The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	238683	435899	3596620	capsid,plate,terminase,protease,head,tail,holin,integrase,tRNA,portal,transposase	Thermus_phage(56.04%)	172	253441:253476	319653:319688
WP_014194682.1|238683_239301_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011229738.1|239414_239804_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014194683.1|239883_240897_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_011229741.1|241145_242300_+	alanine racemase	NA	NA	NA	NA	NA
WP_011229742.1|242426_242708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003253417.1|242712_243063_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
WP_014194685.1|243394_245560_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_013144046.1|245578_245692_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_013144047.1|245781_246231_+	SprT family protein	NA	U5J9G1	Bacillus_phage	26.6	4.9e-05
253441:253476	attL	AGCAAGAAAAGTGGAGGCCGCCCGCTTATCGGCGAG	NA	NA	NA	NA
WP_011229745.1|253959_254418_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011229746.1|254414_255155_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011229747.1|255114_255567_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_013144049.1|255563_256577_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.6	2.3e-66
WP_014194690.1|256898_258824_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	34.3	5.8e-63
WP_011229750.1|258920_259409_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013144051.1|259424_260066_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_013144052.1|260083_260236_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_014194692.1|260256_261000_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_075261519.1|261015_261195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013522803.1|261183_261363_-	YdiK family protein	NA	NA	NA	NA	NA
WP_011229755.1|261359_262094_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013144057.1|262450_262735_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	50.5	1.1e-18
WP_011229758.1|262839_264456_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.0	1.3e-164
WP_013144059.1|264533_265718_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	100.0	1.9e-226
WP_014194694.1|266067_266289_+	hypothetical protein	NA	S6AVX7	Thermus_phage	100.0	1.7e-35
WP_014194695.1|266280_267132_-	TIR domain-containing protein	NA	S6BFN8	Thermus_phage	100.0	7.5e-140
WP_014194696.1|267132_267573_-	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	100.0	2.0e-80
WP_033012578.1|267593_268061_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	100.0	1.1e-79
WP_146331429.1|268219_268498_+	helix-turn-helix domain-containing protein	NA	S6BA02	Thermus_phage	98.9	1.1e-44
WP_033012579.1|268469_269225_+	antirepressor	NA	S6AVX3	Thermus_phage	100.0	1.7e-143
WP_014194701.1|269376_269694_-	hypothetical protein	NA	S6B1N1	Thermus_phage	100.0	1.3e-52
WP_033012596.1|269776_270085_+	phage protein	NA	S6C476	Thermus_phage	100.0	1.6e-52
WP_014194702.1|270087_270363_+	hypothetical protein	NA	S6B9Z9	Thermus_phage	100.0	5.0e-45
WP_014194703.1|270373_270640_+	hypothetical protein	NA	S6AVW9	Thermus_phage	100.0	2.7e-43
WP_014194704.1|270639_270858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033012597.1|271022_271328_+	hypothetical protein	NA	S6BFM8	Thermus_phage	100.0	1.5e-53
WP_014194705.1|271324_271525_+	hypothetical protein	NA	S6B1M6	Thermus_phage	100.0	5.8e-35
WP_014194706.1|271634_272570_+	hypothetical protein	NA	S6C475	Thermus_phage	100.0	5.3e-171
WP_014194708.1|272771_273617_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	100.0	6.1e-158
WP_014194710.1|273792_274713_+	HTH domain-containing protein	NA	S6BFM4	Thermus_phage	100.0	2.8e-148
WP_033012580.1|274654_275497_+	DNA replication protein	NA	S6B1M2	Thermus_phage	100.0	2.2e-160
WP_014194713.1|276011_276521_+	dUTPase	NA	S6AVW3	Thermus_phage	100.0	8.9e-96
WP_020279139.1|276510_276723_+	hypothetical protein	NA	S6BFL9	Thermus_phage	100.0	3.4e-33
WP_033012588.1|276970_277390_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	100.0	1.0e-73
WP_014194717.1|277481_278150_+	hypothetical protein	NA	S6C473	Thermus_phage	99.5	8.0e-113
WP_033012591.1|278282_278531_+	hypothetical protein	NA	S6B9Y8	Thermus_phage	100.0	2.5e-35
WP_014194720.1|278609_279062_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	100.0	9.7e-78
WP_146331435.1|279104_280412_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	100.0	6.4e-231
WP_014194722.1|280392_281646_+	hypothetical protein	NA	S6B1L6	Thermus_phage	100.0	3.7e-236
WP_014194724.1|281951_282392_+|terminase	terminase small subunit	terminase	S6B9Y6	Thermus_phage	100.0	9.8e-75
WP_146331439.1|282378_283641_+|terminase	PBSX family phage terminase large subunit	terminase	S6AVV7	Thermus_phage	100.0	2.2e-244
WP_014194726.1|283654_285079_+|portal	phage portal protein	portal	S6BFK8	Thermus_phage	100.0	4.9e-277
WP_014194727.1|285071_286529_+|head	SPP1 family phage head morphogenesis protein	head	S6B1L4	Thermus_phage	100.0	6.6e-277
WP_014194728.1|286525_286720_+	hypothetical protein	NA	S6C469	Thermus_phage	100.0	1.2e-29
WP_014194729.1|286851_287409_+	methyl-accepting chemotaxis protein	NA	S6B9Y2	Thermus_phage	100.0	5.5e-75
WP_014194730.1|287429_288248_+|capsid	N4-gp56 family major capsid protein	capsid	S6AVV3	Thermus_phage	100.0	1.5e-153
WP_014194732.1|288407_288749_+	hypothetical protein	NA	S6B1K9	Thermus_phage	100.0	1.7e-58
WP_014194733.1|288750_289116_+	hypothetical protein	NA	S6C466	Thermus_phage	100.0	6.4e-64
WP_014194734.1|289115_289514_+	HK97 gp10 family phage protein	NA	S6B9X8	Thermus_phage	100.0	8.5e-70
WP_014194735.1|289503_289911_+	hypothetical protein	NA	S6AVU9	Thermus_phage	100.0	2.7e-71
WP_014194736.1|289894_290077_+	hypothetical protein	NA	S6BFJ9	Thermus_phage	100.0	1.4e-24
WP_014194737.1|290076_291375_+|tail	Sheath tail protein	tail	S6B1K7	Thermus_phage	100.0	1.0e-244
WP_014194738.1|291393_291858_+|tail	phage tail tube protein	tail	S6C462	Thermus_phage	100.0	4.8e-80
WP_014194739.1|291869_292271_+	hypothetical protein	NA	S6B9X5	Thermus_phage	100.0	2.3e-70
WP_075261445.1|292270_292450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014194740.1|292454_294713_+	tape measure protein	NA	S6AVU8	Thermus_phage	100.0	0.0e+00
WP_014194741.1|294712_295384_+	LysM peptidoglycan-binding domain-containing protein	NA	S6BFJ4	Thermus_phage	100.0	6.4e-126
WP_014194742.1|295385_296345_+	hypothetical protein	NA	S6B1K2	Thermus_phage	100.0	7.6e-173
WP_014194743.1|296346_296604_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	100.0	6.1e-37
WP_014194744.1|296603_297017_+	DUF2634 domain-containing protein	NA	S6B9X2	Thermus_phage	100.0	1.2e-69
WP_014194745.1|297009_298050_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	100.0	2.3e-191
WP_014194746.1|298050_298635_+	YmfQ family protein	NA	S6BFJ0	Thermus_phage	100.0	1.6e-109
WP_014194748.1|300081_300456_+	hypothetical protein	NA	S6C455	Thermus_phage	100.0	3.9e-64
WP_033012595.1|300677_301097_+|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	100.0	1.1e-67
WP_014194750.1|301093_301762_+	LysM peptidoglycan-binding domain-containing protein	NA	S6BFI4	Thermus_phage	100.0	1.0e-128
WP_014194751.1|301885_302233_+	hypothetical protein	NA	S6B1J4	Thermus_phage	100.0	3.6e-56
WP_014194752.1|302613_303669_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_014194754.1|304052_304445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194755.1|304564_305935_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_014194756.1|306136_307087_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014194757.1|307083_308265_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_014194758.1|308261_310424_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011229763.1|310627_312160_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.5	3.8e-17
WP_014194759.1|312450_313776_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.4	1.1e-52
WP_020279816.1|313864_314236_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011229765.1|320321_320771_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
319653:319688	attR	AGCAAGAAAAGTGGAGGCCGCCCGCTTATCGGCGAG	NA	NA	NA	NA
WP_011229766.1|321131_321620_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.9	3.1e-21
WP_011229767.1|321612_322761_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_013144127.1|322757_324053_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_014194762.1|324113_324857_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	42.5	9.4e-46
WP_014194763.1|324844_325099_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014194764.1|325095_325782_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014194765.1|325765_327994_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.1	7.7e-168
WP_011229773.1|327969_329382_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.7	8.3e-51
WP_014194766.1|329505_330546_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.3	8.0e-67
WP_011229775.1|330542_331175_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	4.1e-26
WP_014194767.1|331137_332676_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	1.3e-78
WP_014194768.1|332699_333992_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_011229779.1|334301_334547_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_014194770.1|334642_336388_+	adenine deaminase	NA	NA	NA	NA	NA
WP_081130754.1|336406_337435_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_014194772.1|337527_337863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014194773.1|337960_338680_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_025039099.1|338708_340883_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.1	2.2e-135
WP_014194775.1|340903_342916_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.0	1.2e-127
WP_014194776.1|342912_344136_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_014194777.1|344336_345191_-|transposase	transposase	transposase	A0A1L2BWW3	Bacteriophage	33.7	3.8e-22
WP_011229787.1|345375_345933_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	29.4	8.7e-12
WP_014194778.1|346366_347143_-	VOC family protein	NA	NA	NA	NA	NA
WP_014194779.1|347172_347721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194780.1|348343_348634_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_011229791.1|348646_350104_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_011229792.1|350117_351548_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_011229793.1|351723_353028_+	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	26.4	4.1e-20
WP_025039125.1|353546_354626_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_041470245.1|354932_356213_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011229796.1|356651_357041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229797.1|357158_358040_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_014194784.1|358023_358764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229799.1|358760_359462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229800.1|359475_360129_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	32.2	6.2e-25
WP_011229802.1|360542_361904_-|transposase	IS4-like element ISGka3 family transposase	transposase	NA	NA	NA	NA
WP_089113994.1|363581_363899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094239504.1|363947_364052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014194788.1|364444_367585_+	lantibiotic dehydratase	NA	A0A2H4PQG8	Staphylococcus_phage	26.3	5.7e-92
WP_014194791.1|368690_369860_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.7	3.4e-26
WP_020279663.1|371003_372311_+	lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_004888808.1|372652_373351_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014194795.1|373337_374756_+	HAMP domain-containing histidine kinase	NA	Q6XM27	Feldmannia_irregularis_virus	23.1	7.4e-07
WP_014194791.1|375046_376216_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.7	3.4e-26
WP_041470246.1|376313_376739_-	NisI/SpaI family lantibiotic immunity lipoprotein	NA	NA	NA	NA	NA
WP_004888811.1|376793_377582_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_008881432.1|377583_378330_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_008881431.1|378348_379038_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.0	5.1e-54
WP_011229818.1|379640_380270_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011229819.1|380524_381652_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.5	2.5e-29
WP_014194799.1|381668_382571_-	proline/glycine betaine ABC-type transport system, permease component fused to periplasmic component	NA	NA	NA	NA	NA
WP_014194800.1|383151_384810_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014194801.1|384938_385586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194802.1|385730_387221_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_014194803.1|387223_388420_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_014194804.1|388379_392501_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_014194805.1|392497_393718_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_014194806.1|393860_394787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011229827.1|398439_398664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194810.1|400205_401438_-	MFS transporter	NA	NA	NA	NA	NA
WP_014194812.1|401637_402291_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_014194813.1|402250_402775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194816.1|403683_405993_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_014194819.1|406645_408019_-	GHKL domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.0	5.7e-12
WP_015373859.1|408008_408671_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	1.6e-33
WP_014194821.1|408850_409276_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014194822.1|409299_409485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014194823.1|409465_410671_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.1	1.0e-12
WP_014194824.1|411094_411973_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_021322237.1|412110_412836_+	distant relative of cell wall-associated hydrolase-like protein	NA	NA	NA	NA	NA
WP_011229842.1|414493_414883_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011229843.1|415019_415886_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011229844.1|416098_416638_+	membrane protein	NA	NA	NA	NA	NA
WP_011229845.1|416660_418178_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.1	2.7e-07
WP_011229846.1|418320_419241_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.9	1.2e-26
WP_014194830.1|419318_420692_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.8	1.8e-127
WP_014194831.1|421029_422487_+	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	27.9	1.1e-24
WP_020279715.1|422498_423665_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.0	1.1e-08
WP_025039117.1|423707_427049_+	DUF4145 domain-containing protein	NA	A0A097BY72	Enterococcus_phage	25.2	6.8e-19
WP_011229851.1|427307_427922_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011229852.1|429117_429681_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011229853.1|429823_431071_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.1	1.3e-10
WP_011229854.1|431063_431864_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011229855.1|432163_432532_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.9	1.2e-49
WP_014194838.1|432524_434735_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	85.1	0.0e+00
WP_014194839.1|434765_435899_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	578625	631445	3596620	tRNA,transposase	Bacillus_phage(30.77%)	47	NA	NA
WP_011229986.1|578625_579768_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011229987.1|579829_580693_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_011229988.1|580713_581187_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_011229990.1|581510_583406_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	38.4	2.4e-109
WP_014194932.1|583714_584872_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	45.3	1.4e-24
WP_014194933.1|584947_585640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194934.1|585906_586884_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011230062.1|586942_587623_-	response regulator	NA	W8CYM9	Bacillus_phage	26.4	4.6e-07
WP_011230063.1|587686_589264_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.6	9.7e-08
WP_014194935.1|589577_590618_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025039067.1|590778_592041_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011230066.1|592323_593151_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	52.0	5.7e-76
WP_011230067.1|593298_593991_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_011230068.1|594102_595443_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011230069.1|595517_596417_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_014194938.1|596555_596954_+	YhcU family protein	NA	NA	NA	NA	NA
WP_011230071.1|597279_597753_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014194940.1|597749_598187_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011230073.1|598360_598807_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	39.7	3.0e-15
WP_014194941.1|598923_600681_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	49.5	1.2e-160
WP_013146280.1|600728_600986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025039331.1|601166_601415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230077.1|601444_602050_-	DedA family protein	NA	NA	NA	NA	NA
WP_014194943.1|602209_603040_+	stage V sporulation protein R	NA	NA	NA	NA	NA
WP_014194944.1|603314_605186_+	ATPase AAA	NA	NA	NA	NA	NA
WP_011230080.1|605968_606550_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011230081.1|606867_607341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749256.1|607477_608200_+	iron permease	NA	NA	NA	NA	NA
WP_011230084.1|608491_608800_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011230085.1|608814_609762_+	cation transporter	NA	NA	NA	NA	NA
WP_011230086.1|609787_610834_+	SidA/IucD/PvdA family monooxygenase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.0	7.6e-17
WP_011230088.1|612734_613103_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	78.7	1.8e-50
WP_011230089.1|613095_615234_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.8	0.0e+00
WP_041470248.1|615524_616370_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_014194949.1|617552_619211_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014194950.1|619239_619533_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011230091.1|620151_620499_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	36.6	6.0e-11
WP_011230092.1|620538_621600_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_011230093.1|621620_622043_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	62.9	2.7e-42
WP_011230094.1|622191_622638_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011230095.1|622829_623372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012749415.1|623575_624856_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011230096.1|625252_626047_+	arsenite methyltransferase	NA	NA	NA	NA	NA
WP_011230097.1|626174_626666_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231214.1|626894_627773_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_014194953.1|627908_629570_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.9	1.8e-65
WP_012749415.1|630164_631445_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	827601	874141	3596620	transposase	Bacillus_phage(25.0%)	39	NA	NA
WP_014195112.1|827601_828882_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014195113.1|829278_829956_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014195114.1|830214_831015_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014195116.1|832044_833412_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014194630.1|834120_834678_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_025039361.1|835210_835489_+	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_011232756.1|835488_835884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232755.1|835852_836110_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_011232754.1|836459_836912_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011232753.1|837168_838935_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011232752.1|839008_839608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195121.1|839751_840756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232750.1|840926_841424_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011232749.1|841657_841858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232748.1|841901_842375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524772.1|843599_844493_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_014195125.1|844532_845546_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014195126.1|846041_847367_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_011232743.1|847368_848247_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_011232742.1|848233_849064_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014195127.1|849105_850053_+	DUF1861 family protein	NA	NA	NA	NA	NA
WP_011232740.1|850055_851114_+	glycosidase	NA	NA	NA	NA	NA
WP_011232739.1|851395_852283_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.7	1.1e-77
WP_011232738.1|852325_853639_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011232737.1|853641_854073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195130.1|854094_854472_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_014195131.1|854475_854961_+	Appr-1-p processing protein	NA	G3MBI4	Bacillus_virus	56.1	1.7e-43
WP_011232734.1|855241_856213_+	DUF1861 family protein	NA	NA	NA	NA	NA
WP_041470253.1|856826_859589_-	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.0	5.8e-32
WP_014195136.1|859585_861253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195137.1|861445_862762_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_014195139.1|863059_865255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195141.1|865781_867116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232727.1|867202_867913_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	35.4	6.1e-26
WP_080729647.1|868040_868274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049787559.1|868683_870024_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_014195145.1|870338_871217_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014195146.1|871728_872286_+	signal peptidase I	NA	NA	NA	NA	NA
WP_014195147.1|872482_874141_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	1060129	1107905	3596620	protease,transposase	uncultured_Caudovirales_phage(18.18%)	41	NA	NA
WP_014194800.1|1060129_1061788_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_152540314.1|1061784_1062051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195281.1|1062173_1063598_-	amino acid permease	NA	NA	NA	NA	NA
WP_021321685.1|1064694_1066389_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_014195285.1|1066609_1067125_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_122983902.1|1067196_1068468_+	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
WP_014195287.1|1068492_1068705_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_014195289.1|1069153_1069807_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014195290.1|1069834_1070254_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_014195291.1|1070243_1070651_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_014195292.1|1070931_1073064_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.8	1.6e-125
WP_025039183.1|1073331_1074078_+	FixH family protein	NA	NA	NA	NA	NA
WP_014195294.1|1074185_1075226_+	membrane protein	NA	NA	NA	NA	NA
WP_014195295.1|1075285_1076896_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.7	2.1e-13
WP_014195296.1|1077036_1078551_+	spore germination protein	NA	NA	NA	NA	NA
WP_021322459.1|1078562_1079648_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_014195298.1|1079674_1080787_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_031206548.1|1080959_1081631_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	3.9e-67
WP_011230477.1|1081627_1082065_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.0	9.6e-06
WP_011230478.1|1082064_1082799_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.6	3.8e-55
WP_011230479.1|1082851_1083349_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.9	7.7e-52
WP_014195299.1|1083402_1084086_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_013145942.1|1084116_1084296_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_014195301.1|1084597_1085182_-	LysM peptidoglycan-binding domain-containing protein	NA	U5PWL4	Bacillus_phage	50.0	1.4e-41
WP_011230483.1|1085382_1085577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195302.1|1085748_1086423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195303.1|1086692_1087442_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	7.1e-17
WP_011230486.1|1087507_1087753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230487.1|1087808_1089101_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.0	2.1e-16
WP_014195304.1|1089420_1090569_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_014195305.1|1090757_1091579_-	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	34.6	1.8e-05
WP_011230491.1|1091721_1092579_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_014195306.1|1092811_1094830_+	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_011230496.1|1094936_1095203_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_014195308.1|1095202_1096924_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_011230498.1|1097008_1097560_-|protease	spore protease YyaC	protease	NA	NA	NA	NA
WP_011230499.1|1097640_1097832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049787561.1|1098223_1098808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014194571.1|1104882_1106247_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014195312.1|1106847_1107375_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.1	5.5e-08
WP_014195313.1|1107374_1107905_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	1499788	1572463	3596620	tRNA,transposase	Bacillus_phage(28.57%)	55	NA	NA
WP_014195570.1|1499788_1501201_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_014195572.1|1501453_1502326_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_014195573.1|1502569_1503061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195574.1|1503336_1504215_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_033012441.1|1504482_1505988_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_025039163.1|1506337_1506886_+	YpiB family protein	NA	NA	NA	NA	NA
WP_011230895.1|1506990_1508115_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011230896.1|1508221_1509016_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_014195578.1|1509152_1509992_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011230898.1|1510361_1510619_+	membrane protein	NA	NA	NA	NA	NA
WP_014195580.1|1510849_1512511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195581.1|1512526_1513048_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011230900.1|1513305_1513776_+	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_011230901.1|1513843_1514161_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_011230902.1|1514354_1514663_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011230903.1|1514680_1515604_+	cation transporter	NA	NA	NA	NA	NA
WP_014195583.1|1515634_1516531_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014195584.1|1516760_1518590_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_014195585.1|1518616_1520338_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_025039334.1|1520690_1522157_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014195589.1|1522608_1523556_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	50.5	5.0e-84
WP_014195590.1|1523548_1524499_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_014195591.1|1524492_1525248_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.3	2.3e-15
WP_014195592.1|1525515_1526475_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041470282.1|1526513_1527284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195594.1|1527455_1531193_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014195596.1|1531571_1533005_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	45.2	9.8e-108
WP_014195597.1|1533108_1533420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195598.1|1533681_1535190_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_014195599.1|1535536_1536427_+	apolipoprotein acyltransferase	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	37.2	2.1e-44
WP_031206329.1|1536495_1537851_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014195600.1|1537870_1539160_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_041470258.1|1539178_1540594_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_011230920.1|1540673_1540904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195602.1|1541210_1542839_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014195603.1|1543219_1544500_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014195604.1|1544897_1546364_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014195605.1|1546393_1547746_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_025039002.1|1548171_1549158_+	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_014195607.1|1549357_1550269_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014195608.1|1550394_1554954_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014195609.1|1555100_1556585_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_014195603.1|1556728_1558009_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014195610.1|1558558_1559161_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_014195611.1|1559328_1559991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195612.1|1560142_1562236_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_014195613.1|1562260_1563133_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014195614.1|1563129_1563858_-	NAD-dependent deacylase	NA	S5M4R0	Bacillus_phage	42.2	2.9e-47
WP_011230934.1|1564003_1564555_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_014195615.1|1564913_1566350_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_014195616.1|1566495_1567251_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_013145591.1|1567330_1567555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230938.1|1568021_1568756_+	sporulation protein	NA	A0A0E3T7R5	Bacillus_phage	64.0	1.9e-38
WP_014195317.1|1569201_1570338_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	1.6e-36
WP_014195619.1|1571407_1572463_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 6
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	1719264	1764956	3596620	transposase	Staphylococcus_phage(40.0%)	41	NA	NA
WP_041470235.1|1719264_1720440_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014195727.1|1721076_1722210_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014194571.1|1722483_1723848_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_011231104.1|1724690_1724840_+	YflJ family protein	NA	NA	NA	NA	NA
WP_015374752.1|1724964_1725159_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_014195730.1|1725305_1725512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230853.1|1726121_1727381_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014195731.1|1727455_1728748_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014195732.1|1728788_1729055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195733.1|1729154_1730303_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_014195734.1|1730299_1731835_-	spore germination protein	NA	NA	NA	NA	NA
WP_014195735.1|1731831_1732929_-	endospore germination permease	NA	NA	NA	NA	NA
WP_014195736.1|1733188_1733467_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_014195739.1|1733959_1734859_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	4.4e-21
WP_014195740.1|1734866_1736543_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014195741.1|1736612_1736840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195742.1|1736965_1738591_+	spore germination protein	NA	NA	NA	NA	NA
WP_014195743.1|1738587_1739790_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_014195744.1|1739844_1740948_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_014195746.1|1741176_1742622_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_014195747.1|1742634_1743060_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011231124.1|1743153_1743579_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014195748.1|1743985_1745722_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	3.1e-39
WP_025039155.1|1745705_1747511_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	4.2e-55
WP_014195750.1|1747670_1748318_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_014195751.1|1748323_1749328_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014195752.1|1749589_1750576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025039156.1|1750714_1751278_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014195755.1|1751536_1751926_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_014194949.1|1752189_1753848_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013523716.1|1754033_1755392_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011231133.1|1755658_1756546_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014195758.1|1756900_1758148_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	6.4e-63
WP_011231135.1|1758288_1759245_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014195759.1|1759469_1759769_+	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_011231137.1|1759778_1760576_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011231138.1|1760572_1761487_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.7	5.8e-37
WP_025039054.1|1761479_1762460_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021321939.1|1762528_1762996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231140.1|1763009_1763774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231141.1|1763900_1764956_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
>prophage 7
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	1804265	1822767	3596620	transposase	Bacteriophage(50.0%)	13	NA	NA
WP_014195799.1|1804265_1805513_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.9e-63
WP_041470235.1|1805597_1806773_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_014195800.1|1807157_1809365_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_015374815.1|1809761_1810187_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014195802.1|1810211_1810418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195804.1|1810621_1811719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195805.1|1811805_1812255_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014195807.1|1812654_1814313_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014195809.1|1815563_1816811_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.1	1.3e-10
WP_011229674.1|1816953_1817517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021321441.1|1818174_1818573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195814.1|1820133_1821501_+|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_014195816.1|1822209_1822767_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 8
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	1837951	1894612	3596620	transposase	Bacillus_virus(22.22%)	43	NA	NA
WP_014195832.1|1837951_1839610_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014195833.1|1840067_1840868_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011229674.1|1842254_1842818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014195836.1|1843088_1844291_+|transposase	IS21-like element IS5376 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	6.0e-50
WP_014195837.1|1844287_1845043_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	45.7	7.1e-57
WP_020959521.1|1845553_1846690_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.4	3.3e-42
WP_014195603.1|1847273_1848554_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011231223.1|1850092_1850287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195842.1|1850545_1851787_-	oligoribonuclease	NA	NA	NA	NA	NA
WP_011231225.1|1851804_1853709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231226.1|1853719_1854595_-	MoxR family ATPase	NA	R4TG24	Halovirus	29.7	9.8e-10
WP_011231227.1|1854721_1855096_-	replication terminator protein	NA	A0A0K2CP62	Brevibacillus_phage	40.4	2.1e-14
WP_014195843.1|1855205_1856108_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_014195844.1|1856331_1857567_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_011231230.1|1857738_1858182_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_011231232.1|1858478_1859354_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_011231233.1|1859451_1860630_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_014195845.1|1860734_1862234_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SL42	Klosneuvirus	32.7	1.6e-55
WP_011231235.1|1862364_1862814_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011231236.1|1863222_1864635_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_014195847.1|1864850_1865564_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014195848.1|1865586_1867278_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_011231239.1|1867392_1868811_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014195851.1|1869107_1869839_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013145319.1|1869943_1870288_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_014195852.1|1870284_1872729_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.7	8.3e-99
WP_011231243.1|1872788_1874726_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	46.2	1.9e-138
WP_011231244.1|1874886_1875306_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_021322623.1|1875797_1876388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195854.1|1876753_1878430_-	AarF/ABC1/UbiB kinase family protein	NA	A9YVW0	Ostreococcus_tauri_virus	33.5	4.1e-49
WP_011231247.1|1878481_1878781_-	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_014195856.1|1878927_1879776_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011231249.1|1881774_1882407_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_033007538.1|1882453_1884124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195862.1|1884402_1884690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523781.1|1884683_1885331_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_014195863.1|1885360_1886323_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_014195864.1|1886323_1887010_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_014195865.1|1887342_1887957_+	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_081472556.1|1888001_1888616_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_033845420.1|1888959_1890177_-	threonine synthase	NA	NA	NA	NA	NA
WP_011231254.1|1890487_1891723_+	peptidase T	NA	NA	NA	NA	NA
WP_014194949.1|1892953_1894612_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	2016660	2046267	3596620	transposase	Bacillus_virus(50.0%)	20	NA	NA
WP_012749092.1|2016660_2017941_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014195983.1|2018338_2019217_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_049787570.1|2019504_2020716_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014195986.1|2020729_2022271_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.1	4.1e-19
WP_011231399.1|2022352_2023432_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014195987.1|2023625_2024831_-	response regulator	NA	NA	NA	NA	NA
WP_020279035.1|2024844_2026620_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011231402.1|2026655_2027663_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014195991.1|2028931_2030389_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_014195992.1|2030484_2031921_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033012551.1|2032567_2033218_+	cyclase family protein	NA	NA	NA	NA	NA
WP_014195996.1|2035208_2035442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011229816.1|2036332_2037523_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	2.2e-28
WP_014195998.1|2037577_2038441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014194949.1|2038594_2040253_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_128082669.1|2040483_2040681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195999.1|2040920_2041478_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_011230382.1|2042862_2043663_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014196002.1|2044639_2044903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196004.1|2045133_2046267_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	2323732	2379246	3596620	protease,coat,transposase	Bacillus_phage(22.22%)	57	NA	NA
WP_014196217.1|2323732_2323963_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_014196218.1|2323959_2324220_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_011231723.1|2324254_2324824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231724.1|2324849_2325296_-	YpbF family protein	NA	NA	NA	NA	NA
WP_011231725.1|2325394_2325925_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011231726.1|2325921_2326506_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014196219.1|2326489_2328013_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.0	3.3e-61
WP_014196220.1|2328000_2329047_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011231729.1|2329301_2329550_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	53.3	5.6e-19
WP_011231730.1|2329714_2330218_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	44.8	1.0e-27
WP_012820732.1|2330439_2332014_+	phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	34.0	1.0e-33
WP_011231732.1|2332275_2333088_-	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_011231736.1|2333396_2334491_-	UDP-glucose dehydrogenase	NA	NA	NA	NA	NA
WP_011231737.1|2334468_2335014_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_014196222.1|2335127_2335844_-	ATPase	NA	NA	NA	NA	NA
WP_014196223.1|2335836_2336325_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_011231740.1|2336321_2336900_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014196224.1|2336914_2337331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196225.1|2337282_2337915_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011231743.1|2337872_2338661_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011231744.1|2338657_2339215_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_025039355.1|2339211_2340282_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011231746.1|2340238_2341213_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_011231747.1|2341209_2342682_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.0	2.9e-14
WP_013144861.1|2342678_2343713_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_011231749.1|2343699_2344659_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020278285.1|2345336_2345951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196229.1|2346135_2347500_-	amino acid permease	NA	NA	NA	NA	NA
WP_041470264.1|2347513_2348419_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_014196231.1|2348500_2349787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196233.1|2350498_2351416_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_014195799.1|2352230_2353478_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.9e-63
WP_014196235.1|2353716_2354448_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014196236.1|2354444_2355206_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_014196237.1|2355196_2356399_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_014196238.1|2356538_2358332_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	35.6	2.5e-36
WP_014196239.1|2358331_2359078_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.8	7.3e-46
WP_011231762.1|2359153_2360341_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_014196240.1|2360327_2361992_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_011231764.1|2362005_2362530_-	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
WP_011231765.1|2362672_2363404_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011231766.1|2363536_2364070_-	spore maturation protein	NA	NA	NA	NA	NA
WP_011231767.1|2364069_2364666_-	spore maturation protein	NA	NA	NA	NA	NA
WP_014196241.1|2364658_2365807_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	3.9e-22
WP_025039220.1|2366156_2367470_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	5.2e-39
WP_011231771.1|2367827_2368229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231772.1|2368247_2368901_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.3	1.7e-14
WP_033007637.1|2369076_2369832_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.2e-08
WP_011231774.1|2370026_2370566_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_011231775.1|2370588_2370945_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231776.1|2371065_2371530_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.1	1.0e-42
WP_014196246.1|2371550_2372744_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	1.5e-117
WP_011231778.1|2372764_2373409_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.3	1.9e-39
WP_014196247.1|2373363_2374506_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	2.0e-55
WP_011231780.1|2375007_2375448_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_014196252.1|2376640_2377759_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.1	2.8e-86
WP_041470265.1|2378100_2379246_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.0	4.4e-42
>prophage 11
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	2456095	2475839	3596620	integrase,transposase	Paenibacillus_phage(40.0%)	20	2449767:2449782	2477650:2477665
2449767:2449782	attL	CGTCGGAAAAGCGGGC	NA	NA	NA	NA
WP_014196309.1|2456095_2456974_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014196310.1|2457552_2458161_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_014196311.1|2458414_2459140_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_033845382.1|2459231_2459831_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033845381.1|2459997_2460516_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033845380.1|2460694_2461147_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049787562.1|2461193_2462081_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	39.4	6.6e-54
WP_033845379.1|2462342_2463032_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_014194791.1|2463567_2464737_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.7	3.4e-26
WP_033845378.1|2464850_2465351_-	VanZ family protein	NA	NA	NA	NA	NA
WP_081472566.1|2465534_2465900_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_008880572.1|2465948_2467118_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.2	1.9e-24
WP_033845200.1|2467501_2467831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196315.1|2468045_2468627_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_014194800.1|2468796_2470455_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_081472560.1|2470658_2471291_-	methyltransferase	NA	NA	NA	NA	NA
WP_041470289.1|2472025_2472589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014196317.1|2472731_2473979_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.1	1.3e-10
WP_011229854.1|2473971_2474772_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014196318.1|2474963_2475839_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.1	8.3e-25
2477650:2477665	attR	CGTCGGAAAAGCGGGC	NA	NA	NA	NA
>prophage 12
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	2675008	2735474	3596620	protease,coat,tRNA,transposase	Salmonella_phage(20.0%)	57	NA	NA
WP_014196415.1|2675008_2676568_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_011232075.1|2676726_2677830_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_011232076.1|2677844_2678675_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014196416.1|2678703_2680260_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_021321862.1|2680365_2681490_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_014196418.1|2681505_2682045_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_011232080.1|2682153_2683002_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_011232081.1|2683023_2683467_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_011232082.1|2683483_2684782_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014196420.1|2685019_2685568_-	sporulation protein	NA	NA	NA	NA	NA
WP_011232084.1|2685738_2686029_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011232085.1|2686044_2686374_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_011232086.1|2686376_2686685_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_021321861.1|2687154_2688015_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_014196422.1|2688007_2688775_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_013524236.1|2688750_2689011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196423.1|2689034_2689841_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_041470266.1|2689843_2690536_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011232091.1|2690576_2691095_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011232092.1|2691091_2691958_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_011232093.1|2691977_2693000_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_015375501.1|2693157_2693838_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014196426.1|2693973_2694549_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_014196428.1|2694985_2696101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232097.1|2696217_2696679_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_014196429.1|2696700_2697420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196430.1|2697416_2697992_-	fimbrial protein	NA	NA	NA	NA	NA
WP_014196431.1|2697981_2698920_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_014196432.1|2698941_2699688_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014196433.1|2699716_2700235_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014196434.1|2700320_2701532_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014196435.1|2701518_2702574_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_014196436.1|2702586_2704251_-	type II secretion system protein E	NA	NA	NA	NA	NA
WP_014196437.1|2704247_2705618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196438.1|2705634_2706414_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_014196439.1|2706403_2708020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196440.1|2708163_2708784_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014196441.1|2708767_2709346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014196442.1|2709388_2711095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014196443.1|2711189_2713460_-	VWA domain-containing protein	NA	J9Q6D6	Salmonella_phage	29.1	2.2e-08
WP_033012303.1|2713528_2714824_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014196445.1|2715040_2717683_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.4	9.4e-165
WP_014194571.1|2718233_2719598_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_011232115.1|2719874_2720063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014196447.1|2720101_2721133_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_014196448.1|2721177_2722233_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_011232118.1|2722351_2723641_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013144588.1|2723657_2724632_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014196449.1|2724632_2725403_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014196450.1|2725402_2726332_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014196451.1|2726347_2727166_-	cytochrome c	NA	NA	NA	NA	NA
WP_011232123.1|2727176_2728541_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011232124.1|2728707_2729193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014196452.1|2729234_2729822_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014196453.1|2729818_2732161_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.3	1.7e-173
WP_014196454.1|2732391_2734065_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.7	1.1e-12
WP_011232128.1|2734208_2735474_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.0	6.3e-151
>prophage 13
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	3256002	3285887	3596620	protease,transposase	Bacillus_phage(25.0%)	15	NA	NA
WP_041470268.1|3256002_3257235_-|protease	serine protease	protease	U5Q0C0	Bacillus_phage	39.5	2.0e-16
WP_146331517.1|3257847_3261486_-	endonuclease	NA	NA	NA	NA	NA
WP_081472563.1|3262011_3263481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146331540.1|3263466_3266460_-	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	25.4	7.0e-23
WP_146331520.1|3266753_3267797_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	27.9	5.6e-28
WP_049787565.1|3267890_3268295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196821.1|3268446_3269358_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013524694.1|3269357_3269966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196822.1|3270179_3272507_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_014196823.1|3273163_3274495_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014196825.1|3275086_3276334_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	2.4e-62
WP_014196827.1|3277109_3277904_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_014196828.1|3277908_3278301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041470270.1|3278608_3279328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196823.1|3284555_3285887_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	3322377	3435376	3596620	transposase	Bacillus_phage(17.65%)	95	NA	NA
WP_014196869.1|3322377_3323256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011232682.1|3323469_3324813_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_011232683.1|3324937_3325693_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014196870.1|3325698_3327135_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	31.6	7.7e-52
WP_014196872.1|3327508_3328876_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_014196873.1|3328922_3329900_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_033012451.1|3329900_3330980_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_014196875.1|3331066_3332362_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_014196877.1|3333016_3333412_+	VOC family protein	NA	NA	NA	NA	NA
WP_014196878.1|3333516_3334503_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014196879.1|3334598_3335036_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_014196881.1|3335264_3335684_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	61.2	3.6e-42
WP_033013564.1|3335699_3336764_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_014196883.1|3336788_3337136_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	47.6	2.1e-11
WP_014196884.1|3337360_3337744_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_014196885.1|3337805_3337991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232696.1|3338146_3339082_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_011232697.1|3339116_3340061_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_014196887.1|3340057_3341551_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	3.7e-17
WP_011232699.1|3341572_3341983_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_014196888.1|3341982_3342876_-	ribokinase	NA	NA	NA	NA	NA
WP_011232701.1|3342872_3343862_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.0	2.9e-26
WP_011232703.1|3344372_3344825_-	VanZ family protein	NA	NA	NA	NA	NA
WP_011232704.1|3345163_3345334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014196889.1|3345638_3346826_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014196892.1|3349578_3349884_-	symporter	NA	NA	NA	NA	NA
WP_011232711.1|3349880_3350081_-	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_014196893.1|3350117_3351302_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014196894.1|3351335_3352565_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_014196895.1|3352721_3354050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196896.1|3354306_3355680_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.2	1.0e-85
WP_014196898.1|3355903_3357214_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_014196899.1|3357786_3359154_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_021321441.1|3360714_3361113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011229674.1|3361770_3362334_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011229853.1|3362476_3363724_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.1	1.3e-10
WP_014196900.1|3363716_3364517_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014196901.1|3364975_3366634_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014195146.1|3366830_3367388_-	signal peptidase I	NA	NA	NA	NA	NA
WP_014195145.1|3367899_3368778_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_049787559.1|3369092_3370433_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_080729647.1|3370842_3371076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232727.1|3371203_3371914_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	35.4	6.1e-26
WP_014195141.1|3372000_3373335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195139.1|3373861_3376057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195137.1|3376354_3377671_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_014195136.1|3377863_3379531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041470253.1|3379527_3382290_+	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.0	5.8e-32
WP_011232734.1|3382903_3383875_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_014195131.1|3384155_3384641_-	Appr-1-p processing protein	NA	G3MBI4	Bacillus_virus	56.1	1.7e-43
WP_014195130.1|3384644_3385022_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_011232737.1|3385043_3385475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232738.1|3385477_3386791_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011232739.1|3386833_3387721_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.7	1.1e-77
WP_011232740.1|3388002_3389061_-	glycosidase	NA	NA	NA	NA	NA
WP_014195127.1|3389063_3390011_-	DUF1861 family protein	NA	NA	NA	NA	NA
WP_011232742.1|3390052_3390883_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_011232743.1|3390869_3391748_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014195126.1|3391749_3393075_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014195125.1|3393570_3394584_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013524772.1|3394623_3395517_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_011232748.1|3396741_3397215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232749.1|3397258_3397459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232750.1|3397692_3398190_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_014195121.1|3398360_3399365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232752.1|3399508_3400108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232753.1|3400181_3401948_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011232754.1|3402204_3402657_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011232755.1|3403006_3403264_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_011232756.1|3403232_3403628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025039361.1|3403627_3403906_-	DUF3467 domain-containing protein	NA	NA	NA	NA	NA
WP_014194630.1|3404438_3404996_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_014196903.1|3405136_3406390_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.8	6.3e-10
WP_014196904.1|3406382_3407183_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014196905.1|3407380_3407776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196906.1|3407781_3409308_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011232761.1|3410251_3410998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196909.1|3410999_3411872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196910.1|3412020_3413454_-	caspase family protein	NA	NA	NA	NA	NA
WP_011229816.1|3413995_3415186_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.2	2.2e-28
WP_014196914.1|3417622_3418771_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014196915.1|3418811_3419444_-	acetyltransferase	NA	NA	NA	NA	NA
WP_041470271.1|3419443_3420076_-	sugar transferase	NA	NA	NA	NA	NA
WP_014196917.1|3420090_3421113_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	50.5	2.9e-93
WP_014196918.1|3421137_3422280_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014196919.1|3422340_3423669_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.3	1.3e-93
WP_014196920.1|3423722_3424727_-	NAD-dependent epimerase	NA	A0A2K9KZK0	Tupanvirus	25.0	1.4e-20
WP_014196921.1|3424723_3425884_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_146331543.1|3425909_3427040_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014196923.1|3426945_3428244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025038875.1|3428435_3429545_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014196925.1|3429578_3430586_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	29.4	1.8e-07
WP_014196926.1|3430632_3432033_-	flippase	NA	NA	NA	NA	NA
WP_014196929.1|3433581_3434136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195149.1|3434497_3435376_-|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_016593	Geobacillus thermoleovorans CCB_US3_UF5, complete genome	3596620	3566072	3575892	3596620		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_011232933.1|3566072_3567293_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	6.1e-18
WP_011232934.1|3567394_3568189_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	37.7	6.5e-45
WP_011232935.1|3568195_3568978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232936.1|3568964_3570293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014197025.1|3570285_3572115_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.0	1.2e-22
WP_011232938.1|3572121_3572835_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.7e-44
WP_011232939.1|3573023_3574310_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.7	8.6e-71
WP_011232940.1|3574527_3575892_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	7.9e-123
