The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	10631	140253	10145833	transposase,integrase	Mycobacterium_phage(28.57%)	109	4355:4373	111957:113113
4355:4373	attL	CAAGCTCACCCAGGAGCAG	NA	NA	NA	NA
WP_078611907.1|10631_12227_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
4355:4373	attL	CAAGCTCACCCAGGAGCAG	NA	NA	NA	NA
WP_041664655.1|12391_13669_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014668663.1|13938_14067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668664.1|14129_16040_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148282008.1|16095_16329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668665.1|16435_16774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668666.1|16949_17696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664656.1|17695_18097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664657.1|18373_19342_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014668669.1|20339_20759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493094.1|20761_21775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282009.1|22508_23000_+	hypothetical protein	NA	NA	NA	NA	NA
22499:22517	attR	CTGCTCCTGGGTGAGCTTG	NA	NA	NA	NA
WP_041664660.1|23622_24099_-	hypothetical protein	NA	NA	NA	NA	NA
22499:22517	attR	CTGCTCCTGGGTGAGCTTG	NA	NA	NA	NA
WP_014668672.1|24829_25990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668673.1|26555_27077_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014668674.1|27245_28337_-	alkene reductase	NA	NA	NA	NA	NA
WP_014668675.1|28349_28550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668676.1|28588_29155_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014668678.1|29731_30979_+	ParA family protein	NA	NA	NA	NA	NA
WP_041664662.1|30975_32013_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.3	8.1e-11
WP_014668679.1|32114_32639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668680.1|32635_33325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664663.1|33482_33977_-	hypothetical protein	NA	A0A1P8DIV6	Virus_Rctr197k	32.2	1.0e-11
WP_078611908.1|33973_34351_-	HIT domain-containing protein	NA	S5VWB9	Mycobacterium_phage	49.1	1.8e-16
WP_014668682.1|34356_34671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668683.1|34766_34949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668684.1|34978_35560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282010.1|35512_36274_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_041664664.1|36260_37028_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_148282011.1|40025_40622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668686.1|40762_41374_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_014668687.1|41385_41598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668688.1|41620_42082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668689.1|42257_44495_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015493095.1|44524_44839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668691.1|44845_45403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668692.1|45479_45968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668693.1|46364_46838_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014668694.1|47315_47816_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014668695.1|47954_48530_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148282012.1|48779_49346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014668693.1|49994_50468_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014668698.1|51569_52808_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.6	1.6e-82
WP_014668699.1|53231_53687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668700.1|53761_56467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664666.1|56645_57083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282013.1|57561_58113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009537.1|58646_59477_-	ParA family protein	NA	Q8JL10	Natrialba_phage	26.7	9.6e-07
WP_014668702.1|61039_61273_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148282014.1|62352_62940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041664669.1|63448_64135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668704.1|64781_65039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668705.1|65859_66813_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_041664670.1|67763_67997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668707.1|68065_68776_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_078611492.1|69888_70851_+	DUF2332 domain-containing protein	NA	NA	NA	NA	NA
WP_158506407.1|71265_72078_+	cytochrome P450	NA	NA	NA	NA	NA
WP_158506408.1|72545_72716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282015.1|73594_74173_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_041664672.1|74118_74658_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014668711.1|74839_76042_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041664673.1|78653_79781_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_015493101.1|80727_81936_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.2	1.9e-11
WP_086011454.1|82166_82983_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014668718.1|83005_83698_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014668720.1|84642_87042_+	protein kinase/ transcriptional regulator	NA	NA	NA	NA	NA
WP_041664674.1|88614_88980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668721.1|88976_89159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664677.1|90507_91692_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_106436792.1|91960_93508_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_078611501.1|93623_94853_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014668727.1|94992_95274_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041664678.1|95578_96046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665705.1|96042_97002_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_014668729.1|97178_98345_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_078611912.1|102226_103075_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078611505.1|103687_104800_+	DNA primase	NA	NA	NA	NA	NA
WP_041664682.1|104796_106326_+	DNA primase	NA	A0A1D8EQ76	Mycobacterium_phage	44.6	2.6e-98
WP_014668731.1|106322_106724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078611507.1|106876_107197_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_041664683.1|107310_107718_+	ester cyclase	NA	NA	NA	NA	NA
WP_041664684.1|107929_108817_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014668732.1|108894_111681_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148282015.1|111981_112560_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_041664672.1|112505_113045_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078611508.1|113121_114579_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014668735.1|114775_115546_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_167546354.1|117033_117936_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041664688.1|117892_118423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664689.1|118564_119191_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_078611514.1|119354_119693_-	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_041665707.1|120019_120850_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086011455.1|120879_121389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167546355.1|122640_123798_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_148282016.1|123942_125523_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_041664693.1|125652_126894_-	cytochrome P450	NA	NA	NA	NA	NA
WP_041664694.1|127189_128164_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_078611913.1|128463_129312_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041664696.1|129831_130065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668746.1|130089_130335_+	B-ketoadipate enol-lactone hydrolase	NA	NA	NA	NA	NA
WP_158506409.1|130561_131065_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162136153.1|130994_131144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282017.1|131162_131486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063639087.1|131722_132349_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_041664698.1|134053_134788_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051009553.1|136534_137023_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_014668752.1|137019_137382_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_041664701.1|137652_138246_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_167546356.1|138990_140253_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	159483	240040	10145833	transposase	Bacillus_phage(20.0%)	57	NA	NA
WP_014668711.1|159483_160686_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041664711.1|163639_163999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011454.1|164110_164927_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158506410.1|165771_166383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106436793.1|166573_167817_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	51.0	1.1e-73
WP_014668769.1|168112_168985_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	2.4e-40
WP_041665719.1|168981_169290_-|transposase	IS3 family transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.1	2.5e-08
WP_078611524.1|170741_170924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009782.1|174538_175330_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051009556.1|175804_176635_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014668896.1|176761_177592_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014668775.1|178415_178553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041664716.1|178845_179853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167546372.1|181733_182651_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106436794.1|183448_183919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011457.1|183935_184939_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041664717.1|185069_186254_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158506411.1|187147_189124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011615.1|189383_190268_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158506412.1|190881_191721_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051009560.1|191786_192668_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.8	7.6e-10
WP_041664719.1|193282_194797_-	DNA primase	NA	A0A222ZMD2	Mycobacterium_phage	45.1	1.3e-94
WP_167546357.1|196270_197533_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_167546354.1|197950_198853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041664688.1|198809_199340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009562.1|199495_200284_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_051009563.1|200580_201042_+	SsgA family sporulation/cell division regulator	NA	NA	NA	NA	NA
WP_041664721.1|201175_201880_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106436849.1|202080_204957_+	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_078611914.1|205207_205753_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_086011458.1|206090_206909_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041665719.1|208512_208821_+|transposase	IS3 family transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.1	2.5e-08
WP_014668769.1|208817_209690_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	2.4e-40
WP_167546358.1|209787_210927_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_086011454.1|211002_211820_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041664723.1|212859_213300_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041664724.1|214113_214596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011458.1|216518_217338_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_063639093.1|217477_217939_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014668794.1|218315_219263_+	CHRD domain-containing protein	NA	A0A2K9L200	Tupanvirus	30.3	4.2e-06
WP_051009566.1|219747_221127_-	amidase	NA	NA	NA	NA	NA
WP_014668795.1|221162_221819_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014668796.1|222082_223033_+	hydroquinone meta cleavage dioxygenase	NA	NA	NA	NA	NA
WP_014668797.1|223086_224046_+	amidohydrolase	NA	NA	NA	NA	NA
WP_051009567.1|224075_225212_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_041664726.1|225250_225883_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_078611537.1|225888_226866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664727.1|227342_228188_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014668802.1|228266_229730_-	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014668804.1|231085_231772_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_014668805.1|231768_232464_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_041664729.1|232734_233559_+	alpha/beta hydrolase	NA	A0A249XTE1	Mycobacterium_phage	27.0	9.9e-12
WP_041664731.1|233916_234531_-	NAD(P)H:quinone oxidoreductase	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	26.4	7.9e-06
WP_148282022.1|234766_235222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668808.1|235261_238021_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078611539.1|238364_238610_-	DUF2630 family protein	NA	NA	NA	NA	NA
WP_041665742.1|239209_240040_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	282409	360960	10145833	transposase	uncultured_Caudovirales_phage(28.57%)	58	NA	NA
WP_014668844.1|282409_282541_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078611546.1|282873_283191_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014668846.1|284156_284738_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_078611548.1|284734_285565_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014668848.1|285757_286030_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_041664749.1|286026_287202_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_078611549.1|287198_287996_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041664751.1|288114_289365_+	flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041664752.1|289396_289885_+	DUF1857 family protein	NA	NA	NA	NA	NA
WP_014668843.1|290197_290827_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_078611550.1|290923_291190_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041664753.1|291601_292507_-	metapyrocatechase	NA	NA	NA	NA	NA
WP_014668853.1|292927_293566_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014668854.1|293955_294426_+	DUF1857 family protein	NA	NA	NA	NA	NA
WP_014668855.1|294422_294824_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_106436796.1|295384_296628_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	52.3	2.7e-69
WP_041664754.1|297604_298498_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_041665760.1|298736_299609_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041664755.1|299912_301388_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	52.5	3.4e-111
WP_014668860.1|301422_303360_-	FUSC family protein	NA	NA	NA	NA	NA
WP_051009574.1|304492_305005_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_014668707.1|305073_305784_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014668863.1|307241_309122_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	31.2	1.5e-34
WP_014668864.1|309226_310114_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158506414.1|310885_313885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668867.1|313881_315171_+	MFS transporter	NA	NA	NA	NA	NA
WP_014668869.1|319472_320459_-	sugar kinase	NA	NA	NA	NA	NA
WP_041665763.1|320455_321301_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_014668871.1|321327_321960_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_041664757.1|321986_322769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668873.1|322765_323911_-	galactonate dehydratase	NA	NA	NA	NA	NA
WP_014668874.1|323907_324645_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014668875.1|324679_325459_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014668876.1|325514_327587_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_041664758.1|327583_328432_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_041664759.1|328431_329367_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014668879.1|329368_330658_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014668880.1|331216_332602_+	chitinase	NA	A7J8D3	Paramecium_bursaria_Chlorella_virus	29.4	1.5e-23
WP_041664761.1|332643_334860_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_014668882.1|334856_336116_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_041665765.1|336335_336725_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_078611553.1|337118_338354_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_148282024.1|338438_338852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009577.1|339138_339549_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051009579.1|340813_341185_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_167546360.1|342393_343533_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_051009798.1|343895_344138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014668735.1|344875_345646_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_014668891.1|350317_350560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_086011463.1|351023_352203_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.5	1.8e-30
WP_078611556.1|352436_353255_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	42.6	6.1e-14
WP_051009582.1|353677_354142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011463.1|354110_355291_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.5	1.8e-30
WP_148282026.1|355366_355582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014668894.1|356470_357673_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041664765.1|358068_359226_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086011454.1|359215_360033_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014668896.1|360129_360960_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	1687692	1732140	10145833	transposase,integrase	Bacillus_phage(40.0%)	43	1693413:1693428	1727624:1727639
WP_086011463.1|1687692_1688872_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.5	1.8e-30
WP_014670029.1|1690857_1691976_+	dimethyl sulfone monooxygenase SfnG	NA	NA	NA	NA	NA
WP_014670030.1|1692073_1693291_+	monooxygenase	NA	NA	NA	NA	NA
WP_014670031.1|1693346_1693583_+	FMN reductase	NA	NA	NA	NA	NA
1693413:1693428	attL	CACCTCGACGACCGGC	NA	NA	NA	NA
WP_078611627.1|1693525_1693879_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.7	5.5e-12
WP_014670034.1|1694411_1694645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670035.1|1694692_1696123_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_041664869.1|1696198_1696789_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_014670037.1|1696957_1697821_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014670038.1|1697830_1698061_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_014670039.1|1698047_1698437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670040.1|1698695_1699637_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041664870.1|1699738_1700677_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_148282050.1|1701385_1701883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670042.1|1701925_1703125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282051.1|1703884_1704109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670045.1|1704332_1704518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078611629.1|1704629_1704917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670046.1|1704997_1705981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282053.1|1706995_1707373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041664872.1|1707403_1707811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670047.1|1708561_1708702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670048.1|1709210_1709594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670049.1|1709968_1710172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670050.1|1710945_1711233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009623.1|1711523_1712042_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.0	2.8e-20
WP_014670052.1|1712508_1712940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011474.1|1713455_1714657_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.5	5.6e-32
WP_014670056.1|1715507_1715882_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014670057.1|1716196_1716550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051009625.1|1716709_1717210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014670059.1|1717492_1717708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493159.1|1717790_1718228_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051009627.1|1719700_1720060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051009630.1|1720056_1721682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041664873.1|1722352_1722874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282054.1|1723642_1723867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493160.1|1724241_1725084_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014670064.1|1725591_1726014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014670065.1|1726016_1728860_+	oligopeptide-binding lipoprotein	NA	NA	NA	NA	NA
1727624:1727639	attR	CACCTCGACGACCGGC	NA	NA	NA	NA
WP_078611633.1|1729116_1729659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011630.1|1730062_1730890_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_086011474.1|1730939_1732140_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.5	5.6e-32
>prophage 5
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	2860494	2915215	10145833	protease,tail,plate	Bacillus_phage(33.33%)	40	NA	NA
WP_014670998.1|2860494_2863290_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_014670999.1|2863378_2865760_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_014671000.1|2865909_2868681_+	SpoIIE family protein phosphatase	NA	A0A1J0MCT1	Streptomyces_phage	50.6	3.1e-09
WP_014671001.1|2868802_2869135_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014671002.1|2869387_2870131_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014671003.1|2870283_2875029_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.3e-18
WP_014671004.1|2875053_2875602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671005.1|2875689_2876157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671006.1|2876645_2877980_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_014671007.1|2877994_2878363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671008.1|2878668_2879232_+	universal stress protein	NA	NA	NA	NA	NA
WP_014671009.1|2879385_2879886_-	two-component system sensor kinase	NA	NA	NA	NA	NA
WP_014671010.1|2879887_2880571_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	7.9e-23
WP_014671011.1|2880710_2881391_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_014671012.1|2881402_2883499_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.1e-27
WP_014671013.1|2883531_2885193_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_016434100.1|2885200_2885290_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_014671014.1|2885286_2885676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671015.1|2885678_2888174_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_014671016.1|2888837_2890790_+	APC family permease	NA	NA	NA	NA	NA
WP_014671017.1|2891442_2892270_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_014671018.1|2892377_2893691_-	lipase chaperone	NA	NA	NA	NA	NA
WP_014671019.1|2893992_2894631_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014671020.1|2894908_2897002_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_014671021.1|2897011_2897707_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_014671022.1|2897703_2899830_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	40.0	7.2e-06
WP_148282074.1|2899882_2900623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671023.1|2900619_2903793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014671024.1|2904296_2905862_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.2	9.5e-72
WP_014671025.1|2905912_2906356_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_014671026.1|2906355_2906796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671027.1|2906792_2906936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671028.1|2906941_2908702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014671029.1|2908727_2909159_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015493194.1|2909162_2909960_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014671031.1|2909968_2911897_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_041664984.1|2912003_2912279_+	PAAR repeat-containing protein	NA	NA	NA	NA	NA
WP_014671033.1|2912282_2912690_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_014671034.1|2912686_2914654_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_014671035.1|2914654_2915215_+|tail	tail protein	tail	NA	NA	NA	NA
>prophage 6
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	9007314	9095270	10145833	protease,transposase,integrase	Streptomyces_phage(22.22%)	60	8998132:8998151	9100551:9100570
8998132:8998151	attL	GGGCGAGCAGGGCCAGCGCC	NA	NA	NA	NA
WP_014676466.1|9007314_9008454_-|integrase	site-specific integrase	integrase	Q1WDJ5	Streptomyces_phage	24.2	8.3e-09
WP_041665583.1|9009447_9010464_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	26.4	1.0e-05
WP_086011604.1|9010474_9010666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676467.1|9011098_9013075_+	SAM-dependent DNA methyltransferase	NA	A0A2H4UVB0	Bodo_saltans_virus	23.9	6.5e-09
WP_148282102.1|9013071_9014280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014676468.1|9014286_9017385_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_014676470.1|9018677_9021971_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_148282103.1|9022170_9022425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665584.1|9022614_9022908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676471.1|9023002_9023182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676472.1|9023456_9024833_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	55.7	3.4e-126
WP_148282104.1|9024918_9025365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676473.1|9025669_9026890_-	methyltransferase, FxLD system	NA	A0A1J0MC50	Streptomyces_phage	39.2	2.0e-21
WP_041665585.1|9026981_9028199_-	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_014676475.1|9028135_9031180_-	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014676476.1|9031254_9031437_-	FxLD family lantipeptide	NA	NA	NA	NA	NA
WP_014676477.1|9031572_9031752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676478.1|9031748_9032003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106436863.1|9032224_9032611_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_148282105.1|9032864_9034259_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078611998.1|9034387_9035140_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_148282106.1|9035306_9035633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282107.1|9035711_9037373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665586.1|9038055_9038235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665587.1|9038249_9039056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676483.1|9039089_9039374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665588.1|9040271_9040454_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014676485.1|9040868_9041051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282108.1|9041052_9041868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014676487.1|9041905_9043471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014676488.1|9043537_9044995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148282142.1|9045220_9046372_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_014676490.1|9046368_9048189_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_148282109.1|9048181_9048844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014676491.1|9048868_9049390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665591.1|9049449_9051765_+	methyltransferase domain-containing protein	NA	A0A223W0B5	Agrobacterium_phage	32.0	4.0e-66
WP_014676492.1|9051831_9066537_+	AAA family ATPase	NA	A0A248SL14	Klebsiella_phage	29.8	8.2e-117
WP_014676493.1|9066567_9067716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148282110.1|9068188_9068551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014676494.1|9068705_9069263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665593.1|9069274_9069817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676495.1|9069911_9070109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665595.1|9070428_9070629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676496.1|9071146_9071443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676497.1|9071461_9076240_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_014676498.1|9076676_9077072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014676499.1|9077144_9077513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676500.1|9077989_9082273_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_014676501.1|9082274_9082592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676502.1|9083016_9084255_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.9	6.8e-81
WP_014676503.1|9084670_9084988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676504.1|9085649_9085994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676505.1|9086114_9086540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676506.1|9086548_9086926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676507.1|9087488_9088367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676508.1|9088616_9088991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665598.1|9090949_9091474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014676511.1|9092200_9093577_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	55.0	4.7e-123
WP_041665599.1|9094212_9094752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148282143.1|9094676_9095270_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
9100551:9100570	attR	GGCGCTGGCCCTGCTCGCCC	NA	NA	NA	NA
>prophage 7
NC_017765	Streptomyces hygroscopicus subsp. jinggangensis 5008, complete sequence	10145833	9932101	9969711	10145833	transposase,integrase	Bacillus_phage(100.0%)	35	9919217:9919235	9945071:9945089
9919217:9919235	attL	CGGCCGCCCGCGCCGCCGG	NA	NA	NA	NA
WP_014677233.1|9932101_9934741_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014677234.1|9934835_9935294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041665656.1|9935356_9935923_+	DUF4240 domain-containing protein	NA	NA	NA	NA	NA
WP_014677236.1|9937183_9937411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677237.1|9937615_9938860_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014677238.1|9939360_9939534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677239.1|9939816_9941181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677240.1|9941882_9942515_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041665658.1|9942685_9943255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677242.1|9944137_9944893_+	(5-formylfuran-3-yl)methyl phosphate synthase	NA	NA	NA	NA	NA
WP_014677243.1|9944901_9946305_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
9945071:9945089	attR	CGGCCGCCCGCGCCGCCGG	NA	NA	NA	NA
WP_014677244.1|9946307_9947414_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014677245.1|9947494_9948400_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014677246.1|9948552_9949086_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_014677247.1|9949692_9949974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014677248.1|9950005_9951394_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014677249.1|9951390_9952242_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014677250.1|9952238_9953420_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014677251.1|9953554_9954928_-	MFS transporter	NA	NA	NA	NA	NA
WP_014677252.1|9955030_9955465_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014677253.1|9955455_9956499_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_086011608.1|9958001_9959203_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.7	3.7e-31
WP_014677257.1|9959356_9959584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677258.1|9960182_9960347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086011609.1|9960365_9961182_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148282122.1|9961302_9961722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014677262.1|9961714_9963880_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_041665664.1|9964558_9965131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158506455.1|9965127_9965370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158506456.1|9965430_9965562_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078611892.1|9965822_9967052_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041665666.1|9967625_9968216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014677268.1|9968296_9968554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041665667.1|9968647_9969187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148282124.1|9969132_9969711_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
