The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	390471	395558	5333942		Escherichia_phage(33.33%)	8	NA	NA
YP_005224651.1|390471_391428_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
YP_005224652.1|391437_391809_+	plasmid stable inheritance protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
YP_005224653.1|391974_392760_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
YP_005224654.1|392816_393338_-	hypothetical protein	NA	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
YP_005224655.1|393506_393812_-	chaperone-modulator protein CbpM	NA	NA	NA	NA	NA
YP_005224656.1|393811_394729_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
YP_005224657.1|394804_394918_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005224658.1|394874_395558_-	putative transmembrane protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 2
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	581951	595336	5333942	integrase,transposase	Enterobacteria_phage(66.67%)	17	580390:580404	591988:592002
580390:580404	attL	GCGGCAGGGCGACAA	NA	NA	NA	NA
YP_005224840.1|581951_583214_+|integrase	putative P4-type integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
YP_005224841.1|583271_584282_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005224842.1|584692_584806_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005224843.1|584769_585849_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005224844.1|586053_587022_+|transposase	transposase InsC for insertion sequence IS903	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
YP_005224845.1|587434_587584_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005224846.1|587655_588222_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
YP_005224847.1|588239_588485_-	phage transcriptional activator, Ogr/delta	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
YP_005224848.1|588481_589219_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
YP_005224849.1|589779_590046_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
YP_005224850.1|590396_590591_+	phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	7.2e-22
YP_005224851.1|590587_590815_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005224852.1|590811_591132_+	P4 phage protein	NA	NA	NA	NA	NA
YP_005224853.1|591146_593480_+	nucleoside triphosphatase, D5 family	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
591988:592002	attR	TTGTCGCCCTGCCGC	NA	NA	NA	NA
YP_005224854.1|594224_594491_+|transposase	IS3 family element, transposase orfA	transposase	NA	NA	NA	NA
YP_005224855.1|594568_594724_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005224856.1|594856_595336_+|transposase	IS3 family element, transposase orfB	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	1.6e-06
>prophage 3
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	1064222	1075879	5333942	integrase	Enterobacteria_phage(70.0%)	14	1052356:1052370	1075416:1075430
1052356:1052370	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
YP_005225302.1|1064222_1066556_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.4	0.0e+00
YP_005225303.1|1066570_1066891_-	P4 phage protein	NA	NA	NA	NA	NA
YP_005225304.1|1066887_1067067_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225305.1|1067111_1067306_-	phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	3.2e-22
YP_005225306.1|1067665_1067932_-	hypothetical protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
YP_005225307.1|1068036_1068174_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225308.1|1068473_1069211_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
YP_005225309.1|1069207_1069453_+	phage transcriptional activator, Ogr/delta	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
YP_005225310.1|1069470_1070037_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
YP_005225311.1|1070605_1071031_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225312.1|1071030_1071981_-	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
YP_005225313.1|1071968_1073159_-|integrase	putative site specific integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
YP_005225314.1|1073511_1074765_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
YP_005225315.1|1074775_1075879_-	gamma-glutamyl kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1075416:1075430	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 4
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	1285434	1325764	5333942	integrase,head,tRNA,transposase	Salmonella_phage(17.95%)	54	1288314:1288360	1338717:1338763
YP_005225531.1|1285434_1286820_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
YP_005225532.1|1286862_1287075_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225533.1|1287076_1287943_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1288314:1288360	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
YP_005225534.1|1288373_1289537_-|integrase	site-specific recombinase, phage integrase family	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
YP_005225535.1|1289750_1289966_-	phage/conjugal plasmid C-4 type zinc finger protein, TraR family	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
YP_005225536.1|1290182_1290953_-	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	8.5e-66
YP_005225537.1|1290949_1291477_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	6.4e-57
YP_005225538.1|1291628_1292252_-	putative phage-like protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
YP_005225539.1|1292248_1292584_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
YP_005225540.1|1292553_1292751_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225541.1|1292762_1293047_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	61.7	1.5e-28
YP_005225542.1|1293326_1293452_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225543.1|1293850_1293973_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225544.1|1294559_1294928_-	regulatory protein CI bacteriophage origin	NA	Q76H56	Enterobacteria_phage	91.0	1.1e-60
YP_005225545.1|1295350_1295578_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
YP_005225546.1|1295617_1295839_+	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
YP_005225547.1|1295924_1296071_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225548.1|1296111_1296963_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
YP_005225549.1|1296967_1298383_+	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
YP_005225550.1|1298382_1298676_+	hypothetical protein	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
YP_005225551.1|1298672_1299179_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
YP_005225552.1|1299292_1299424_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225553.1|1299416_1300091_+	RelE family toxin-antitoxin system	NA	C6ZR30	Salmonella_phage	63.0	7.8e-07
YP_005225554.1|1300605_1301559_+	Eaa1	NA	S4TSR6	Salmonella_phage	42.8	2.5e-51
YP_005225555.1|1302059_1302515_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
YP_005225556.1|1302677_1303316_+	putative ninG protein	NA	H6WRY9	Salmonella_phage	69.3	1.4e-74
YP_005225557.1|1303488_1303611_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225558.1|1305331_1305580_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225559.1|1305582_1306113_+	hypothetical protein	NA	A0A1I9LJR4	Stx_converting_phage	79.7	9.3e-80
YP_005225560.1|1306109_1306499_+	hypothetical protein	NA	U5P0U9	Shigella_phage	47.9	1.1e-21
YP_005225561.1|1306713_1306836_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225562.1|1306957_1307593_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
YP_005225563.1|1307731_1308109_+	hypothetical protein	NA	H9C190	Pectobacterium_phage	84.0	1.4e-53
YP_005225564.1|1308110_1309787_+	hypothetical protein	NA	H9C191	Pectobacterium_phage	74.4	2.3e-249
YP_005225565.1|1309787_1311308_+	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	2.2e-105
YP_005225566.1|1311360_1312050_+|head	putative phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	52.2	6.7e-62
YP_005225567.1|1312171_1312327_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225568.1|1312489_1313497_+	hypothetical protein	NA	A0A219YCD3	Aeromonas_phage	51.2	1.6e-56
YP_005225569.1|1313573_1313696_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005225570.1|1313676_1314939_-|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
YP_005225571.1|1315170_1316139_-|transposase	transposase InsC for insertion sequence IS903	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
YP_005225572.1|1316335_1316659_+	hypothetical protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	37.5	7.8e-05
YP_005225573.1|1316660_1317143_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
YP_005225574.1|1317142_1318180_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	50.3	1.1e-84
YP_005225575.1|1318181_1318508_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	2.1e-10
YP_005225576.1|1318953_1319517_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.4	2.4e-17
YP_005225577.1|1319648_1319882_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225578.1|1319863_1320415_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225579.1|1320418_1321900_+	hypothetical protein	NA	Q2NPD0	Xanthomonas_phage	35.0	9.3e-61
YP_005225580.1|1321899_1322343_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225581.1|1322523_1323081_+	hypothetical protein	NA	A0A088CBJ5	Shigella_phage	89.3	1.2e-88
YP_005225582.1|1323160_1323637_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
YP_005225583.1|1323714_1323858_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005225584.1|1323838_1325764_+	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	53.2	1.7e-38
1338717:1338763	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 5
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	1778389	1808525	5333942	integrase,tail,portal,terminase,plate,capsid	Salmonella_phage(84.38%)	39	1778297:1778315	1808597:1808615
1778297:1778315	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
YP_005226013.1|1778389_1779370_-|integrase	integrase family protein	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
YP_005226014.1|1779857_1781345_+	putative reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
YP_005226015.1|1781445_1781634_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
YP_005226016.1|1781644_1781878_+	putative DinI-like damage-inducible protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
YP_005226017.1|1782439_1782670_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226018.1|1782945_1784688_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226019.1|1784749_1785775_-|portal	putative phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
YP_005226020.1|1785774_1787541_-|terminase	terminase, ATPase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
YP_005226021.1|1787683_1788517_+|capsid	Presumed capsid scaffolding protein (GpO)	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
YP_005226022.1|1788533_1789592_+|capsid	minor capsid protein H1 and H2, major capsid protein N*	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
YP_005226023.1|1789595_1790246_+|terminase	terminase, endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
YP_005226024.1|1790341_1790806_+	Head completion/stabilization protein (GpL)	NA	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
YP_005226025.1|1790805_1791009_+	hypothetical protein	NA	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
YP_005226026.1|1791012_1791228_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
YP_005226027.1|1791208_1791718_+	hypothetical protein	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
YP_005226028.1|1791722_1792106_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
YP_005226029.1|1792102_1792531_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
YP_005226030.1|1792517_1792664_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
YP_005226031.1|1792626_1793058_+|tail	P2 phage tail completion protein R	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
YP_005226032.1|1793092_1793497_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	72.0	4.3e-45
YP_005226033.1|1793493_1794003_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005226034.1|1794001_1794166_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226035.1|1794280_1794853_+|plate	baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
YP_005226036.1|1794849_1795212_+|plate	baseplate assembly protein W	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
YP_005226037.1|1795198_1796107_+|plate	baseplate assembly protein J	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
YP_005226038.1|1796099_1796699_+|tail	tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
YP_005226039.1|1796700_1799652_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
YP_005226040.1|1799655_1800387_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226041.1|1800425_1800587_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226042.1|1800616_1801693_+	hypothetical protein	NA	Q37842	Escherichia_phage	44.8	1.2e-25
YP_005226043.1|1801831_1803004_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
YP_005226044.1|1803013_1803529_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
YP_005226045.1|1803581_1803881_+|tail	phage tail protein E	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
YP_005226046.1|1803895_1804015_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
YP_005226047.1|1804007_1804130_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226048.1|1804242_1806636_+|tail	phage tail tape measure protein, family	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
YP_005226049.1|1806632_1807118_+|tail	putative bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
YP_005226050.1|1807114_1808215_+	Late control gene D protein (GpD)	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
YP_005226051.1|1808369_1808525_+	prophage P2 Ogr protein	NA	E5G6Q4	Salmonella_phage	65.3	2.9e-10
1808597:1808615	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 6
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	1842941	1852405	5333942	protease	Dickeya_phage(16.67%)	8	NA	NA
YP_005226089.1|1842941_1844057_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
YP_005226090.1|1844053_1845994_+	ABC-type macrolide transport system efflux carrier	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
YP_005226091.1|1846070_1846292_-	DNA replication inhibitor	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
YP_005226092.1|1846617_1846935_+|protease	ATP-dependent Clp protease adaptor protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
YP_005226093.1|1846965_1849245_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
YP_005226094.1|1849365_1849584_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
YP_005226095.1|1849937_1850657_-	leucyltransferase	NA	NA	NA	NA	NA
YP_005226096.1|1850683_1852405_-	cytochrome-related transport system ATP-binding component	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	2277468	2321673	5333942	protease	uncultured_Caudovirales_phage(33.33%)	60	NA	NA
YP_005226533.1|2277468_2278230_+	short chain dehydrogenase/reductase family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
YP_005226534.1|2278446_2279979_+	putative metal-dependent phosphohydrolase with HD subdomain	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
YP_005226535.1|2280177_2280666_-|protease	putative intracellular protease/amidase	protease	NA	NA	NA	NA
YP_005226536.1|2280922_2282104_+	hypothetical protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
YP_005226537.1|2282286_2282433_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
YP_005226538.1|2282505_2282739_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005226539.1|2282981_2283095_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
YP_005226540.1|2283190_2283415_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
YP_005226541.1|2283404_2284115_-	DNA-binding protein Roi	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
YP_005226542.1|2284120_2284639_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
YP_005226543.1|2284743_2285571_-	gp20	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
YP_005226544.1|2285567_2285762_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005226545.1|2285758_2286184_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
YP_005226546.1|2286180_2286303_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
YP_005226547.1|2286617_2286779_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
YP_005226548.1|2287152_2287341_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
YP_005226549.1|2287333_2287648_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
YP_005226550.1|2288373_2288541_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226551.1|2289428_2291042_+	putative helicase	NA	A0A286N2P9	Klebsiella_phage	95.9	2.1e-311
YP_005226552.1|2291028_2292006_+	putative phage DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
YP_005226553.1|2292002_2292479_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
YP_005226554.1|2292475_2293258_+	putative antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
YP_005226555.1|2293324_2293480_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226556.1|2293517_2293646_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005226557.1|2293663_2293867_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226558.1|2293877_2295416_-	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
YP_005226559.1|2295464_2295812_-	hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
YP_005226560.1|2295808_2296213_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
YP_005226561.1|2296376_2296907_+	hypothetical protein	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
YP_005226562.1|2296903_2297293_+	hypothetical protein	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
YP_005226563.1|2298213_2298702_+	putative bacteriophage protein	NA	NA	NA	NA	NA
YP_005226564.1|2298652_2300053_+	putative bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
YP_005226565.1|2300290_2301742_+	phage-associated protein, family	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
YP_005226566.1|2302565_2303600_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	53.0	4.9e-85
YP_005226567.1|2303603_2304098_+	Putative bacteriophage protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
YP_005226568.1|2304109_2305051_+	putative bacteriophage protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	3.9e-137
YP_005226569.1|2305090_2305372_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226570.1|2305340_2305760_+	putative bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
YP_005226571.1|2305756_2306263_+	putative bacteriophage protein	NA	NA	NA	NA	NA
YP_005226572.1|2306262_2306649_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
YP_005226573.1|2306743_2307184_+	putative bacteriophage protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
YP_005226574.1|2307187_2308333_+	putative bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
YP_005226575.1|2308343_2308784_+	Putative bacteriophage protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
YP_005226576.1|2308787_2309213_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
YP_005226577.1|2309248_2309401_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
YP_005226578.1|2309390_2311394_+	lytic transglycosylase, catalytic	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
YP_005226579.1|2311579_2311993_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
YP_005226580.1|2312068_2312296_+	putative bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
YP_005226581.1|2312298_2313321_+	putative bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
YP_005226582.1|2313320_2313662_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
YP_005226583.1|2313714_2313900_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005226584.1|2314152_2314503_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226585.1|2314556_2315210_+	putative bacteriophage protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
YP_005226586.1|2315211_2315565_+	putative bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
YP_005226587.1|2315564_2316761_+	putative bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
YP_005226588.1|2316862_2317531_+	putative bacteriophage protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	50.9	1.2e-60
YP_005226589.1|2318005_2318170_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226590.1|2318290_2318422_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226591.1|2318396_2318594_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005226592.1|2318649_2321673_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
>prophage 8
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	2545567	2556453	5333942		Escherichia_phage(77.78%)	11	NA	NA
YP_005226818.1|2545567_2546188_-	putative aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
YP_005226819.1|2546180_2547446_-	ygbK domain protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
YP_005226820.1|2547457_2548360_-	putative dehydrogenase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
YP_005226821.1|2548620_2549382_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
YP_005226822.1|2549402_2550263_-	beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
YP_005226823.1|2550560_2550767_+	putative K+ transporting ATPase, KdpC subunit	NA	A0A077SK33	Escherichia_phage	95.2	9.6e-25
YP_005226824.1|2550908_2551997_+	putative RecF protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
YP_005226825.1|2552027_2553185_-	putative proton/sugar symporter, LacY	NA	NA	NA	NA	NA
YP_005226826.1|2553157_2553292_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005226827.1|2553346_2554807_-	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	52.0	1.3e-147
YP_005226828.1|2554830_2556453_-	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	63.2	1.7e-180
>prophage 9
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	3553139	3561516	5333942		Escherichia_phage(28.57%)	9	NA	NA
YP_005227851.1|3553139_3554144_+	uridine diphosphate galacturonate 4-epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
YP_005227852.1|3554213_3554354_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005227853.1|3554544_3554667_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005227854.1|3555089_3556256_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
YP_005227855.1|3556435_3556990_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
YP_005227856.1|3557004_3557895_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
YP_005227857.1|3557926_3558796_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
YP_005227858.1|3558822_3559887_-	dTDP-D-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
YP_005227859.1|3560109_3561516_-	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 10
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	3604843	3611749	5333942	protease	Bacillus_phage(33.33%)	6	NA	NA
YP_005227890.1|3604843_3606322_+	two-component regulatory system sensor protein	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
YP_005227891.1|3606318_3607041_+	two-component regulatory system response regulator	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
YP_005227892.1|3607359_3608721_+|protease	putative protease	protease	Q6DW11	Phage_TP	94.8	1.8e-207
YP_005227893.1|3608964_3609861_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
YP_005227894.1|3610101_3610875_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
YP_005227895.1|3610885_3611749_-	putative dipeptide ABC transport system ATP-binding component	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 11
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	4049986	4091803	5333942	transposase,tRNA,tail,portal,terminase,head,holin,plate,lysis,capsid	Escherichia_phage(34.15%)	52	NA	NA
YP_005228300.1|4049986_4051018_-	gp27	NA	A0A0M4S6G4	Salmonella_phage	83.7	1.6e-173
YP_005228301.1|4051020_4051617_-	CI repressor	NA	Q6K1G0	Salmonella_virus	47.7	8.1e-48
YP_005228302.1|4052114_4052246_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005228303.1|4052277_4052787_+	gp31	NA	Q6K1F8	Salmonella_virus	94.1	4.1e-85
YP_005228304.1|4052848_4052995_+	hypothetical protein	NA	E5G6L4	Salmonella_phage	75.8	8.9e-09
YP_005228305.1|4053075_4053363_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	55.9	2.3e-24
YP_005228306.1|4053428_4053653_+	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	71.9	4.4e-15
YP_005228307.1|4053652_4053880_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.8e-24
YP_005228308.1|4053876_4054458_+	putative exonuclease CP81	NA	A0A1S6L012	Salmonella_phage	77.7	2.6e-83
YP_005228309.1|4054454_4054727_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	73.3	1.1e-31
YP_005228310.1|4055148_4057212_+	gp36	NA	A0A218M4H2	Erwinia_phage	89.9	0.0e+00
YP_005228311.1|4057357_4058845_-	putative reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
YP_005228312.1|4059248_4059431_+	TumA	NA	A0A0M5M1G5	Salmonella_phage	78.3	5.3e-19
YP_005228313.1|4059551_4059665_+	bacteriophage sos operon Tum protein	NA	A0A218M4I0	Erwinia_phage	78.4	2.8e-10
YP_005228314.1|4059744_4060476_+	phage protein	NA	Q37850	Escherichia_phage	85.6	2.4e-118
YP_005228315.1|4060589_4061387_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005228316.1|4061757_4062801_-|portal	putative prophage presumed portal protein	portal	M1SV64	Escherichia_phage	82.1	2.6e-166
YP_005228317.1|4062800_4064570_-|terminase	putative prophage large terminase protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	2.4e-305
YP_005228318.1|4064735_4065590_+|capsid	putative prophage capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	4.8e-126
YP_005228319.1|4065663_4066527_+|capsid	putative prophage major capsid protein	capsid	S4TUA6	Salmonella_phage	83.7	1.5e-111
YP_005228320.1|4066520_4066721_+|capsid	putative prophage major capsid protein	capsid	O80304	Escherichia_phage	81.8	1.5e-22
YP_005228321.1|4066748_4067468_+|terminase	putative prophage small terminase subunit	terminase	Q94MJ2	Enterobacteria_phage	79.7	2.1e-95
YP_005228322.1|4067564_4068071_+|head	putative prophage phage head completion protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
YP_005228323.1|4068070_4068274_+|tail	putative prophage tail component protein	tail	A0A0F7LCN2	Escherichia_phage	79.1	3.6e-24
YP_005228324.1|4068278_4068569_+|holin	putative prophage holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
YP_005228325.1|4068555_4069053_+|lysis	putative prophage endolysin, control of lysis	lysis	A0A0F7LBS0	Escherichia_phage	87.7	3.0e-80
YP_005228326.1|4069049_4069481_+	putative prophage P2 LysB-like protein	NA	O80310	Escherichia_phage	66.9	3.7e-42
YP_005228327.1|4069455_4069614_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
YP_005228328.1|4069576_4070044_+|tail	putative prophage, tail completion protein	tail	A0A0F7LA33	Escherichia_phage	74.8	6.3e-64
YP_005228329.1|4070111_4070486_+|tail	putative prophage, tail completion protein	tail	O80313	Escherichia_phage	71.3	2.1e-41
YP_005228330.1|4070602_4071196_+|plate	putative prophage baseplate assembly protein	plate	A0A0M4S6F6	Salmonella_phage	76.6	8.2e-85
YP_005228331.1|4071192_4071540_+|plate	putative prophage baseplate protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
YP_005228332.1|4071544_4072453_+|plate	putative prophage baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	1.9e-112
YP_005228333.1|4072460_4073045_+|tail	tail protein I	tail	A0A1S6L000	Salmonella_phage	57.2	1.5e-51
YP_005228334.1|4073049_4073850_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005228335.1|4073839_4077277_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005228336.1|4077292_4078363_+	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	40.8	8.9e-29
YP_005228337.1|4078473_4079655_+|tail	putative prophage tail sheath	tail	A0A0F7LBW9	Escherichia_phage	86.9	2.1e-196
YP_005228338.1|4079668_4080184_+|tail	putative prophage tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
YP_005228339.1|4080244_4080520_+|tail	putative prophage tail protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
YP_005228340.1|4080552_4080672_+|tail	putative prophage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
YP_005228341.1|4080664_4083106_+|tail	putative prophage tail length determinator	tail	Q858U7	Yersinia_virus	72.1	1.1e-289
YP_005228342.1|4083272_4083599_+|tail	putative prophage tail protein	tail	U5N3F6	Enterobacteria_phage	81.1	8.6e-44
YP_005228343.1|4083598_4084759_+|tail	putative prophage tail protein	tail	Q7Y4C6	Escherichia_virus	81.2	9.8e-175
YP_005228344.1|4085217_4085565_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
YP_005228345.1|4085604_4086372_-|tRNA	tRNA (guanine-N(1)-)-methyltransferase	tRNA	NA	NA	NA	NA
YP_005228346.1|4086403_4086862_-	16S rRNA-processing protein	NA	NA	NA	NA	NA
YP_005228347.1|4086970_4087219_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
YP_005228348.1|4087478_4088843_-	fifty-four-like protein	NA	NA	NA	NA	NA
YP_005228349.1|4089006_4089798_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005228350.1|4089817_4090444_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005228351.1|4090540_4091803_+|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 12
NC_016845	Klebsiella pneumoniae subsp. pneumoniae HS11286 chromosome, complete genome	5333942	4783391	4852767	5333942	integrase,tRNA,tail,terminase,portal,holin,head,protease,capsid	uncultured_Caudovirales_phage(57.89%)	71	4819150:4819167	4835145:4835162
YP_005229067.1|4783391_4783886_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
YP_005229068.1|4783889_4784528_-	stringent starvation protein A	NA	NA	NA	NA	NA
YP_005229069.1|4784839_4785232_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
YP_005229070.1|4785247_4785676_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
YP_005229071.1|4785941_4787069_-	putative ATPase	NA	NA	NA	NA	NA
YP_005229072.1|4787259_4787658_+	cytochrome d ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
YP_005229073.1|4787831_4789199_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
YP_005229074.1|4789286_4790345_+|protease	serine endoprotease	protease	NA	NA	NA	NA
YP_005229075.1|4790481_4791420_-	malate dehydrogenase	NA	NA	NA	NA	NA
YP_005229076.1|4791834_4792305_+	arginine repressor	NA	NA	NA	NA	NA
YP_005229077.1|4792680_4792944_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229078.1|4793192_4793309_+	YcfR family protein	NA	NA	NA	NA	NA
YP_005229079.1|4793359_4793635_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229080.1|4793714_4795622_-	p-hydroxybenzoic acid efflux subunit AaeB	NA	NA	NA	NA	NA
YP_005229081.1|4795687_4796620_-	putative membrane located multidrug resistance protein	NA	NA	NA	NA	NA
YP_005229082.1|4796627_4796831_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229083.1|4796980_4797892_+	putative LysR-family transcriptional regulator	NA	NA	NA	NA	NA
YP_005229084.1|4797927_4799373_-|protease	protease TldD	protease	NA	NA	NA	NA
YP_005229085.1|4799461_4803259_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229086.1|4803296_4804766_-	ribonuclease G	NA	NA	NA	NA	NA
YP_005229087.1|4804768_4805350_-	Maf-like protein	NA	NA	NA	NA	NA
YP_005229088.1|4805357_4805846_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
YP_005229089.1|4805845_4806838_-	cell wall structural complex MreBCD transmembrane component MreC	NA	NA	NA	NA	NA
YP_005229090.1|4806908_4807952_-	regulator of ftsI, penicillin binding protein 3, septation function	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
YP_005229091.1|4808257_4810198_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229092.1|4810277_4810469_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229093.1|4810697_4811699_+	putative sulfite oxidase subunit YedY	NA	NA	NA	NA	NA
YP_005229094.1|4811698_4812307_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229095.1|4812530_4812983_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
YP_005229096.1|4813005_4813473_+	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
YP_005229097.1|4813483_4814833_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
YP_005229098.1|4814943_4815186_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229099.1|4815175_4816627_+	sodium/panthothenate symporter	NA	NA	NA	NA	NA
YP_005229100.1|4816638_4817520_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
YP_005229101.1|4817970_4818843_+	FMN-linked protein	NA	NA	NA	NA	NA
YP_005229102.1|4818867_4819164_+	DNA-binding protein Fis	NA	NA	NA	NA	NA
4819150:4819167	attL	TACGGCATGAACTGATAC	NA	NA	NA	NA
YP_005229103.1|4819317_4819509_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229104.1|4819511_4821173_-|terminase	putative phage terminase, large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
YP_005229105.1|4821156_4821513_-|terminase	phage terminase small subunit	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
YP_005229106.1|4821643_4821796_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
YP_005229107.1|4821788_4822025_-|holin	putative prophage holin	holin	A0A2H4JAS8	uncultured_Caudovirales_phage	88.5	1.8e-35
YP_005229108.1|4822231_4822531_-	phage QLRG family, putative DNA packaging	NA	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
YP_005229109.1|4822527_4822683_-|head,tail	putative phage head-tail adaptor	head,tail	A0A1P8DTK6	Proteus_phage	54.0	7.2e-09
YP_005229110.1|4822859_4824101_-|portal	phage portal protein, HK97 family	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
YP_005229111.1|4824102_4824663_-|head,protease	phage prohead protease, HK97 family	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
YP_005229112.1|4824714_4825881_-|capsid	phage major capsid protein, HK97 family	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
YP_005229113.1|4826144_4826657_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229114.1|4826705_4827041_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229115.1|4827383_4829519_-	putative prophage protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
YP_005229116.1|4829518_4829884_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229117.1|4829880_4830249_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
YP_005229118.1|4830347_4830476_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229119.1|4830552_4830741_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229120.1|4830733_4830913_-	hypothetical protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
YP_005229121.1|4831454_4832234_-	Roi protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
YP_005229122.1|4832244_4832529_-	phage transcriptional regulator AlpA	NA	NA	NA	NA	NA
YP_005229123.1|4832710_4833652_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229124.1|4833744_4834971_-|integrase	integrase family protein	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
YP_005229125.1|4835246_4835897_-	DNA-binding transcriptional regulator EnvR	NA	NA	NA	NA	NA
4835145:4835162	attR	TACGGCATGAACTGATAC	NA	NA	NA	NA
YP_005229126.1|4836274_4837414_+	transmembrane protein	NA	NA	NA	NA	NA
YP_005229127.1|4837426_4840537_+	inner membrane multidrug efflux protein BpeB	NA	NA	NA	NA	NA
YP_005229128.1|4840830_4841052_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229129.1|4846750_4847401_+	transferase	NA	NA	NA	NA	NA
YP_005229130.1|4847376_4847634_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229131.1|4847630_4848449_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
YP_005229132.1|4848452_4849025_-	putative RNA-binding protein with unique protein fold	NA	NA	NA	NA	NA
YP_005229133.1|4849029_4849572_-	putative DNA topoisomerase	NA	NA	NA	NA	NA
YP_005229134.1|4849597_4850071_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229135.1|4850042_4851167_-	putative competence protein	NA	NA	NA	NA	NA
YP_005229136.1|4851295_4851805_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
YP_005229137.1|4851819_4852767_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 1
NC_016838	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS1, complete sequence	122799	200	90662	122799	integrase,transposase,tail	Salmonella_phage(88.37%)	104	2600:2619	43847:43866
YP_005220808.1|200_1418_+	replication protein A	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
YP_005220809.1|1869_2082_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
YP_005220810.1|2081_2696_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.3e-37
2600:2619	attL	TAAATACTAACTTATCTATT	NA	NA	NA	NA
YP_005220811.1|2779_2956_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
YP_005220812.1|3126_4149_-	putative recombinase	NA	J9Q736	Salmonella_phage	96.1	2.4e-185
YP_005220813.1|4114_4474_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.7	3.4e-33
YP_005220814.1|4473_5418_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
YP_005220815.1|5478_6486_-	putative regulator	NA	J9Q7Z3	Salmonella_phage	88.3	1.6e-144
YP_005220816.1|6605_7037_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
YP_005220817.1|7201_7501_-	lipoprotein	NA	NA	NA	NA	NA
YP_005220818.1|7637_7892_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	64.6	5.9e-24
YP_005220819.1|8132_8558_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	8.6e-60
YP_005220820.1|8572_9067_-	DNA polymerase III	NA	J9Q7Z2	Salmonella_phage	95.7	3.9e-88
YP_005220821.1|9045_12090_-	putative DNA polymerase III alpha subunit	NA	J9Q7Z2	Salmonella_phage	92.6	0.0e+00
YP_005220822.1|12270_13116_-	porphyrin biosynthetic protein	NA	J9Q733	Salmonella_phage	91.5	1.1e-151
YP_005220823.1|13157_13466_-	putative porphyrin biosynthetic protein	NA	J9Q733	Salmonella_phage	69.4	2.4e-27
YP_005220824.1|13599_15885_-	porphyrin biosynthetic protein	NA	J9Q7G6	Salmonella_phage	66.1	8.0e-245
YP_005220825.1|16001_16214_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220826.1|16487_16868_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220827.1|16862_17966_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	30.3	5.6e-18
YP_005220828.1|18052_19537_-	putative retA reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
YP_005220829.1|20649_21060_-	putative toxin YafO	NA	NA	NA	NA	NA
YP_005220830.1|21069_21675_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220831.1|21769_22138_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	1.0e-13
YP_005220832.1|22145_22919_-	hypothetical protein	NA	W8D063	Erwinia_phage	65.0	1.1e-89
YP_005220833.1|23159_24749_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220834.1|24948_25104_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220835.1|26043_26433_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220836.1|26523_29490_-|transposase	transposase for transposon Tn1721	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
YP_005220837.1|29493_30054_-	Tn4653 resolvase	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
YP_005220838.1|30042_30210_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
YP_005220839.1|30363_30798_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	100.0	1.6e-77
YP_005220840.1|30839_31763_-|transposase	transposase InsC for insertion sequence IS903	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
YP_005220841.1|31842_32694_-	beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	7.8e-153
YP_005220842.1|32697_32820_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220843.1|32864_32987_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220844.1|32967_34230_-|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
YP_005220845.1|34430_35462_+	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.2e-51
YP_005220846.1|35772_35988_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	3.2e-23
YP_005220847.1|35971_36136_-	hypothetical protein	NA	J9Q729	Salmonella_phage	72.5	6.7e-13
YP_005220848.1|36147_37470_-	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
YP_005220849.1|37469_37937_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	2.0e-49
YP_005220850.1|38016_38805_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.8	5.3e-71
YP_005220851.1|39066_40269_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220852.1|40311_41436_-	hypothetical protein	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
YP_005220853.1|41583_42924_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
YP_005220854.1|42988_43714_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.3e-127
YP_005220855.1|43896_44058_-	hypothetical protein	NA	NA	NA	NA	NA
43847:43866	attR	AATAGATAAGTTAGTATTTA	NA	NA	NA	NA
YP_005220856.1|44299_44734_-	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	3.7e-18
YP_005220857.1|44880_45066_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220858.1|45138_45495_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
YP_005220859.1|45500_46166_-	putative plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.3	8.3e-102
YP_005220860.1|46405_46927_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220861.1|46981_47137_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	64.7	1.3e-13
YP_005220862.1|47129_47381_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.1	6.4e-23
YP_005220863.1|47383_48076_-	putative transmembrane protein	NA	J9Q7Y7	Salmonella_phage	89.6	7.0e-120
YP_005220864.1|48089_48413_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
YP_005220865.1|48509_50009_-|tail	putative phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	52.1	2.1e-108
YP_005220866.1|50061_52683_-	Gp21	NA	A0A0P0IKE4	Klebsiella_phage	52.4	4.5e-34
YP_005220867.1|52642_56548_-	Gp21	NA	Q6UAW1	Klebsiella_phage	50.1	4.3e-97
YP_005220868.1|56606_62231_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	82.4	0.0e+00
YP_005220869.1|62247_62859_-|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	72.1	5.0e-77
YP_005220870.1|62846_63644_-|tail	putative phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
YP_005220871.1|63636_64335_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	87.0	2.6e-122
YP_005220872.1|64421_64757_-|tail	minor tail fiber protein M	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
YP_005220873.1|64800_66138_-|tail	putative phage tail tape measure protein	tail	J9Q712	Salmonella_phage	60.1	3.0e-103
YP_005220874.1|66139_69340_-	hypothetical protein	NA	J9Q712	Salmonella_phage	78.1	0.0e+00
YP_005220875.1|69347_69572_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
YP_005220876.1|69697_70015_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
YP_005220877.1|70076_70823_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
YP_005220878.1|70890_71283_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
YP_005220879.1|71284_71758_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
YP_005220880.1|71748_72093_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
YP_005220881.1|72190_73024_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.0	4.1e-130
YP_005220882.1|73023_73173_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	93.9	2.8e-18
YP_005220883.1|73340_73529_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220884.1|73504_73933_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
YP_005220885.1|74011_74890_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
YP_005220886.1|74916_75816_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
YP_005220887.1|75838_76486_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.8	1.5e-103
YP_005220888.1|76599_77427_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	85.4	3.0e-133
YP_005220889.1|77444_78701_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
YP_005220890.1|78703_79345_-	putative DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	6.6e-96
YP_005220891.1|79520_79787_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
YP_005220892.1|79796_80687_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
YP_005220893.1|80692_80947_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	1.0e-39
YP_005220894.1|80939_81362_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	98.6	1.2e-69
YP_005220895.1|81358_81577_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	95.1	1.6e-25
YP_005220896.1|81573_82242_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
YP_005220897.1|82241_82946_-	hypothetical protein	NA	J9Q756	Salmonella_phage	88.8	3.7e-108
YP_005220898.1|83005_84565_+	putative helicase	NA	J9Q7I4	Salmonella_phage	92.7	1.5e-279
YP_005220899.1|84567_84843_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
YP_005220900.1|84893_85328_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
YP_005220901.1|85486_86017_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
YP_005220902.1|86149_86329_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220903.1|86650_87301_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
YP_005220904.1|87351_87555_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	5.4e-28
YP_005220905.1|88149_88632_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	2.9e-64
YP_005220906.1|88836_89034_-	hypothetical protein	NA	J9Q753	Salmonella_phage	81.5	2.9e-26
YP_005220907.1|88986_89139_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220908.1|89243_89663_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220909.1|89770_90070_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	70.7	5.0e-30
YP_005220910.1|90218_90431_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	7.6e-25
YP_005220911.1|90443_90662_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	6.4e-27
>prophage 2
NC_016838	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS1, complete sequence	122799	94608	122799	122799		Salmonella_phage(82.14%)	34	NA	NA
YP_005220915.1|94608_96165_+	type I restriction enzyme	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	5.8e-106
YP_005220916.1|96161_97358_+	Restriction modification system DNA specificity domain protein	NA	NA	NA	NA	NA
YP_005220917.1|97433_97715_+	HsdR protein	NA	NA	NA	NA	NA
YP_005220918.1|97668_100164_+	putative type I restriction-modification enzyme R subunit	NA	A0A220A398	Liberibacter_phage	23.8	4.8e-25
YP_005220919.1|100259_100550_+	putative type I restriction-modification enzyme R subunit	NA	NA	NA	NA	NA
YP_005220920.1|100611_100827_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
YP_005220921.1|100955_101534_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	5.1e-55
YP_005220922.1|101661_101817_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
YP_005220923.1|101816_102188_-	TciA	NA	Q71TK7	Escherichia_phage	82.9	1.4e-50
YP_005220924.1|102541_103204_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.5	1.6e-28
YP_005220925.1|103227_103896_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	93.2	4.4e-119
YP_005220926.1|104423_104657_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	9.2e-32
YP_005220927.1|104859_105453_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	94.9	2.6e-107
YP_005220928.1|105637_106471_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
YP_005220929.1|106596_107154_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
YP_005220930.1|107163_107583_-	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	1.9e-51
YP_005220931.1|107646_108291_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
YP_005220932.1|108290_108761_-	putative dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	78.7	2.0e-70
YP_005220933.1|108763_109159_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	74.8	2.6e-50
YP_005220934.1|109178_110282_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
YP_005220935.1|110475_111351_-	hypothetical protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
YP_005220936.1|111428_112571_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
YP_005220937.1|112701_115005_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
YP_005220938.1|115080_115650_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
YP_005220939.1|115659_116370_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	2.8e-71
YP_005220940.1|116395_116980_-	RecF/RecN/SMC domain protein	NA	J9Q741	Salmonella_phage	91.1	1.5e-91
YP_005220941.1|116954_118313_-	putative exonuclease	NA	J9Q741	Salmonella_phage	81.8	3.0e-199
YP_005220942.1|118309_118543_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	3.4e-18
YP_005220943.1|118542_119628_-	putative exonuclease subunit 1	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
YP_005220944.1|119626_119743_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220945.1|120126_120282_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005220946.1|120280_120625_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005220947.1|120647_121841_+	Chromosome segregation ATPase	NA	X5JAC1	Clostridium_phage	52.3	5.0e-57
YP_005220948.1|122154_122799_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
>prophage 1
NC_016846	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence	111195	9591	31119	111195	integrase,transposase	Salmonella_phage(38.46%)	33	15553:15566	21626:21639
YP_005229634.1|9591_9819_+|transposase	putative transposase	transposase	A0A2L1IV22	Escherichia_phage	94.6	1.7e-35
YP_005229635.1|9863_10241_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	93.6	1.9e-63
YP_005229636.1|10242_10623_+|transposase	IS903D transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	6.3e-46
YP_005229637.1|10821_11826_-|transposase	transposase InsD1 for insertion sequence IS4321R	transposase	NA	NA	NA	NA
YP_005229638.1|11904_12339_-	putative transcriptional regulator MerR	NA	NA	NA	NA	NA
YP_005229639.1|12410_12761_+	putative mercuric transport protein	NA	NA	NA	NA	NA
YP_005229640.1|12774_13050_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229641.1|13046_13508_+	putative mercury transport protein MerC	NA	NA	NA	NA	NA
YP_005229642.1|13741_13867_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229643.1|13886_15254_+	mercuric ion reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	4.6e-38
YP_005229644.1|15271_15634_+	HTH-type transcriptional regulator merD	NA	NA	NA	NA	NA
15553:15566	attL	GCGGCGCGCGGCGT	NA	NA	NA	NA
YP_005229645.1|15630_15867_+	putative mercury resistance protein	NA	NA	NA	NA	NA
YP_005229646.1|15902_16571_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005229647.1|16645_17914_+|integrase	integrase core subunit	integrase	NA	NA	NA	NA
YP_005229648.1|17942_18665_+	hypothetical protein	NA	A0A077SL39	Escherichia_phage	100.0	3.2e-139
YP_005229649.1|18704_19178_+	resolvase	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
YP_005229650.1|19300_20281_+|transposase	putative transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
YP_005229651.1|20393_20540_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229652.1|20556_21438_+	Class A Carbapenemase Kpc-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
YP_005229653.1|21687_22668_-|transposase	putative transposase	transposase	NA	NA	NA	NA
21626:21639	attR	GCGGCGCGCGGCGT	NA	NA	NA	NA
YP_005229654.1|22672_22969_-	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
YP_005229655.1|23014_23170_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229656.1|23297_23723_-	antirestriction protein Klca	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
YP_005229657.1|23833_24112_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229658.1|24095_24491_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229659.1|24645_25206_-	putative replication protein	NA	NA	NA	NA	NA
YP_005229660.1|25498_25666_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
YP_005229661.1|25654_26215_+	Tn4653 resolvase	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
YP_005229662.1|26218_29185_+|transposase	transposase for transposon Tn1721	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
YP_005229663.1|29326_29521_+|transposase	transposase IS26	transposase	A0A077SL39	Escherichia_phage	98.4	6.0e-29
YP_005229664.1|29722_30196_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229665.1|30285_30549_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229666.1|30615_31119_-|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_016846	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence	111195	39767	46674	111195		Enterobacteria_phage(33.33%)	10	NA	NA
YP_005229677.1|39767_40247_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
YP_005229678.1|40481_41204_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	100.0	3.2e-139
YP_005229679.1|41210_41540_+	hypothetical protein	NA	Q1MVP4	Enterobacteria_phage	100.0	4.6e-45
YP_005229680.1|41722_42583_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
YP_005229681.1|42815_43124_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
YP_005229682.1|43120_43771_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229683.1|43826_44471_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229684.1|44520_45123_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229685.1|45283_45877_-	fertility inhibition protein	NA	NA	NA	NA	NA
YP_005229686.1|45948_46674_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	27.6	5.5e-06
>prophage 3
NC_016846	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence	111195	100180	111195	111195		Escherichia_phage(50.0%)	13	NA	NA
YP_005229764.1|100180_100882_-	putative methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
YP_005229765.1|101083_101200_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229766.1|101318_101549_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229767.1|101611_102283_-	mediator of plasmid stability	NA	NA	NA	NA	NA
YP_005229768.1|102285_103257_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
YP_005229769.1|103387_103513_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229770.1|103505_104990_-	putative retA reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
YP_005229771.1|105305_105422_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005229772.1|105399_105831_+	Protein impA	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
YP_005229773.1|105830_107102_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
YP_005229774.1|107183_108158_-	plasmid partition protein B	NA	Q38420	Escherichia_phage	53.8	1.4e-86
YP_005229775.1|108157_109363_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
YP_005229776.1|110472_111195_-	DNA replication	NA	A0A222YYK1	Escherichia_phage	31.1	1.3e-23
>prophage 1
NC_016839	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence	105974	27996	48999	105974	integrase,transposase	Escherichia_phage(25.0%)	31	29554:29613	49628:50827
YP_005221000.1|27996_28701_+|transposase	putative transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
YP_005221001.1|29005_29563_+	hypothetical protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
29554:29613	attL	GGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACG	NA	NA	NA	NA
YP_005221002.1|29745_30606_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
YP_005221003.1|30775_31531_+	RmtB	NA	NA	NA	NA	NA
YP_005221004.1|31611_32160_-	putative Na(+)/H(+) antiporter	NA	NA	NA	NA	NA
YP_005221005.1|32195_32573_+|integrase	GroEL-like/integrase protein	integrase	A0A2I7SAK5	Vibrio_phage	58.1	8.2e-22
YP_005221006.1|32727_32886_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221007.1|32837_33491_+|transposase	ISCR15b transposase	transposase	NA	NA	NA	NA
YP_005221008.1|33487_34333_+|transposase	transposase	transposase	NA	NA	NA	NA
YP_005221009.1|34424_34904_-	putative LysR-type transcriptional regulator	NA	NA	NA	NA	NA
YP_005221010.1|34859_35138_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221011.1|35236_36412_-	tetracycline resistance protein	NA	NA	NA	NA	NA
YP_005221012.1|36515_37142_+	tetracycline repressor protein class G	NA	NA	NA	NA	NA
YP_005221013.1|37138_37321_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221014.1|37348_38563_-	putative chloramphenicol and florfenicol resistance protein (CmlA)	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
YP_005221015.1|38779_39751_-	truncated dihydropteroate synthetase	NA	NA	NA	NA	NA
YP_005221016.1|39744_40092_-	Orf3/QacEdelta1 fusion protein	NA	NA	NA	NA	NA
YP_005221017.1|40255_41035_-	aminoglycoside adenylyltransferase	NA	NA	NA	NA	NA
YP_005221018.1|41092_41206_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221019.1|41219_41342_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221020.1|41493_41949_-	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	41.0	3.4e-22
YP_005221021.1|42093_43107_+|integrase	class I integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
YP_005221022.1|43065_43245_-	putative transcriptional regulator	NA	NA	NA	NA	NA
YP_005221023.1|43381_44086_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	100.0	1.8e-139
YP_005221024.1|44076_44850_+	extended-spectrum beta-lactamase/aminoglycoside modifying enzyme fusion protein	NA	NA	NA	NA	NA
YP_005221025.1|44862_45405_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221026.1|45902_46076_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221027.1|46099_46327_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221028.1|46377_47514_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221029.1|47480_47630_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221030.1|47628_48999_+|transposase	putative transposase	transposase	NA	NA	NA	NA
49628:50827	attR	GGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGATACAATAACCCTGGTAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTTCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC	NA	NA	NA	NA
>prophage 2
NC_016839	Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence	105974	60211	91762	105974	integrase,transposase	Salmonella_phage(50.0%)	37	57750:57769	98499:98518
57750:57769	attL	AAACTTTCACATGTGAAAGT	NA	NA	NA	NA
YP_005221050.1|60211_61090_-|integrase	integrase catalytic subunit	integrase	U5P429	Shigella_phage	43.5	2.6e-50
YP_005221051.1|61086_61404_-|transposase	transposase IS3/IS911 family protein	transposase	A9YX41	Burkholderia_phage	39.0	1.8e-09
YP_005221052.1|61584_61803_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221053.1|61876_62434_+	pyruvate/2-oxoglutarate dehydrogenase complex dehydrogenase (E1) component eukaryotic type beta subunit	NA	NA	NA	NA	NA
YP_005221054.1|62508_63360_+	NgrC	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
YP_005221055.1|63564_63711_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221056.1|63817_64204_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221057.1|64381_66109_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
YP_005221058.1|66095_66374_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221059.1|66446_66686_+	permease	NA	NA	NA	NA	NA
YP_005221060.1|66695_66812_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221061.1|66932_67307_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221062.1|67420_68146_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221063.1|68120_68324_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221064.1|68386_72541_+	RhsD protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.7e-23
YP_005221065.1|72537_72810_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221066.1|73104_73404_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221067.1|73570_74023_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221068.1|74038_74641_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221069.1|74902_75184_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221070.1|75482_76019_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221071.1|76021_77032_+|integrase	integrase/recombinase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
YP_005221072.1|77036_77906_+	exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
YP_005221073.1|77902_78394_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221074.1|78439_78571_-	hypothetical protein	NA	NA	NA	NA	NA
YP_005221075.1|78720_79635_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
YP_005221076.1|79782_80814_-	hypothetical protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.2e-51
YP_005221077.1|81014_82277_+|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
YP_005221078.1|82257_82380_+	hypothetical protein	NA	NA	NA	NA	NA
YP_005221079.1|82526_83402_+	beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
YP_005221080.1|83481_84405_+|transposase	transposase InsC for insertion sequence IS903	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
YP_005221081.1|84446_84881_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	100.0	1.6e-77
YP_005221082.1|85034_85202_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
YP_005221083.1|85190_85751_+	Tn4653 resolvase	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
YP_005221084.1|85754_88721_+|transposase	transposase for transposon Tn1721	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
YP_005221085.1|88923_89964_+	KfrA protein	NA	NA	NA	NA	NA
YP_005221086.1|90250_91762_+	putative DNA helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
98499:98518	attR	AAACTTTCACATGTGAAAGT	NA	NA	NA	NA
