA	NA
>prophage 4
NC_016935	Paenibacillus mucilaginosus 3016, complete sequence	8739048	8085654	8095019	8739048		Mollivirus(33.33%)	7	NA	NA
WP_014372470.1|8085654_8086698_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.8	1.3e-72
WP_051045049.1|8087904_8089413_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	2.3e-51
WP_013920974.1|8089469_8091716_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.5	5.6e-166
WP_013920975.1|8091693_8092389_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013920976.1|8092435_8092681_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	39.2	1.5e-08
WP_013920977.1|8092796_8093690_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	32.8	4.5e-42
WP_013920978.1|8093723_8095019_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	3.1e-20
