The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017278	Thermus sp. CCB_US3_UF1, complete genome	2243772	1694078	1759605	2243772	integrase,tRNA,transposase	Bacillus_phage(40.0%)	51	1730515:1730560	1759675:1759720
WP_014516094.1|1694078_1695494_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014516095.1|1695528_1695969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014516096.1|1695968_1696883_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_041434017.1|1697056_1697464_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_014516099.1|1697765_1698479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041434018.1|1698489_1700577_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	38.4	8.7e-113
WP_014516101.1|1700638_1701532_+	phosphoglucomutase	NA	NA	NA	NA	NA
WP_014516102.1|1701528_1702482_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014516103.1|1702540_1704187_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	1.5e-35
WP_014516104.1|1704284_1704719_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_014516105.1|1704715_1705588_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_014516106.1|1705656_1706472_-	3-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_014516107.1|1706475_1707183_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_014516108.1|1707208_1707838_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.3	1.9e-31
WP_014516109.1|1707886_1708537_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014516110.1|1708558_1709290_+	2-phosphosulfolactate phosphatase	NA	NA	NA	NA	NA
WP_014516111.1|1709286_1710600_-	dipeptidase	NA	NA	NA	NA	NA
WP_014516112.1|1710596_1710935_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155983287.1|1710976_1711801_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014516114.1|1711833_1713396_+	malate synthase A	NA	NA	NA	NA	NA
WP_014516115.1|1713435_1714821_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_041433847.1|1714807_1715854_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_014516117.1|1715858_1717127_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_014516118.1|1717123_1718347_+	DUF4147 domain-containing protein	NA	NA	NA	NA	NA
WP_041434020.1|1718360_1719482_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_014516122.1|1719901_1720291_-	NADH-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_014516123.1|1720370_1723322_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_041433848.1|1723359_1723539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081477229.1|1723626_1726746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081477230.1|1726772_1727612_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014516126.1|1727762_1730456_+	hypothetical protein	NA	NA	NA	NA	NA
1730515:1730560	attL	TGGTGGGCGCGAGTGGACTTGAACCACCGACCCCTACCGTGTCAAG	NA	NA	NA	NA
WP_014514494.1|1730633_1731854_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_155983288.1|1732111_1732534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041434024.1|1732596_1733217_+	helix-turn-helix domain-containing protein	NA	Q859R0	Thermus_virus	38.2	6.5e-08
WP_014516129.1|1733605_1733917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014514494.1|1734112_1735333_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041433850.1|1735240_1736863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014514494.1|1737098_1738319_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014514485.1|1738412_1739504_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014516132.1|1742987_1743197_-	peptidase C26	NA	NA	NA	NA	NA
WP_014516133.1|1743436_1745554_-	alpha-amylase	NA	NA	NA	NA	NA
WP_050802042.1|1745698_1745962_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014516135.1|1745954_1746341_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_014516136.1|1746371_1747127_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014514494.1|1748421_1749642_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014516139.1|1751090_1751624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003043751.1|1751824_1753021_-	MFS transporter	NA	NA	NA	NA	NA
WP_014632236.1|1753013_1754489_-	radical SAM protein	NA	NA	NA	NA	NA
WP_014516140.1|1754754_1756239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014516141.1|1756336_1756576_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081477232.1|1758987_1759605_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	31.8	2.4e-18
1759675:1759720	attR	TGGTGGGCGCGAGTGGACTTGAACCACCGACCCCTACCGTGTCAAG	NA	NA	NA	NA
>prophage 2
NC_017278	Thermus sp. CCB_US3_UF1, complete genome	2243772	2234169	2241253	2243772		Streptococcus_phage(16.67%)	9	NA	NA
WP_014516634.1|2234169_2234976_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.5	3.9e-37
WP_014516635.1|2234977_2235475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014516636.1|2235512_2236040_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	46.5	6.5e-33
WP_014516637.1|2236050_2236680_-	glycerophosphodiester phosphodiesterase	NA	M1HE48	Acanthocystis_turfacea_Chlorella_virus	29.6	6.0e-09
WP_014516638.1|2236702_2237377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014516639.1|2237349_2237658_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014516640.1|2237659_2239714_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	33.3	7.1e-27
WP_014516641.1|2239701_2240514_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	39.9	3.6e-22
WP_041434065.1|2240497_2241253_-	ParA family protein	NA	Q8JL10	Natrialba_phage	33.1	3.8e-18
