The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	366057	376719	1988420		Streptococcus_phage(33.33%)	11	NA	NA
WP_006531119.1|366057_368712_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.7	1.4e-19
WP_003067449.1|368972_369323_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_014334337.1|369423_370002_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.8	1.1e-22
WP_014334338.1|369973_370519_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_006531123.1|370700_371132_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_014334339.1|371169_373407_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.1	4.8e-93
WP_006531126.1|373418_373625_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_006531127.1|373714_374341_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_006531128.1|374333_375146_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	41.1	5.2e-05
WP_006531129.1|375183_375741_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	48.7	5.3e-17
WP_014334340.1|375873_376719_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	63.5	2.3e-96
>prophage 2
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	396843	406151	1988420		Bacillus_virus(50.0%)	8	NA	NA
WP_014334352.1|396843_398229_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	29.7	1.6e-43
WP_014334353.1|398378_399206_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006531152.1|399220_400024_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014334354.1|400023_400767_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.4e-27
WP_014334355.1|401139_402054_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.4	4.7e-87
WP_014334356.1|402300_403761_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.3	3.8e-99
WP_006531157.1|403760_404585_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.6e-73
WP_014334357.1|404813_406151_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	35.2	2.1e-67
>prophage 3
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	589826	600009	1988420		Staphylococcus_phage(50.0%)	10	NA	NA
WP_006532288.1|589826_590957_+	acetylornithine transaminase	NA	B5LJF5	Mycobacterium_phage	31.5	2.8e-17
WP_006532289.1|591052_591610_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006532291.1|592153_593209_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.5	4.2e-39
WP_014334476.1|593208_593811_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	4.8e-32
WP_006532293.1|593811_594990_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.5	1.0e-102
WP_006532294.1|595001_595463_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.3	2.1e-43
WP_014334477.1|595526_596093_-	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_014334478.1|596328_597291_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	71.2	6.8e-129
WP_014334479.1|597551_599711_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	62.3	3.6e-263
WP_014334480.1|599781_600009_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.9	1.3e-11
>prophage 4
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	792424	829694	1988420	holin,capsid,portal,transposase,terminase,integrase,head,tail	Streptococcus_phage(72.5%)	51	792344:792387	830068:830111
792344:792387	attL	CCTATCATATCAAGCTTTACGGCCTGTGTGATAGGGCTTTTTTT	NA	NA	NA	NA
WP_148259538.1|792424_792913_-|integrase	tyrosine-type recombinase/integrase	integrase	M1NRJ9	Streptococcus_phage	58.0	1.1e-34
WP_014334227.1|792928_793894_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	51.3	1.3e-55
WP_014334226.1|793890_794568_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014334609.1|794621_795380_-|integrase	phage integrase	integrase	A0A1S5S8R9	Streptococcus_phage	52.4	8.4e-66
WP_148259560.1|795501_796257_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	31.1	8.2e-05
WP_014334611.1|796518_797082_-	Ltp family lipoprotein	NA	A0A1P8D5Q9	Corynebacterium_phage	50.0	7.7e-08
WP_043914466.1|797136_797337_-	hypothetical protein	NA	A0A1S5SFF2	Streptococcus_phage	71.2	1.4e-20
WP_014334613.1|797339_798146_-	helix-turn-helix transcriptional regulator	NA	M1NS52	Streptococcus_phage	62.4	3.6e-83
WP_014334615.1|798659_799208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014334616.1|799272_799458_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S7M3	Streptococcus_phage	65.6	8.1e-15
WP_014334617.1|799695_799920_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	95.9	9.4e-34
WP_043914469.1|800083_800272_+	helix-turn-helix transcriptional regulator	NA	B3GVX6	Streptococcus_phage	87.1	2.0e-24
WP_014334618.1|800285_801035_+	phage repressor protein/antirepressor Ant	NA	A0A068A1Z1	Staphylococcus_phage	55.7	3.8e-79
WP_014334619.1|801301_801613_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	71.8	1.0e-38
WP_014334620.1|801614_801791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052307178.1|801903_802269_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	61.7	3.5e-38
WP_052307179.1|802252_802771_+	DnaD domain protein	NA	A0A1S5SCN0	Streptococcus_phage	35.4	9.9e-10
WP_014334623.1|802773_803028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014334624.1|803027_803249_+	hypothetical protein	NA	C5J991	Streptococcus_phage	58.5	1.8e-13
WP_014334626.1|803394_804330_+	recombinase RecT	NA	A0A1S5S8V5	Streptococcus_phage	67.5	2.2e-108
WP_014334627.1|804322_805153_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1S5S8V6	Streptococcus_phage	72.3	3.1e-122
WP_014334628.1|805156_805483_+	hypothetical protein	NA	M1PS51	Streptococcus_phage	56.6	7.6e-24
WP_043914478.1|805697_806081_+	endodeoxyribonuclease RusA	NA	U4KJA0	Streptococcus_phage	49.6	2.4e-29
WP_167316286.1|806077_806254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014334630.1|806250_806472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014334631.1|806868_807282_+	DUF722 domain-containing protein	NA	A0A1X9I5N8	Streptococcus_phage	58.5	2.4e-38
WP_043914481.1|807631_808066_+|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	58.3	1.2e-40
WP_014334633.1|808049_809342_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	74.9	4.3e-179
WP_148259562.1|809553_810855_+|portal	phage portal protein	portal	A1EAE2	Streptococcus_phage	51.5	9.2e-121
WP_081469459.1|810823_811813_+|capsid	minor capsid protein	capsid	A1EAE3	Streptococcus_phage	87.6	4.5e-160
WP_014334636.1|811935_812250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081469438.1|812206_812497_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_014334638.1|812514_813444_+|capsid	phage major capsid protein	capsid	A0A2H4J376	uncultured_Caudovirales_phage	37.3	1.4e-46
WP_014334639.1|813463_813751_+	hypothetical protein	NA	A1EAF0	Streptococcus_phage	46.1	4.2e-10
WP_014334640.1|813753_814101_+|head,tail	phage head-tail connector protein	head,tail	A1EAF1	Streptococcus_phage	83.5	3.2e-49
WP_014334641.1|814097_814406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014334642.1|814402_814750_+	hypothetical protein	NA	A1EAF2	Streptococcus_phage	54.8	1.7e-29
WP_043914485.1|814746_815139_+	DUF3168 domain-containing protein	NA	A1EAF3	Streptococcus_phage	49.2	2.5e-29
WP_014334643.1|815740_816202_+	phage protein	NA	A1EAF5	Streptococcus_phage	59.5	1.3e-29
WP_014334644.1|816216_816534_+	hypothetical protein	NA	A1EAF6	Streptococcus_phage	48.0	2.3e-17
WP_014334645.1|816523_820573_+|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	49.0	3.6e-06
WP_014334646.1|820563_821283_+	hypothetical protein	NA	A0A1S5SA63	Streptococcus_phage	45.1	2.4e-54
WP_014334647.1|821279_822770_+|tail	phage tail protein	tail	A0A1S5SA59	Streptococcus_phage	45.0	2.7e-100
WP_081469440.1|822744_824631_+	hypothetical protein	NA	A0A1S5SA51	Streptococcus_phage	35.3	5.8e-07
WP_081469441.1|824760_825009_+	hypothetical protein	NA	B0YL75	Streptococcus_virus	88.9	1.7e-31
WP_014334650.1|825005_825248_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	67.6	1.6e-18
WP_014334651.1|825244_826099_+	peptidoglycan hydrolase	NA	B3GW20	Streptococcus_phage	72.0	5.6e-119
WP_014334652.1|826342_826759_+	DUF4065 domain-containing protein	NA	A0A0R6PCI9	Moraxella_phage	27.4	2.4e-06
WP_014334653.1|826758_827697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043914491.1|827908_828100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259539.1|828583_829694_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	2.8e-49
830068:830111	attR	CCTATCATATCAAGCTTTACGGCCTGTGTGATAGGGCTTTTTTT	NA	NA	NA	NA
>prophage 5
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	857282	865793	1988420		Bacillus_phage(33.33%)	8	NA	NA
WP_006532059.1|857282_857492_-	hypothetical protein	NA	Q7Y4M2	Streptococcus_phage	82.6	2.0e-25
WP_043914772.1|857947_858529_+	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	52.7	3.5e-48
WP_006532061.1|858567_859647_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_148259540.1|859693_860476_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006532063.1|860468_861068_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	30.6	1.1e-15
WP_014334674.1|861150_862401_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	53.2	2.1e-98
WP_006532066.1|863420_864023_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	38.5	7.0e-23
WP_014334675.1|864068_865793_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	9.2e-44
>prophage 6
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	903185	913350	1988420		Streptococcus_phage(50.0%)	10	NA	NA
WP_014334708.1|903185_903872_+	helix-turn-helix domain-containing protein	NA	E8ZDN4	Streptococcus_phage	49.6	1.3e-57
WP_014334709.1|903873_904077_+	hypothetical protein	NA	D0R0A4	Streptococcus_phage	47.7	4.6e-11
WP_014334710.1|904077_905493_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	73.4	2.0e-201
WP_014334711.1|905494_905854_+	hypothetical protein	NA	M1PLN9	Streptococcus_phage	46.6	1.8e-18
WP_014334712.1|905877_906054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014334713.1|906183_906861_+	hypothetical protein	NA	A0A2H4YF91	Aeromonas_phage	34.0	2.4e-08
WP_014334714.1|906865_911236_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SII8	Klosneuvirus	22.0	4.0e-27
WP_014334715.1|911247_912033_+	DUF4393 domain-containing protein	NA	A0A2H4J3S8	uncultured_Caudovirales_phage	29.6	1.5e-17
WP_014334716.1|912067_912334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014334717.1|912651_913350_+	GntR family transcriptional regulator	NA	A0A2H5BLU5	Streptomyces_phage	36.7	2.0e-05
>prophage 7
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	1127928	1148058	1988420	tRNA	Bacillus_phage(42.86%)	19	NA	NA
WP_014334864.1|1127928_1128774_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.4	7.4e-55
WP_006531255.1|1128818_1130045_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	22.7	1.7e-07
WP_014334865.1|1130053_1130734_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	6.2e-20
WP_014334866.1|1130736_1131372_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_014334867.1|1131471_1133244_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	4.9e-48
WP_014334868.1|1133233_1135048_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	32.0	2.0e-17
WP_006531250.1|1135051_1135492_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014334869.1|1135633_1136044_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.7	1.9e-08
WP_014334870.1|1136040_1136550_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014334871.1|1136706_1138056_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_014334872.1|1138292_1138790_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_014334873.1|1138826_1139318_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.6	9.6e-47
WP_014334874.1|1139466_1140180_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	45.7	2.2e-60
WP_014334875.1|1140172_1140550_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	61.6	1.2e-41
WP_014334876.1|1140617_1141268_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.5	7.0e-61
WP_014334877.1|1141434_1143204_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	3.7e-56
WP_014334878.1|1143206_1144946_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	4.9e-37
WP_014334879.1|1144987_1146856_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.4e-66
WP_043914542.1|1146852_1148058_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	48.0	2.1e-42
>prophage 8
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	1500762	1510613	1988420		Streptococcus_phage(75.0%)	12	NA	NA
WP_014335157.1|1500762_1501854_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	81.8	1.3e-173
WP_006532841.1|1501988_1502618_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014335158.1|1502731_1503073_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_006532843.1|1503153_1504389_-	ammonium transporter	NA	NA	NA	NA	NA
WP_014335159.1|1504745_1505612_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	78.5	1.5e-122
WP_006532845.1|1505621_1505942_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	62.3	6.9e-30
WP_014335160.1|1505934_1506735_-	signal peptidase II	NA	NA	NA	NA	NA
WP_014335161.1|1506731_1507607_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	48.6	1.2e-71
WP_014335162.1|1507626_1508253_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	67.1	1.4e-71
WP_006532849.1|1508345_1509005_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	67.0	7.3e-74
WP_014335163.1|1509138_1509849_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	3.5e-13
WP_014335164.1|1509848_1510613_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	4.7e-16
>prophage 9
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	1713027	1802369	1988420	bacteriocin,transposase,tRNA	Bacillus_phage(41.67%)	67	NA	NA
WP_015695667.1|1713027_1714038_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.2	2.7e-59
WP_043914654.1|1714052_1714487_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_015695669.1|1714470_1715163_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_015695670.1|1715351_1715582_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_015695671.1|1715583_1717266_+	ribonuclease J	NA	NA	NA	NA	NA
WP_015695672.1|1718211_1719651_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_015695673.1|1719652_1724170_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_006531908.1|1724360_1725707_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_015695674.1|1725753_1726125_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006531906.1|1726206_1726752_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_015695675.1|1726885_1728082_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_006531904.1|1728264_1729275_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006531903.1|1729474_1731553_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.8	1.6e-63
WP_004233289.1|1731754_1732225_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003066537.1|1732246_1732660_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_006531901.1|1732903_1733719_-	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	28.8	2.1e-06
WP_081469450.1|1734276_1734528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006531898.1|1734628_1735567_-	3'-5' exoribonuclease YhaM family protein	NA	NA	NA	NA	NA
WP_006531897.1|1735556_1736831_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_015695678.1|1736832_1737465_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_006531895.1|1737457_1738120_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_006531894.1|1738126_1738999_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_006531893.1|1739624_1739774_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015695681.1|1743343_1744390_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_015695682.1|1744570_1744975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015695683.1|1745011_1745125_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003066586.1|1745338_1745650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015695685.1|1745738_1745969_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_006531883.1|1746586_1746769_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015695686.1|1746794_1746995_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015695687.1|1747162_1747459_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015695689.1|1747824_1748127_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015695690.1|1748138_1748378_-|bacteriocin	garvicin Q family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015695691.1|1748650_1750798_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.6	1.6e-45
WP_015695692.1|1750809_1752204_+|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_015695693.1|1752337_1753210_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_015695694.1|1753279_1753804_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_015695695.1|1753800_1754370_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_015695696.1|1754362_1755133_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_148259532.1|1757161_1758306_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	32.6	6.1e-28
WP_015695697.1|1759019_1760816_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.4	2.8e-75
WP_009855024.1|1761434_1762373_-	class C sortase	NA	NA	NA	NA	NA
WP_015695698.1|1762517_1763954_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_015695699.1|1764044_1769057_-	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_015695700.1|1769097_1769691_-	signal peptidase I	NA	NA	NA	NA	NA
WP_012962535.1|1769677_1769935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015695701.1|1770491_1771145_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015695702.1|1772866_1774072_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_015695703.1|1774195_1775467_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_015695704.1|1775488_1777111_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_015695705.1|1777268_1778150_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015695706.1|1778204_1779470_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_015695707.1|1779462_1779702_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_006530971.1|1779728_1780991_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_006530972.1|1780987_1782526_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.1	8.0e-39
WP_006530973.1|1782541_1782664_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_167316291.1|1782673_1783834_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	30.6	8.1e-20
WP_015695709.1|1783827_1784517_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	1.4e-30
WP_006530977.1|1785792_1786509_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_015695712.1|1786899_1787073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015695713.1|1787221_1787431_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	64.6	7.7e-14
WP_002885866.1|1787561_1787696_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_015695714.1|1788124_1789477_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_015695716.1|1792844_1797518_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	NA	NA	NA	NA
WP_015695717.1|1798042_1798996_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	37.1	1.6e-37
WP_006531842.1|1800763_1801177_-	Fic family protein	NA	NA	NA	NA	NA
WP_148259552.1|1801224_1802369_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	32.6	8.0e-28
>prophage 10
NC_016826	Streptococcus infantarius subsp. infantarius CJ18, complete sequence	1988420	1963966	1972163	1988420		Staphylococcus_phage(33.33%)	9	NA	NA
WP_015695834.1|1963966_1964635_-	transglycosylase family protein	NA	Q4Z8Z7	Staphylococcus_phage	72.3	8.3e-25
WP_006531467.1|1964884_1965475_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	78.3	6.8e-23
WP_006531468.1|1965613_1966411_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_006531469.1|1966403_1967246_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	2.3e-16
WP_015695835.1|1967221_1968061_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.4	3.8e-19
WP_006531471.1|1968057_1968612_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_006531472.1|1968624_1969563_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015695836.1|1969628_1970918_-	insulinase family protein	NA	K7Z7Q1	Megavirus	27.5	6.5e-18
WP_015695837.1|1970918_1972163_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	43.7	9.5e-91
