The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016894	Acetobacterium woodii DSM 1030, complete sequence	4044777	144479	152177	4044777	transposase,integrase	Bacillus_phage(50.0%)	8	148003:148016	155627:155640
WP_014354544.1|144479_145988_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.8	2.7e-55
WP_083837915.1|146603_147203_-|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	33.0	2.5e-20
WP_014354546.1|147569_148106_+	hypothetical protein	NA	NA	NA	NA	NA
148003:148016	attL	AAAAAGCCATAAAG	NA	NA	NA	NA
WP_014354547.1|148252_149512_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	27.6	1.3e-15
WP_014354548.1|149504_150305_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014354549.1|150381_150804_-|integrase	phage integrase	integrase	A0A0U3U8Y8	Bacillus_phage	33.3	2.4e-06
WP_041669838.1|150924_151104_-	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	41.7	9.6e-05
WP_014354551.1|151418_152177_-	phage antirepressor KilAC domain-containing protein	NA	A0A0H4TEY4	Erysipelothrix_phage	39.3	9.6e-38
155627:155640	attR	CTTTATGGCTTTTT	NA	NA	NA	NA
>prophage 2
NC_016894	Acetobacterium woodii DSM 1030, complete sequence	4044777	1920565	1933851	4044777		Synechococcus_phage(25.0%)	9	NA	NA
WP_014356016.1|1920565_1922707_-	diguanylate cyclase	NA	A0A220YL79	Alteromonas_virus	31.9	4.9e-10
WP_014356017.1|1922788_1923487_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014356018.1|1923769_1927495_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.3	3.0e-31
WP_014356019.1|1927574_1928069_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	9.1e-29
WP_014356020.1|1928104_1928812_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.2	6.9e-46
WP_014356021.1|1928892_1930281_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.3	6.2e-59
WP_014356022.1|1930362_1931418_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SCX2	Cyanophage	44.1	7.3e-68
WP_014356023.1|1931399_1932056_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	3.6e-25
WP_014356024.1|1932321_1933851_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.5	6.6e-70
>prophage 3
NC_016894	Acetobacterium woodii DSM 1030, complete sequence	4044777	3570878	3589662	4044777	capsid,integrase,tail,protease,terminase,holin	Clostridium_phage(64.29%)	22	3584210:3584223	3590252:3590265
WP_014357413.1|3570878_3571313_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	45.8	1.5e-22
WP_014357414.1|3571412_3571565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669151.1|3571581_3571914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357416.1|3571917_3573210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357417.1|3573211_3574237_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	50.6	6.4e-61
WP_014357418.1|3574250_3575339_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	34.8	1.7e-59
WP_014357419.1|3575340_3576204_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	44.4	5.1e-59
WP_014357420.1|3576213_3579543_-|tail	phage tail tape measure protein	tail	G4KNQ9	Staphylococcus_phage	48.8	1.3e-107
WP_014357421.1|3579532_3579802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357422.1|3579864_3580269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357423.1|3580273_3581116_-	chitobiase/beta-hexosaminidase C-terminal domain-containing protein	NA	A0A0U4IS63	Bacillus_phage	47.6	3.7e-46
WP_041669153.1|3581230_3581479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669156.1|3581468_3581927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357813.1|3581889_3582225_-	hypothetical protein	NA	Q0H236	Geobacillus_phage	37.9	8.4e-10
WP_014357427.1|3582225_3582528_-	DNA-packaging protein	NA	A0A1L2BY95	Clostridium_phage	51.6	8.3e-17
WP_014357428.1|3582569_3583805_-|capsid	phage major capsid protein	capsid	A0A290FZS5	Caldibacillus_phage	50.6	6.7e-105
WP_014357429.1|3583797_3584571_-|protease	Clp protease ClpP	protease	A0A1L2BY92	Clostridium_phage	44.2	3.1e-47
3584210:3584223	attL	GATGCGGAATCCAT	NA	NA	NA	NA
WP_014357431.1|3585758_3587414_-|terminase	terminase large subunit	terminase	A0A0A8WI49	Clostridium_phage	68.7	7.8e-226
WP_014357815.1|3587410_3587794_-	hypothetical protein	NA	A0A1L2BY96	Clostridium_phage	51.6	4.7e-25
WP_014357433.1|3587896_3588628_-	HNH endonuclease	NA	A0A0A8WJ48	Clostridium_phage	44.1	1.6e-18
WP_014357817.1|3588629_3588887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052307152.1|3589098_3589662_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	67.2	9.0e-65
3590252:3590265	attR	ATGGATTCCGCATC	NA	NA	NA	NA
>prophage 4
NC_016894	Acetobacterium woodii DSM 1030, complete sequence	4044777	3880300	3943307	4044777	transposase,integrase,protease,bacteriocin	Bacillus_phage(30.0%)	58	3941031:3941060	3947082:3947111
WP_014357715.1|3880300_3880726_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	9.9e-24
WP_145972751.1|3880741_3880975_-	hypothetical protein	NA	A0A1X9I5T2	Streptococcus_phage	61.5	3.4e-18
WP_169314715.1|3882236_3882389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357717.1|3883126_3883984_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_193353297.1|3884139_3884775_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_145972752.1|3885499_3885733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145972753.1|3885810_3886068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014357721.1|3886087_3887551_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.3	3.1e-48
WP_014357722.1|3887620_3888112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014357723.1|3888419_3889388_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041669496.1|3889472_3890066_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014357725.1|3890224_3892222_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041669499.1|3892526_3893228_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	50.2	1.7e-57
WP_014357727.1|3893227_3893989_+	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_014357728.1|3893985_3894714_+	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_014357729.1|3894729_3895404_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	1.7e-30
WP_014357730.1|3895379_3896711_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_145972736.1|3897012_3898132_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	58.0	3.0e-88
WP_014357731.1|3898129_3898597_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_169314716.1|3899849_3905132_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_014357733.1|3905420_3905669_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_014357734.1|3906051_3908538_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169314717.1|3909259_3909646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169314718.1|3909680_3909833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357737.1|3909921_3911073_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_169314719.1|3911635_3911746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357740.1|3911883_3912087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357742.1|3912901_3914134_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014357743.1|3914135_3915842_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014357744.1|3916128_3916794_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145972754.1|3917218_3917404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014357746.1|3917446_3917704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669503.1|3917874_3918249_-	PH domain-containing protein	NA	A6N235	Microbacterium_phage	69.2	1.0e-40
WP_041669509.1|3919016_3919394_-	RidA family protein	NA	NA	NA	NA	NA
WP_041669511.1|3919421_3920609_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014357751.1|3920617_3921913_-	amino acid permease	NA	NA	NA	NA	NA
WP_014357752.1|3922066_3922525_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014357753.1|3922978_3923278_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014357754.1|3923513_3923657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357755.1|3923749_3924016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669514.1|3924111_3924525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357756.1|3924612_3926823_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	24.9	6.3e-21
WP_052307121.1|3926839_3929020_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	23.2	4.2e-25
WP_041669518.1|3929030_3929513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669524.1|3929737_3930775_-	dihydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_041671669.1|3930887_3931721_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014357761.1|3931980_3932460_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041669529.1|3932608_3933013_-	GFA family protein	NA	NA	NA	NA	NA
WP_014357763.1|3933163_3934051_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014357764.1|3934188_3935043_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041669534.1|3935160_3936198_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014357766.1|3936434_3936581_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_145972755.1|3936713_3937040_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041669537.1|3937161_3937971_+	EFR1 family ferrodoxin	NA	NA	NA	NA	NA
WP_014357768.1|3938292_3938850_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014357769.1|3939017_3940991_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
3941031:3941060	attL	TTAGGTAATTGCGAAAATGCCGTGAGCTTT	NA	NA	NA	NA
WP_014354546.1|3941364_3941901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014354547.1|3942047_3943307_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	27.6	1.3e-15
3947082:3947111	attR	TTAGGTAATTGCGAAAATGCCGTGAGCTTT	NA	NA	NA	NA
>prophage 5
NC_016894	Acetobacterium woodii DSM 1030, complete sequence	4044777	3956431	4006028	4044777	capsid,integrase,tail,protease,portal,terminase,transposase,holin	Clostridium_phage(41.94%)	67	3961017:3961032	4005738:4005753
WP_014357783.1|3956431_3956944_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	59.4	3.8e-54
WP_014357784.1|3957844_3960106_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.7	2.5e-137
WP_014357785.1|3960118_3960541_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041669558.1|3960918_3961776_+|transposase	transposase	transposase	NA	NA	NA	NA
3961017:3961032	attL	GAAATCTCTTTCCAGA	NA	NA	NA	NA
WP_014354548.1|3962029_3962830_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014354547.1|3962822_3964082_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	27.6	1.3e-15
WP_014354546.1|3964228_3964765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357788.1|3964943_3965609_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014357790.1|3965837_3966272_-	HD domain-containing protein	NA	A0A0F7L746	uncultured_marine_virus	56.2	1.4e-28
WP_014357791.1|3966551_3966737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357792.1|3966908_3967769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145972736.1|3968744_3969865_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	58.0	3.0e-88
WP_169314721.1|3970307_3970664_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014357796.1|3970836_3971217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357797.1|3971335_3972058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145972736.1|3974203_3975323_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	58.0	3.0e-88
WP_014357798.1|3975403_3976159_-	DNA adenine methylase	NA	A0A2H4IYF4	uncultured_Caudovirales_phage	55.5	7.8e-80
WP_041669567.1|3976275_3977268_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	29.5	6.3e-05
WP_014357800.1|3977269_3977701_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	44.2	1.6e-21
WP_014357801.1|3977738_3977891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145972826.1|3977909_3978167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357803.1|3978243_3979518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357804.1|3979519_3980545_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	51.0	3.4e-62
WP_014357805.1|3980558_3981647_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	35.3	1.3e-59
WP_014357806.1|3981648_3982512_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	44.1	1.5e-58
WP_014357807.1|3982521_3985833_-|tail	phage tail tape measure protein	tail	G4KNQ9	Staphylococcus_phage	48.8	1.3e-107
WP_014357808.1|3985822_3986092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357809.1|3986154_3986559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357810.1|3986563_3987406_-	chitobiase/beta-hexosaminidase C-terminal domain-containing protein	NA	A0A0U4IS63	Bacillus_phage	47.6	3.7e-46
WP_041669587.1|3987409_3987769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669589.1|3987758_3988217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357813.1|3988179_3988515_-	hypothetical protein	NA	Q0H236	Geobacillus_phage	37.9	8.4e-10
WP_014357427.1|3988515_3988818_-	DNA-packaging protein	NA	A0A1L2BY95	Clostridium_phage	51.6	8.3e-17
WP_014357428.1|3988859_3990095_-|capsid	phage major capsid protein	capsid	A0A290FZS5	Caldibacillus_phage	50.6	6.7e-105
WP_014357429.1|3990087_3990861_-|protease	Clp protease ClpP	protease	A0A1L2BY92	Clostridium_phage	44.2	3.1e-47
WP_014357814.1|3990863_3991988_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	63.9	1.4e-138
WP_014357431.1|3992049_3993705_-|terminase	terminase large subunit	terminase	A0A0A8WI49	Clostridium_phage	68.7	7.8e-226
WP_014357815.1|3993701_3994085_-	hypothetical protein	NA	A0A1L2BY96	Clostridium_phage	51.6	4.7e-25
WP_014357433.1|3994187_3994919_-	HNH endonuclease	NA	A0A0A8WJ48	Clostridium_phage	44.1	1.6e-18
WP_014357817.1|3994920_3995178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052307153.1|3995389_3995953_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	67.2	1.2e-64
WP_169314722.1|3996005_3996146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669168.1|3996265_3996688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145972828.1|3996779_3997595_-	DNA adenine methylase	NA	Q24LC8	Clostridium_phage	41.5	4.5e-57
WP_169314723.1|3997611_3997758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357820.1|3997767_3998622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669176.1|3998618_3998888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669591.1|3998877_3999099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145972756.1|3999100_3999892_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	49.0	1.1e-63
WP_169314724.1|3999973_4000144_-	hypothetical protein	NA	A0A1J0MGB9	Staphylococcus_phage	43.8	1.8e-05
WP_041669593.1|4000136_4000343_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169314725.1|4000339_4000516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357441.1|4000516_4000702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169314726.1|4000698_4001103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052307123.1|4001041_4001347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357822.1|4001339_4002158_-	hypothetical protein	NA	I6XGC7	Burkholderia_virus	55.7	1.0e-29
WP_014357823.1|4002154_4002385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357824.1|4002442_4003147_-	hypothetical protein	NA	A0A0A7RUC6	Clostridium_phage	44.4	1.8e-46
WP_014357825.1|4003143_4003473_-	hypothetical protein	NA	A0A1L2JY32	Aeribacillus_phage	36.5	1.7e-10
WP_041669602.1|4003459_4003648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014357826.1|4003707_4004196_-	helix-turn-helix transcriptional regulator	NA	A0A1L2BY71	Clostridium_phage	39.1	2.6e-20
WP_145972829.1|4004255_4004615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669611.1|4004638_4004866_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169314727.1|4004888_4005041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169314728.1|4005050_4005206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041669615.1|4005232_4005466_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014357828.1|4005632_4006028_+	helix-turn-helix transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	33.3	8.9e-11
4005738:4005753	attR	TCTGGAAAGAGATTTC	NA	NA	NA	NA
>prophage 6
NC_016894	Acetobacterium woodii DSM 1030, complete sequence	4044777	4017850	4027704	4044777	tRNA	Streptococcus_phage(33.33%)	8	NA	NA
WP_014357839.1|4017850_4018837_-	DNA polymerase III subunit delta'	NA	A0A1L2BWV7	Bacteriophage	33.7	1.9e-17
WP_014357840.1|4018860_4019172_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_083837914.1|4019164_4021297_-	aminotransferase class V-fold PLP-dependent enzyme	NA	G3MB74	Bacillus_virus	33.8	3.7e-26
WP_014357842.1|4021422_4021749_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.4	1.2e-16
WP_014357843.1|4021808_4023755_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.9	5.8e-103
WP_014357844.1|4024106_4024949_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.1	7.9e-49
WP_014357845.1|4024949_4026338_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_014357846.1|4026348_4027704_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	45.8	1.1e-103
