The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_019903	Desulfitobacterium dichloroeliminans LMG P-21439, complete sequence	3624449	1251372	1262835	3624449		Synechococcus_phage(25.0%)	8	NA	NA
WP_015261725.1|1251372_1255218_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.3	3.4e-38
WP_015261726.1|1255252_1255744_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.9	2.7e-25
WP_015261727.1|1255907_1257203_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.1	5.3e-20
WP_015261728.1|1257273_1257990_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	40.2	8.8e-41
WP_015261729.1|1258101_1259520_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	2.1e-57
WP_015261730.1|1259614_1260634_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	47.1	5.0e-74
WP_015261731.1|1260633_1261236_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.2	5.7e-25
WP_041219306.1|1261272_1262835_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	9.4e-80
>prophage 2
NC_019903	Desulfitobacterium dichloroeliminans LMG P-21439, complete sequence	3624449	2611633	2652571	3624449	bacteriocin,tRNA,protease	Bacillus_phage(25.0%)	38	NA	NA
WP_015262964.1|2611633_2612518_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_015262965.1|2612504_2613479_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_015262966.1|2613468_2613846_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015262967.1|2613869_2616689_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.6	3.9e-23
WP_015262968.1|2616732_2617029_-	L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_015262969.1|2617025_2617292_-	YlxR family protein	NA	NA	NA	NA	NA
WP_015262970.1|2617301_2618750_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_015262971.1|2618811_2619270_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_015262972.1|2619543_2620365_-	TIGR03915 family putative DNA repair protein	NA	NA	NA	NA	NA
WP_015262973.1|2620343_2621651_-	putative DNA modification/repair radical SAM protein	NA	NA	NA	NA	NA
WP_015262974.1|2621859_2623587_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_172635940.1|2623586_2624660_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015262976.1|2624684_2625749_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015262977.1|2625854_2626997_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_015262978.1|2627104_2628202_-	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_015262979.1|2628206_2628989_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015262980.1|2628999_2629770_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.7	5.6e-25
WP_015262981.1|2629850_2630408_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_015262982.1|2630407_2631130_-	UMP kinase	NA	NA	NA	NA	NA
WP_015262983.1|2631225_2631879_-	translation elongation factor Ts	NA	NA	NA	NA	NA
WP_015262984.1|2632039_2632777_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_015262985.1|2632931_2633375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015262986.1|2633407_2634196_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_015262987.1|2634277_2635654_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.5	4.9e-40
WP_172635941.1|2635665_2636202_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_015262989.1|2636295_2637192_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	32.9	3.4e-34
WP_015262990.1|2637236_2638550_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_015262991.1|2638551_2640642_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.9	1.4e-107
WP_041219955.1|2640786_2641950_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.3	5.1e-30
WP_015262993.1|2642192_2642750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015262994.1|2643113_2643716_-	DUF3786 domain-containing protein	NA	NA	NA	NA	NA
WP_015262995.1|2643847_2644678_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_015262996.1|2644890_2645070_+	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_015262997.1|2645153_2645585_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_015262998.1|2645888_2646383_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_041219471.1|2646534_2649384_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.4	3.1e-36
WP_015263000.1|2649422_2651600_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.5	1.5e-30
WP_015263001.1|2651632_2652571_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
>prophage 3
NC_019903	Desulfitobacterium dichloroeliminans LMG P-21439, complete sequence	3624449	3205715	3233555	3624449	transposase,integrase	Tupanvirus(22.22%)	24	3228556:3228589	3233614:3233647
WP_015263514.1|3205715_3206972_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	26.3	1.7e-31
WP_015263515.1|3207618_3209196_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1V0DZX0	Clostridioides_phage	55.8	6.3e-07
WP_015263516.1|3209398_3210403_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015263517.1|3210929_3212270_+	Ig-like domain-containing protein	NA	A0A288TYF3	Enterococcus_phage	40.9	7.0e-15
WP_015263518.1|3212395_3212629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015263519.1|3212806_3213922_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_015263520.1|3214036_3214789_-	Fic family protein	NA	NA	NA	NA	NA
WP_015263521.1|3214988_3215981_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	34.0	4.2e-49
WP_041220019.1|3216336_3216576_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_041220020.1|3216590_3216881_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_015263524.1|3216971_3217688_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_015263525.1|3217684_3220360_-	DEAD/DEAH box helicase	NA	A0A0N7D8L3	Dasychira_pudibunda_nucleopolyhedrovirus	27.4	1.1e-35
WP_015263526.1|3220783_3222079_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041220021.1|3222489_3223344_+	DUF3102 domain-containing protein	NA	NA	NA	NA	NA
WP_015263528.1|3223582_3224596_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.2	2.6e-78
WP_015263529.1|3224617_3224830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015263530.1|3224833_3225295_-	VanZ family protein	NA	NA	NA	NA	NA
WP_015263531.1|3225312_3226305_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	4.0e-52
WP_015263532.1|3226427_3226853_-	hypothetical protein	NA	NA	NA	NA	NA
3228556:3228589	attL	CTCGTCTTATGTTGAGCGATATATTATGTAGAGT	NA	NA	NA	NA
WP_015263533.1|3228704_3229640_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1J1J900	Escherichia_phage	23.2	2.7e-05
WP_015263534.1|3229626_3230604_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.4	7.9e-08
WP_051015683.1|3230606_3231290_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015263535.1|3231327_3232974_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_083879903.1|3233186_3233555_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3233614:3233647	attR	ACTCTACATAATATATCGCTCAACATAAGACGAG	NA	NA	NA	NA
