The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007053	Opitutaceae bacterium TAV5 chromosome, complete genome	7317842	750323	804310	7317842	tRNA,plate,tail,capsid,terminase,integrase,portal	Escherichia_phage(20.83%)	79	751672:751719	804475:804522
WP_009513295.1|750323_751535_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
751672:751719	attL	ATCGTAAACCGCTGGTCGTCGGTTCGACTCCGACCATCGGCTCCACTT	NA	NA	NA	NA
WP_009513296.1|751798_752824_-	late control D family protein	NA	A0A088FRU7	Escherichia_phage	35.2	3.7e-40
WP_025440399.1|752861_753074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513298.1|753063_753459_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_009513299.1|753461_755693_-	hypothetical protein	NA	A0A2I7RS59	Vibrio_phage	23.8	1.8e-07
WP_158442939.1|755756_755933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513301.1|756117_756375_-|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	40.0	1.2e-08
WP_009513302.1|756530_757028_-|tail	phage major tail tube protein	tail	A0A1W6JT38	Escherichia_phage	50.9	5.7e-39
WP_009513303.1|757087_758263_-|tail	tail protein	tail	V5YTI0	Pseudomonas_phage	51.8	1.9e-117
WP_009513304.1|758327_758570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513305.1|758566_758764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513307.1|758900_759278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513308.1|759332_759647_-	hypothetical protein	NA	A0A2I6UHP8	Bacillus_phage	56.1	4.6e-10
WP_009513309.1|759648_759804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513310.1|759782_760220_-	lectin MOA-related protein	NA	NA	NA	NA	NA
WP_009513311.1|760298_760859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513312.1|760862_761642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513313.1|761701_762658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513314.1|762660_763434_-|tail	tail collar domain protein	tail	A0A077K818	Ralstonia_phage	39.1	2.8e-08
WP_009513315.1|763430_764990_-|tail	phage tail collar domain-containing protein	tail	V5YST5	Pseudomonas_phage	43.2	1.4e-62
WP_009513316.1|764996_765701_-|tail	phage tail protein I	tail	A0A088FVH1	Escherichia_phage	39.2	4.5e-29
WP_009513317.1|765697_766585_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	56.0	1.5e-77
WP_009513318.1|766581_766932_-|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	57.5	1.1e-28
WP_009513319.1|767001_767175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513320.1|767381_767927_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	33.8	8.5e-20
WP_009513321.1|767923_768484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513322.1|768480_769131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513323.1|769127_769499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513324.1|769505_769712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513325.1|769828_771988_-|capsid	phage major capsid protein	capsid	A0A193GYA3	Enterobacter_phage	37.0	1.1e-105
WP_009513326.1|772133_773996_-|portal	phage portal protein	portal	A0A1W6JT60	Escherichia_phage	43.3	1.2e-97
WP_009513327.1|773998_774304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084149756.1|774306_776385_-|terminase	phage terminase large subunit family protein	terminase	H7BVZ9	unidentified_phage	38.0	2.8e-103
WP_009513329.1|776275_776827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513330.1|776819_778163_-	ParB N-terminal domain-containing protein	NA	R4THK0	Halovirus	43.8	2.1e-91
WP_009513331.1|778175_778925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513332.1|779098_779923_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_158442940.1|779924_780749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513334.1|780988_781411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513335.1|781882_782137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513336.1|782263_782503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513337.1|782524_782887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025440404.1|783209_783470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513339.1|783505_783898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513340.1|783962_784124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513342.1|784120_785026_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4PCB7	Arthrobacter_phage	24.5	6.2e-07
WP_009513343.1|785040_785484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513344.1|785496_785919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513345.1|785919_786372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513347.1|786373_786607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513349.1|786603_787722_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	46.5	2.0e-76
WP_009513351.1|787714_788080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513353.1|788076_788418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513354.1|788414_788810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052340594.1|788806_789091_-	hypothetical protein	NA	I3PV00	Vibrio_phage	51.1	9.2e-18
WP_025440407.1|789198_789939_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	28.9	1.3e-10
WP_009513357.1|789962_790217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513359.1|790213_790591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513361.1|790895_791318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513363.1|791314_791629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044284858.1|791702_792191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144238695.1|792193_792772_-	hypothetical protein	NA	I3UM29	Rhodobacter_phage	49.6	4.1e-20
WP_009513369.1|792723_793338_-	hypothetical protein	NA	A0A142KB10	Gordonia_phage	54.8	7.1e-39
WP_009513371.1|793362_794250_-	hypothetical protein	NA	A0A088FVF0	Escherichia_phage	26.3	2.7e-07
WP_009513374.1|794246_795596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513375.1|795656_796289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513376.1|796597_797005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144238696.1|797058_797277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513379.1|797315_797627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044285017.1|797769_798522_-	antirepressor	NA	A0A192Y918	Salmonella_phage	59.0	6.0e-24
WP_025440409.1|798766_799084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009513385.1|799134_799434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084149761.1|799451_800075_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009513389.1|800406_800982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009513391.1|801028_801379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009513393.1|801391_802210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144238697.1|802275_802821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144238698.1|802832_803132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009513398.1|803134_804310_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
804475:804522	attR	ATCGTAAACCGCTGGTCGTCGGTTCGACTCCGACCATCGGCTCCACTT	NA	NA	NA	NA
