The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	33571	41945	5863081	tRNA	Streptococcus_phage(33.33%)	9	NA	NA
WP_014182622.1|33571_34450_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.6	1.3e-14
WP_014182623.1|34442_35255_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_014182624.1|35251_35557_+	DUF972 family protein	NA	NA	NA	NA	NA
WP_014182625.1|35597_36425_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	1.6e-62
WP_042331758.1|36528_36804_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.8	2.3e-21
WP_014182627.1|37026_38976_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	33.8	7.6e-103
WP_014182628.1|38972_39737_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014182629.1|39801_40695_+	G5 domain-containing protein	NA	U5PRV3	Bacillus_phage	47.9	9.1e-19
WP_014182630.1|40769_41945_+	DUF348 domain-containing protein	NA	S5YD02	Bacillus_phage	63.0	1.9e-16
>prophage 2
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	672681	681342	5863081	integrase,transposase	uncultured_virus(16.67%)	9	674305:674328	689214:689237
WP_014183189.1|672681_674322_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	57.7	5.9e-165
674305:674328	attL	ATGGGCGGCATGATGTAAGAAAAG	NA	NA	NA	NA
WP_014183190.1|674799_676311_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014183191.1|676303_677044_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	40.9	1.2e-40
WP_081468462.1|677091_677727_-|integrase	site-specific integrase	integrase	A0A1W6JPB2	Staphylococcus_phage	46.9	7.8e-41
WP_081468463.1|677898_678054_-	Arm DNA-binding domain-containing protein	NA	A0A0N9SGH8	Paenibacillus_phage	62.7	1.0e-10
WP_042330765.1|678059_678893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014183193.1|679065_679368_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158309002.1|679616_680432_+	hypothetical protein	NA	A8YQM0	Lactobacillus_phage	24.3	2.7e-09
WP_014183195.1|680400_681342_+	ATP-binding protein	NA	A0A0C5ACF6	Bacillus_phage	33.5	1.9e-22
689214:689237	attR	ATGGGCGGCATGATGTAAGAAAAG	NA	NA	NA	NA
>prophage 3
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	713306	720549	5863081		Synechococcus_phage(42.86%)	7	NA	NA
WP_014183221.1|713306_713807_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.3	6.2e-25
WP_014183222.1|713855_715154_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.0	2.3e-23
WP_014183223.1|715173_715887_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	39.8	3.6e-42
WP_014183224.1|715939_717358_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	1.1e-58
WP_014183225.1|717380_718394_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	46.3	1.2e-72
WP_014183226.1|718390_719008_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	2.4e-26
WP_014183227.1|719004_720549_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.7	2.6e-74
>prophage 4
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	2307096	2329159	5863081	integrase,transposase	Bacillus_phage(50.0%)	25	2297660:2297673	2324960:2324973
2297660:2297673	attL	TGGAGATTTATACT	NA	NA	NA	NA
WP_014183027.1|2307096_2308311_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	30.5	1.4e-41
WP_014184616.1|2308759_2309071_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014184617.1|2309060_2309330_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014184618.1|2309605_2309932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014184619.1|2310020_2311466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014184620.1|2311752_2312313_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014184621.1|2312312_2313719_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_014184622.1|2313924_2314323_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014184623.1|2314306_2316085_+	antirepressor regulating drug resistance protein	NA	NA	NA	NA	NA
WP_148265261.1|2316316_2316628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014184625.1|2316605_2316857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148265353.1|2317291_2318137_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.1	1.6e-36
WP_014184627.1|2318332_2319172_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	37.5	2.9e-43
WP_014184628.1|2319164_2320343_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_148265262.1|2320688_2321282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014183027.1|2321440_2322655_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	30.5	1.4e-41
WP_014184630.1|2323090_2323558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014184631.1|2323886_2324276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042332153.1|2324510_2325320_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
2324960:2324973	attR	TGGAGATTTATACT	NA	NA	NA	NA
WP_014184634.1|2325562_2325928_-	hypothetical protein	NA	A0A0H3UZC1	Geobacillus_virus	43.7	4.7e-22
WP_014184635.1|2325938_2326142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014184636.1|2326421_2326688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042331083.1|2326726_2327056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158309027.1|2327299_2327770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014183027.1|2327944_2329159_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	30.5	1.4e-41
>prophage 5
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	2343631	2361006	5863081	integrase,transposase	Bacillus_phage(25.0%)	17	2352723:2352737	2361102:2361116
WP_014183027.1|2343631_2344846_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	30.5	1.4e-41
WP_158309028.1|2345237_2345375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014184659.1|2345400_2345634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014184660.1|2346082_2346679_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_014184661.1|2347078_2347417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014184662.1|2347736_2348195_+	effector binding domain-containing protein	NA	NA	NA	NA	NA
WP_081468490.1|2348416_2349184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081468491.1|2349183_2349672_-|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	33.3	1.1e-10
WP_014184663.1|2349786_2350239_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_148265264.1|2350502_2350883_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2352723:2352737	attL	GACGTTATCGGAAAT	NA	NA	NA	NA
WP_014183190.1|2353964_2355476_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014183191.1|2355468_2356209_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	40.9	1.2e-40
WP_042331084.1|2356252_2356630_+	C-GCAxxG-C-C family protein	NA	NA	NA	NA	NA
WP_014184667.1|2359644_2359833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042331087.1|2360368_2360635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081468492.1|2360574_2360802_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_081468493.1|2360805_2361006_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	54.2	8.2e-05
2361102:2361116	attR	GACGTTATCGGAAAT	NA	NA	NA	NA
>prophage 6
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	3884745	3910605	5863081	bacteriocin,protease	Bacillus_phage(75.0%)	20	NA	NA
WP_042332485.1|3884745_3886866_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	23.7	4.3e-19
WP_014186048.1|3886934_3889085_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	F2Y165	Organic_Lake_phycodnavirus	26.9	6.1e-13
WP_014186049.1|3889156_3890047_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014186050.1|3890881_3893611_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	25.5	2.6e-32
WP_014186051.1|3893751_3895944_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	27.7	1.8e-28
WP_014186052.1|3895961_3896933_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
WP_014186053.1|3896946_3898074_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014186054.1|3898291_3899683_+	nif11-like peptide radical SAM maturase	NA	NA	NA	NA	NA
WP_014186055.1|3899745_3899988_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_014186056.1|3900073_3900316_-	Nif11-like leader peptide family natural product precursor	NA	NA	NA	NA	NA
WP_014186057.1|3900636_3901446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014186058.1|3901458_3902727_-	nitrate/TMAO reductase membrane-bound tetraheme cytochrome C subunit	NA	NA	NA	NA	NA
WP_014186059.1|3903050_3904445_-	MFS transporter	NA	NA	NA	NA	NA
WP_014186060.1|3904512_3905712_-	MFS transporter	NA	NA	NA	NA	NA
WP_014186061.1|3905790_3906318_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014186062.1|3906420_3907449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014186063.1|3907441_3907834_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014186064.1|3908028_3908631_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014186065.1|3908646_3909804_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_014186066.1|3910038_3910605_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 7
NC_016584	Desulfosporosinus orientis DSM 765, complete sequence	5863081	5591901	5640261	5863081	tail,plate,portal,holin,tRNA	Clostridium_phage(30.0%)	55	NA	NA
WP_014187543.1|5591901_5592666_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.8	2.0e-19
WP_014187544.1|5592639_5593203_-	DUF5317 domain-containing protein	NA	NA	NA	NA	NA
WP_014187545.1|5593193_5594498_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_014187546.1|5594831_5595482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014187547.1|5596100_5596601_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_014187548.1|5596609_5598229_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_148265417.1|5598274_5600047_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_014187550.1|5600145_5600532_-	DUF1987 domain-containing protein	NA	NA	NA	NA	NA
WP_014187551.1|5600546_5601095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014187552.1|5601277_5602024_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	51.2	1.7e-23
WP_014187553.1|5602150_5602903_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.1	1.8e-60
WP_042331697.1|5603244_5604003_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_014187555.1|5604004_5604412_-|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	41.5	1.4e-19
WP_014187556.1|5605011_5605146_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014187557.1|5605147_5605462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014187558.1|5605475_5606906_-	hypothetical protein	NA	S6B1J7	Thermus_phage	36.8	3.7e-38
WP_014187559.1|5606905_5607445_-	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	36.6	2.2e-20
WP_014187560.1|5607441_5608518_-|plate	baseplate J/gp47 family protein	plate	H7BWD5	unidentified_phage	52.2	1.3e-101
WP_014187561.1|5608518_5608920_-	DUF2634 domain-containing protein	NA	S5MTX3	Brevibacillus_phage	48.5	3.4e-26
WP_014187562.1|5608916_5609273_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	54.3	4.0e-26
WP_014187563.1|5609273_5610248_-	hypothetical protein	NA	S5MA66	Brevibacillus_phage	52.8	3.5e-101
WP_014187564.1|5610263_5610920_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	49.5	4.0e-56
WP_014187565.1|5610919_5612725_-	hypothetical protein	NA	S5MNW9	Brevibacillus_phage	35.8	1.6e-86
WP_014187566.1|5612893_5613055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014187567.1|5613066_5613489_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	48.6	1.7e-28
WP_014187568.1|5613720_5614188_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	59.2	3.5e-46
WP_014187569.1|5614191_5615508_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	52.9	1.6e-128
WP_014187570.1|5615509_5615692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014187571.1|5615684_5616104_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	40.9	4.1e-22
WP_052304344.1|5616526_5617024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014187573.1|5617308_5617713_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	31.2	9.1e-11
WP_014187574.1|5617751_5618177_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	39.7	4.8e-18
WP_014187575.1|5618186_5619824_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014187576.1|5619988_5620513_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_014187577.1|5620682_5621906_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_014187578.1|5621944_5622706_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014187579.1|5623095_5624454_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_014187580.1|5624571_5625924_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_014187581.1|5625974_5627363_+	cytosine permease	NA	NA	NA	NA	NA
WP_014187582.1|5627655_5628420_-	response regulator	NA	NA	NA	NA	NA
WP_042332802.1|5628419_5629616_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.5	8.7e-25
WP_014187584.1|5629873_5630164_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_014187585.1|5630189_5630831_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_042332803.1|5630833_5632318_-	acetaldehyde dehydrogenase (acetylating)	NA	A0A1X9I5D4	Streptococcus_phage	22.3	2.5e-05
WP_014187587.1|5632322_5632955_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014187588.1|5632988_5633654_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_014187590.1|5634438_5634987_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014187591.1|5634979_5636317_-	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_014187592.1|5636337_5636598_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_014187593.1|5636594_5636906_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_014187594.1|5636925_5637768_-	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_014187595.1|5637755_5638424_-	ethanolamine utilization cobalamin adenosyltransferase	NA	NA	NA	NA	NA
WP_014187596.1|5638465_5638900_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_014187597.1|5638896_5639250_-	ethanolamine utilization microcompartment protein EutS	NA	NA	NA	NA	NA
WP_042331704.1|5639277_5640261_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
