The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011013	Lactobacillus mucosae LM1 chromosome, complete genome	2326299	146876	198209	2326299	integrase,transposase	unidentified_phage(30.77%)	53	146844:146903	198183:199240
146844:146903	attL	AATGGCAGATTGCAAGAAATAACTTGAACGAATTTAATGACGTAAATTAAGCAGGAAGAT	NA	NA	NA	NA
WP_006500519.1|146876_147800_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	2.8e-31
WP_006500566.1|148025_148667_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_006500565.1|148802_149381_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_006500564.1|149534_149921_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033934783.1|149963_150875_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_006500562.1|151000_153409_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_045025293.1|153569_153935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006500560.1|154205_155000_+	acetoin reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	1.6e-11
WP_006500559.1|155114_155687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006500558.1|156015_157122_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.5	5.9e-36
WP_006500557.1|157118_157934_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.1	2.0e-09
WP_006500556.1|157930_158749_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006500555.1|158745_159819_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006500554.1|159865_161257_-	amino acid permease	NA	NA	NA	NA	NA
WP_006500553.1|161455_161872_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_033934782.1|161871_162432_+	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.9	1.9e-06
WP_006500551.1|162478_162916_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_033934728.1|163005_163449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033934727.1|163463_164285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500548.1|164364_165030_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_006500547.1|165118_166162_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_034540666.1|166378_166945_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039946003.1|166994_168275_-	GTPase HflX	NA	NA	NA	NA	NA
WP_039946002.1|168305_168953_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_039946035.1|169032_169680_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_006500542.1|169857_172161_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_039946001.1|172346_174440_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.9	1.6e-146
WP_039946000.1|174739_175663_+	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_006500538.1|176352_177588_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	54.9	3.1e-118
WP_006500536.1|178230_179784_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.1	1.1e-19
WP_158423321.1|180653_181106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006500535.1|181172_181643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052669123.1|182047_183385_-	helix-turn-helix domain-containing protein	NA	A0A0H4TJ49	Erysipelothrix_phage	38.6	3.8e-13
WP_039945996.1|183444_183780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006500532.1|183791_184115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006500531.1|184107_184326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039945995.1|184315_184561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006500529.1|184621_185311_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_006500528.1|185629_185893_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_006500527.1|185895_186087_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080890454.1|186257_186776_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006500524.1|187605_188754_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.7	1.5e-53
WP_123835535.1|189089_189437_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039945992.1|189968_190361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945991.1|190357_190693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500523.1|191215_191806_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_148313119.1|191735_192968_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_039946028.1|192948_193602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945990.1|193601_193901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045025294.1|194273_195197_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.4	1.5e-29
WP_045025295.1|195331_196462_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.1e-34
WP_052669128.1|196572_197067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500519.1|197285_198209_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	2.8e-31
198183:199240	attR	ATCTTCCTGCTTAATTTACGTCATTAAATTCGTTCAAGTTATTTCTTGCAATCTGCCATTAATATTCTTTTTAATCGATTTAGAATGTCAATGTTGGAGATATATTGATAGTTATTATCATTACTACTATTGAAAAATATATCGTCTGGTATTCCGAAGTATTGTCGATAATTCCAAATAACGTTGTAGTGAATCTTTGCTATCTGGTGACATGTTAGTTGGATTATTAAATTATCCGAATCTGGAATTTTTAGCTCCTTAGAAGAAGTTATTTCACACAAATATGCAAAGTCAGGAATGGGAGGATTAAGTTCAGCAATTGTCTTAAAGGCTTTAACTGGTTTATCATCTTTTTTCAGCTTCCTACCTTGTTGATCAATGTAATAAGCAATTCCGTTTTTGTCACGTCTAATATTGTAGTTTTCTTCGTCATCGATATGGACTGGCAACTCTTCGTTAGCTAATTTTCCGAATGGATGGTTGTTTTGTTTTACTGTGTCTTGCAGCGTATATCTAACCCTCGTAACAATTAATAATGACTTGTTGATTTTTCCTTTAATTGTTTGCCAATATCGCTTGTCAATTTTAATTACCTCACTATTTACTTTATTGCTGTGAGTAGCCAAAACTGAGAAAGAATTCTGAAACTCTTTGGAATCAGGAAACCGAGCGATAAATATGTCGCTTATATCTTTGAACATACTATTGTAATGAGCTTTATCGGAATATGTGTTTTGAGAATTGCCAGAATAACCGAGAAATTTTGAAGAAGTTTTATTAAGTGCAATATCTGTAATCATTTCTTCTAGTTCTTTATAGATAACTTTAGGAGCTGTTGATGGATATACCTTTTTGCTACCATCCGTAATCTTATTTTTATTTAACCAATCGCTAAGTGATGTTAATGAATCGTCTGTTATTGATTGACGAAGAGCTTTCTCAAATTCTTCTTCGGATTTAAAACGATTCTTTAAGGAGTCAGCGGCTTTACTGAAGCCTTTATCATTTAGAATACGACTTGCAGTTGTTTTAGAAATAGTAATATTTTCACGATTAAC	NA	NA	NA	NA
>prophage 2
NZ_CP011013	Lactobacillus mucosae LM1 chromosome, complete genome	2326299	370784	444059	2326299	tRNA,transposase,protease	Escherichia_phage(17.65%)	57	NA	NA
WP_039945898.1|370784_373040_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	41.7	3.9e-127
WP_006500175.1|373321_373510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033935213.1|373640_373907_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_006500173.1|373908_375642_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_039945897.1|375803_377012_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_039945896.1|377014_378037_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_039945895.1|378041_379061_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_006500168.1|379140_379389_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_006500167.1|386010_386352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500519.1|387254_388178_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	2.8e-31
WP_006499922.1|388286_388784_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_006499921.1|389140_389827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109588286.1|390276_391050_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_039945757.1|391317_391821_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_006499918.1|392092_393679_+	asparagine synthase B	NA	I3UL62	Ostreococcus_lucimarinus_virus	42.8	1.1e-102
WP_006499917.1|393854_394061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006499916.1|394039_394267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499915.1|394375_395812_-	MFS transporter	NA	NA	NA	NA	NA
WP_006499914.1|396259_396619_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_006499913.1|396941_398465_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_006499912.1|398559_399486_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_039945755.1|399723_400293_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	26.7	1.2e-11
WP_006499909.1|400697_401066_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_033934960.1|401224_402235_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_006499907.1|402269_403595_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.0	5.1e-34
WP_006499906.1|404218_404653_-	GtrA family protein	NA	NA	NA	NA	NA
WP_006499905.1|404652_405105_-	flavodoxin	NA	NA	NA	NA	NA
WP_006499904.1|405235_406093_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_006499903.1|406308_407229_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_006499902.1|407313_408114_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_039945752.1|408215_408869_+	sugar transferase	NA	NA	NA	NA	NA
WP_006499900.1|408884_409655_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_006499899.1|409815_410685_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.5	3.7e-102
WP_006499898.1|410696_411278_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	42.2	5.5e-33
WP_006499897.1|411289_412330_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	38.2	1.4e-58
WP_006499896.1|412403_413249_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	2.7e-33
WP_006499895.1|413339_414551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499894.1|414553_415189_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_006499893.1|415247_416057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945749.1|416071_417067_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_006499891.1|417075_417999_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_006499890.1|418013_418784_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_006499889.1|418806_420141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499888.1|420238_421360_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	77.3	4.7e-166
WP_006499887.1|421363_422788_+	flippase	NA	NA	NA	NA	NA
WP_039945743.1|423053_423923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080890457.1|424157_426902_+	peptidoglycan DD-metalloendopeptidase family protein	NA	E9LUJ4	Lactobacillus_phage	52.3	3.9e-36
WP_045025295.1|427093_428224_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.1e-34
WP_052669134.1|428278_431731_+	hypothetical protein	NA	L0P6H6	Lactobacillus_phage	27.9	8.1e-07
WP_080890458.1|431842_432328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052669137.1|432566_435992_+	KxYKxGKxW signal peptide domain-containing protein	NA	A0A059PAX1	Leuconostoc_phage	54.8	2.2e-36
WP_039946475.1|436190_437171_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	36.3	1.0e-47
WP_052669142.1|437167_438688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045025302.1|438920_440111_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	27.1	2.4e-35
WP_158423323.1|442168_442342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045025303.1|442475_443666_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.8	4.1e-35
WP_045025490.1|443729_444059_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011013	Lactobacillus mucosae LM1 chromosome, complete genome	2326299	558231	677893	2326299	tail,tRNA,capsid,protease,transposase,plate,holin,terminase,integrase,portal,head	Lactobacillus_phage(33.9%)	144	556489:556505	649126:649142
556489:556505	attL	GCCGAGCAGCTTAAGCA	NA	NA	NA	NA
WP_033935311.1|558231_558867_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_039945841.1|558893_560204_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_033935309.1|560306_561029_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_006500069.1|561177_563841_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	32.7	3.3e-48
WP_039945839.1|563974_564814_+	DNA-formamidopyrimidine glycosylase	NA	NA	NA	NA	NA
WP_006500067.1|564810_565413_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_033935305.1|565464_565938_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_006500065.1|565954_567343_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_006500064.1|567358_568285_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	35.6	1.2e-26
WP_006500063.1|568513_569026_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	4.2e-13
WP_033935301.1|569050_569248_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006500061.1|569300_569654_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_033935300.1|569796_570324_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_039945837.1|570324_571449_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_006500058.1|571475_571787_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_006500057.1|571803_572439_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_006500056.1|572431_573046_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK	NA	NA	NA	NA	NA
WP_006500055.1|573045_573402_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_006500054.1|573404_574154_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_039945834.1|574153_575299_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_006500052.1|575360_575915_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_006500051.1|575966_576143_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_006500050.1|576359_577454_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	46.8	2.1e-78
WP_006500049.1|577536_578400_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	67.9	5.6e-50
WP_006500048.1|578447_579095_-	helix-turn-helix domain-containing protein	NA	Q9G0C2	Lactococcus_phage	51.3	4.2e-42
WP_039945831.1|579252_579489_+	helix-turn-helix transcriptional regulator	NA	A0A2K9VBT6	Staphylococcus_phage	50.6	4.3e-13
WP_006500046.1|579493_580276_+	Rha family transcriptional regulator	NA	E9LUL6	Lactobacillus_phage	68.1	3.5e-99
WP_006500045.1|580288_580477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500044.1|580479_580794_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_158423324.1|580917_581085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500042.1|581116_581905_+	ParB N-terminal domain-containing protein	NA	A0A141E1C9	Streptococcus_phage	29.2	6.3e-16
WP_006500040.1|582054_582555_+	siphovirus Gp157 family protein	NA	H2BDF7	Pseudomonas_virus	29.9	8.4e-06
WP_006500039.1|582554_583253_+	DUF1071 domain-containing protein	NA	X2CXM9	Lactobacillus_phage	46.9	4.0e-38
WP_006500038.1|583252_583687_+	single-stranded DNA-binding protein	NA	Q0ILF5	Lactococcus_phage	51.3	3.5e-32
WP_006500037.1|583686_584370_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	57.3	3.4e-66
WP_039945829.1|584373_584583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945827.1|584579_584828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158423337.1|585073_585703_+	conserved phage C-terminal domain-containing protein	NA	B8R680	Lactobacillus_phage	60.6	2.8e-22
WP_006500034.1|585713_586544_+	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	38.5	8.4e-43
WP_006500033.1|586555_586780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158423325.1|586782_586956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500031.1|586980_587163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052669329.1|587162_587606_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	45.5	4.5e-27
WP_006500030.1|587595_588096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500029.1|588098_588353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500028.1|588336_588606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500027.1|588752_588932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052669161.1|588945_589233_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	50.6	3.0e-16
WP_052669164.1|589235_589622_+	helix-turn-helix transcriptional regulator	NA	O34051	Streptococcus_phage	49.3	1.7e-06
WP_006500025.1|589692_590184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945822.1|591350_591851_+	hypothetical protein	NA	L0P6X1	Lactobacillus_phage	46.2	2.2e-22
WP_039945820.1|591932_592475_+	HNH endonuclease	NA	L0P6F5	Lactobacillus_phage	42.1	9.6e-40
WP_006500023.1|592530_593766_+|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	56.8	6.2e-135
WP_148313156.1|593824_595222_+|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	46.9	4.6e-110
WP_006500021.1|595211_596609_+|capsid	minor capsid protein	capsid	Q6SED6	Lactobacillus_prophage	42.6	9.3e-95
WP_039945818.1|596614_596842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945816.1|596910_597243_+	YjcQ family protein	NA	Q6SED4	Lactobacillus_prophage	61.8	4.1e-33
WP_052669167.1|597423_598086_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	43.0	4.1e-16
WP_006500017.1|598088_598919_+|capsid	N4-gp56 family major capsid protein	capsid	Q9AZ61	Lactococcus_phage	62.3	2.3e-85
WP_006500016.1|598929_599286_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	58.5	1.6e-27
WP_006500015.1|599286_599595_+	hypothetical protein	NA	A0A0N7IR97	Lactobacillus_phage	50.5	8.5e-17
WP_039945814.1|599587_599974_+	phage protein	NA	A0A0A1ENQ3	Lactobacillus_phage	48.4	1.7e-22
WP_039945812.1|599990_600383_+	phage major structural protein	NA	A0A0A1EN91	Lactobacillus_phage	48.8	6.7e-27
WP_006500013.1|600393_600984_+|tail	phage tail protein	tail	A0A0A1ELH3	Lactobacillus_phage	52.6	1.0e-47
WP_006500012.1|600995_601343_+|tail	tail assembly chaperone	tail	A0A0P0IJV9	Lactobacillus_phage	48.7	6.2e-24
WP_006500011.1|601384_601777_+	hypothetical protein	NA	A0A1B0Y2Q4	Lactobacillus_phage	40.7	4.1e-16
WP_006500010.1|601778_603992_+	tape measure protein	NA	A0A2H4J016	uncultured_Caudovirales_phage	70.1	3.3e-54
WP_006500009.1|603991_604753_+	hypothetical protein	NA	Q6SEC3	Lactobacillus_prophage	46.0	3.0e-55
WP_006500008.1|604752_607044_+|tail	phage tail protein	tail	Q6SEC2	Lactobacillus_prophage	45.1	5.6e-182
WP_006500007.1|607043_607220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500006.1|607234_608596_+|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_006500005.1|608616_609126_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_080890459.1|609141_609594_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_039945810.1|609609_610053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006500002.1|610069_610438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148313122.1|610455_610590_+	XkdX family protein	NA	A0A1W6JQM1	Staphylococcus_phage	48.8	2.5e-05
WP_045025499.1|610707_611109_+|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	42.0	6.3e-20
WP_039945807.1|611086_612025_+	SH3 domain-containing protein	NA	Q6SE63	Lactobacillus_prophage	40.7	5.0e-52
WP_006499998.1|612082_613144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499997.1|613276_613621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039945805.1|613632_614199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499995.1|614638_615325_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	2.3e-30
WP_006499994.1|615344_616829_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	3.0e-27
WP_147648935.1|616892_618140_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_006499992.1|618410_618821_-	peptide deformylase	NA	NA	NA	NA	NA
WP_006499991.1|618906_619857_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_006499990.1|619946_620219_-	acylphosphatase	NA	NA	NA	NA	NA
WP_006499989.1|620313_621087_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_006499988.1|621215_621743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045025309.1|621764_622103_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006499986.1|622409_623456_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	1.4e-26
WP_006499985.1|623461_625894_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_006499984.1|625961_626330_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_006499983.1|626396_627050_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.6	4.9e-38
WP_006499982.1|627146_627623_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_143112705.1|627755_628133_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_148313157.1|628132_630043_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	1.9e-90
WP_006499979.1|630289_632917_-	YfhO family protein	NA	NA	NA	NA	NA
WP_006499978.1|633151_635215_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_033935278.1|635359_635509_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_006499977.1|635516_635684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039945800.1|635863_636418_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_006499975.1|636420_637083_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_006499974.1|637079_637319_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_006499973.1|637357_638332_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_174435173.1|638443_638851_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_006499971.1|638905_639082_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_039945797.1|639169_640093_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_006499969.1|640297_641641_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.6	1.2e-09
WP_006499967.1|642085_642970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034540496.1|642959_644000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033935194.1|644001_644553_+	dUTP diphosphatase	NA	NA	NA	NA	NA
WP_052669171.1|645321_646455_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	29.9	6.3e-33
WP_006499963.1|646521_647217_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	55.2	1.7e-12
WP_039945795.1|647347_647572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499961.1|647571_647832_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039945792.1|647895_648828_+	hypothetical protein	NA	Q8SDH3	Lactococcus_phage	56.9	2.5e-27
WP_052669175.1|648843_649710_+	AAA family ATPase	NA	E9LUM7	Lactobacillus_phage	33.0	5.9e-31
649126:649142	attR	GCCGAGCAGCTTAAGCA	NA	NA	NA	NA
WP_039945791.1|649911_651429_+	AAA family ATPase	NA	A0A2I7R7D8	Vibrio_phage	33.7	3.9e-54
WP_006499957.1|651690_652020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499956.1|652034_652538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045025310.1|652656_653787_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.6	1.3e-35
WP_158423326.1|653807_656096_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_039946188.1|656287_656665_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_006500918.1|656664_656952_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_039946187.1|656951_658895_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.9	8.7e-91
WP_006500916.1|659084_659735_-	TenA family protein	NA	NA	NA	NA	NA
WP_003676621.1|659924_660524_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.2	2.8e-24
WP_148313123.1|660460_661369_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	27.6	8.9e-14
WP_002816262.1|661559_661991_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_039945234.1|662242_664396_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	5.1e-60
WP_080890461.1|667733_667898_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_167541570.1|667916_668063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499427.1|668401_669058_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_006499426.1|669195_669888_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.6	2.6e-29
WP_045025311.1|669884_670274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148313124.1|671026_671887_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.0	3.9e-19
WP_006499559.1|672030_672918_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.0	2.9e-17
WP_006499560.1|672932_673736_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_006499561.1|673767_674223_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_080890462.1|674250_674508_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	40.6	2.8e-05
WP_013437565.1|675574_675928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006499564.1|677251_677560_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_006499565.1|677572_677893_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 4
NZ_CP011013	Lactobacillus mucosae LM1 chromosome, complete genome	2326299	1425937	1434391	2326299	tRNA	Staphylococcus_phage(50.0%)	8	NA	NA
WP_045025409.1|1425937_1427026_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.0	2.3e-56
WP_045025410.1|1427059_1427596_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_045025411.1|1428040_1428883_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.6	5.2e-16
WP_045025551.1|1429082_1429721_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_045025412.1|1429717_1430212_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	34.8	3.6e-25
WP_033934748.1|1430223_1431186_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.8	5.9e-117
WP_045025413.1|1431263_1433177_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	6.4e-54
WP_045025414.1|1433176_1434391_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.5	1.5e-45
>prophage 5
NZ_CP011013	Lactobacillus mucosae LM1 chromosome, complete genome	2326299	1952316	1960585	2326299		Streptococcus_phage(50.0%)	7	NA	NA
WP_006500398.1|1952316_1952910_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	2.1e-56
WP_006500399.1|1952962_1953901_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	1.6e-50
WP_006500400.1|1953919_1954909_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	53.3	7.5e-91
WP_006500401.1|1954921_1955791_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	27.7	1.4e-08
WP_006500402.1|1955924_1956677_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	33.3	4.3e-22
WP_006500403.1|1956677_1957583_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_006500404.1|1957732_1960585_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	3.8e-305
>prophage 6
NZ_CP011013	Lactobacillus mucosae LM1 chromosome, complete genome	2326299	2187324	2195872	2326299		Synechococcus_phage(33.33%)	8	NA	NA
WP_006499348.1|2187324_2187915_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	9.2e-28
WP_006499347.1|2187928_2188975_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.6	1.3e-64
WP_006499346.1|2188971_2190441_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	2.5e-58
WP_006499345.1|2190416_2192645_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	2.0e-147
WP_006499344.1|2192650_2193331_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_006499343.1|2193331_2193580_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_006499342.1|2193584_2194301_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	37.0	1.6e-37
WP_006499341.1|2194573_2195872_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.3	2.7e-19
>prophage 1
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	0	6155	108311		Oenoccocus_phage(33.33%)	6	NA	NA
WP_039946422.1|390_1668_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6EVN0	Oenoccocus_phage	57.4	6.7e-124
WP_006501037.1|1871_2885_-	hypothetical protein	NA	A0A0U1ZU90	Staphylococcus_phage	37.3	6.8e-47
WP_006501038.1|2903_3587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501039.1|3604_4987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501040.1|5006_5402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501041.1|5414_6155_-	hypothetical protein	NA	A0A0H3V0Q5	Geobacillus_virus	35.4	2.0e-27
>prophage 2
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	10926	20442	108311	tail	Brevibacillus_phage(100.0%)	1	NA	NA
WP_039946330.1|10926_20442_-|tail	phage tail tape measure protein	tail	A0A0K2FL55	Brevibacillus_phage	22.4	2.1e-20
>prophage 3
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	23879	33090	108311		Lactobacillus_phage(40.0%)	8	NA	NA
WP_052669353.1|23879_24239_-	hypothetical protein	NA	A0A2H4PBB2	Lactobacillus_phage	55.6	9.0e-10
WP_006501051.1|24243_24519_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_006501052.1|24645_24933_-	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	45.2	1.8e-08
WP_006501053.1|25000_25189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148313174.1|25181_25514_-	hypothetical protein	NA	V9QJA4	Oenococcus_phage	40.8	1.0e-12
WP_045025660.1|25528_30766_-	hypothetical protein	NA	E4ZFN3	Streptococcus_phage	24.6	4.5e-09
WP_045025661.1|30878_31850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039946343.1|31989_33090_-	fibronectin type III domain-containing protein	NA	A0A0H3UZ43	Geobacillus_virus	35.8	6.6e-11
>prophage 4
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	36705	42990	108311	terminase	Bacillus_phage(66.67%)	5	NA	NA
WP_006501062.1|36705_37689_-	hypothetical protein	NA	A0A218KCB5	Bacillus_phage	30.3	6.6e-39
WP_006501063.1|37708_38158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501064.1|38190_39855_-	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	31.7	1.7e-34
WP_006501065.1|39864_41409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148313175.1|41421_42990_-|terminase	terminase	terminase	A0A1P8CWR6	Bacillus_phage	41.8	3.0e-102
>prophage 5
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	49145	49988	108311		Enterococcus_phage(100.0%)	1	NA	NA
WP_039946353.1|49145_49988_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	42.3	2.7e-49
>prophage 6
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	56861	57182	108311		Staphylococcus_phage(100.0%)	1	NA	NA
WP_006501077.1|56861_57182_+	hypothetical protein	NA	A0A060AF46	Staphylococcus_phage	45.3	3.7e-07
>prophage 7
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	63965	64418	108311		Lactobacillus_phage(100.0%)	1	NA	NA
WP_039946373.1|63965_64418_+	hypothetical protein	NA	F8J1H2	Lactobacillus_phage	45.8	9.9e-06
>prophage 8
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	69442	84558	108311	transposase	Lactobacillus_phage(37.5%)	14	NA	NA
WP_006501093.1|69442_70570_+	hypothetical protein	NA	A0A218KBY0	Bacillus_phage	27.4	7.2e-05
WP_039946382.1|70595_71540_+	AAA family ATPase	NA	Q332H0	Clostridium_botulinum_C_phage	38.1	3.4e-40
WP_045025675.1|71738_72842_+	metallophosphoesterase family protein	NA	A0A218KCD4	Bacillus_phage	38.1	2.9e-59
WP_006501096.1|72844_73576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006501097.1|73579_73867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006501098.1|73882_75373_+	replication protein	NA	Q332G8	Clostridium_botulinum_C_phage	31.1	8.5e-62
WP_006501099.1|75557_76109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039946386.1|76086_76395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006501101.1|76395_78645_+	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	32.0	1.4e-84
WP_006501102.1|78648_78990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039946389.1|79587_80328_+	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	94.3	2.4e-134
WP_158423339.1|80398_80566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006501104.1|82001_83306_+|transposase	transposase	transposase	A0A2K9VD29	Lactobacillus_phage	45.7	9.0e-92
WP_039946394.1|83841_84558_+	deoxynucleoside kinase	NA	A0A2K9VCW4	Lactobacillus_phage	68.4	3.1e-86
>prophage 9
NZ_CP011014	Lactobacillus mucosae LM1 plasmid pLM1, complete sequence	108311	87632	107369	108311		Lactobacillus_phage(42.86%)	29	NA	NA
WP_045025666.1|87632_87989_+	hypothetical protein	NA	A0A0A7NQQ2	Lactobacillus_phage	58.3	8.0e-27
WP_039946299.1|87981_88269_+	hypothetical protein	NA	A0A0A7NTY8	Lactobacillus_phage	57.0	1.2e-25
WP_039946300.1|88271_88517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039946302.1|88529_88790_+	hypothetical protein	NA	A0A0A7NNI8	Lactobacillus_phage	52.3	3.7e-13
WP_039946304.1|88805_89042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006501017.1|89056_89629_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_006501018.1|89637_89865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052669366.1|89959_90418_+	hypothetical protein	NA	O03945	Lactobacillus_phage	32.6	6.1e-11
WP_006501019.1|91354_91978_-	thymidine kinase	NA	A0A1W6JKV9	Lactococcus_phage	54.6	1.6e-51
WP_006501020.1|91997_92441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039946305.1|92443_92635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039946308.1|92841_93072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501022.1|93132_93477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039946310.1|93502_93886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501023.1|93900_95172_-	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	45.0	3.2e-33
WP_039946312.1|95189_95585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501025.1|95578_96280_-	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	56.1	4.5e-74
WP_006501026.1|96319_96463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006501027.1|96820_97609_-	DNA cytosine methyltransferase	NA	A0A191KBU6	Streptococcus_virus	44.3	6.3e-56
WP_006501028.1|97767_98007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052669371.1|98014_98491_-	DUF1064 domain-containing protein	NA	A0A1I9KKZ1	Lactobacillus_phage	54.8	4.2e-39
WP_148313184.1|98595_99936_-	ligase	NA	A0A0H3UZH0	Geobacillus_virus	39.3	3.1e-79
WP_148313181.1|99958_100375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148313182.1|100408_103684_-	DNA polymerase III subunit alpha	NA	A0A218KC91	Bacillus_phage	35.5	4.3e-191
WP_052669369.1|103702_104287_-	hypothetical protein	NA	A0A1S5SCI4	Streptococcus_phage	34.0	2.7e-11
WP_148313183.1|104340_105483_-	PD-(D/E)XK nuclease family protein	NA	Q332G6	Clostridium_botulinum_C_phage	30.6	2.1e-36
WP_039946319.1|105524_105932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039946322.1|105945_106344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039946324.1|106325_107369_-	DNA primase	NA	Q332G7	Clostridium_botulinum_C_phage	32.2	1.1e-36
