The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	535387	545834	4855529	integrase,transposase	RD114_retrovirus(20.0%)	10	531308:531343	550371:550406
531308:531343	attL	TTTAAGTGGAACCAACACATTTGATGTATTGAAATA	NA	NA	NA	NA
WP_041285143.1|535387_536647_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	E0D6V1	RD114_retrovirus	32.5	1.6e-08
WP_015617907.1|536639_537440_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_083939749.1|537447_537684_+	DUF5348 domain-containing protein	NA	NA	NA	NA	NA
WP_006524054.1|538827_538998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524053.1|539074_539830_+	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	31.4	2.2e-18
WP_006524052.1|540009_540891_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	34.3	1.1e-37
WP_006524051.1|540883_542011_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_006521022.1|542552_543770_-|transposase	IS256-like element ISDgi1 family transposase	transposase	A0A218MNI5	uncultured_virus	52.3	2.8e-55
WP_006524050.1|543859_544873_-|integrase	site-specific integrase	integrase	A0A1D6X8B0	Bacillus_phage	22.8	1.8e-10
WP_006524049.1|544859_545834_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
550371:550406	attR	TTTAAGTGGAACCAACACATTTGATGTATTGAAATA	NA	NA	NA	NA
>prophage 2
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	1043134	1094160	4855529	protease,coat,transposase	Hokovirus(21.43%)	48	NA	NA
WP_006521214.1|1043134_1045864_+	pyruvate, phosphate dikinase	NA	A0A1V0SGR7	Hokovirus	33.3	1.6e-34
WP_015617918.1|1046360_1046789_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	44.0	4.6e-29
WP_015617919.1|1046775_1048089_+|transposase	transposase	transposase	S4VZ68	Pandoravirus	23.8	2.9e-05
WP_157872726.1|1048425_1048644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083939764.1|1048667_1049027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041284775.1|1049031_1049253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041284776.1|1049550_1049796_+	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	50.6	3.2e-19
WP_006521219.1|1049797_1050184_+|protease	aspartyl protease family protein	protease	A0A0A8WIU2	Clostridium_phage	51.6	4.6e-28
WP_157872879.1|1050559_1051723_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.7	3.7e-20
WP_006521221.1|1052579_1053335_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157872727.1|1053492_1053657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521224.1|1054586_1055441_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006521225.1|1055522_1056890_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_006521226.1|1057624_1060786_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	35.1	3.2e-183
WP_006521227.1|1060797_1061586_+	DUF72 domain-containing protein	NA	A0A2K9L3D5	Tupanvirus	25.3	7.0e-07
WP_041284778.1|1061603_1062167_+	uracil-DNA glycosylase	NA	A0A127AW33	Bacillus_phage	33.3	1.3e-15
WP_157872880.1|1062743_1063025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521229.1|1063106_1063991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521230.1|1064267_1065443_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_006521233.1|1066484_1066664_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041285218.1|1066656_1067349_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	2.2e-36
WP_006521235.1|1067352_1068276_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.1	2.4e-22
WP_006521236.1|1068402_1069326_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	2.3e-41
WP_041284780.1|1069309_1070113_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006521238.1|1070128_1070953_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_169406849.1|1070973_1071411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521240.1|1071426_1071690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041284781.1|1071880_1072339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157872728.1|1072338_1072584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521243.1|1072996_1073248_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006521244.1|1073249_1073663_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_006521245.1|1073835_1074117_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006521246.1|1074113_1074290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521247.1|1074859_1075831_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_006521248.1|1075823_1076507_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_157872881.1|1078112_1078196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521252.1|1079012_1079837_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_157872729.1|1079929_1080607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521254.1|1080622_1081597_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_006521256.1|1081878_1082244_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006521257.1|1082375_1083893_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_006521260.1|1085094_1085964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521261.1|1086023_1086593_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_006521262.1|1086928_1087912_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_041284783.1|1087937_1088342_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_006521264.1|1088390_1091096_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	8.8e-41
WP_006521265.1|1091198_1093844_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	33.4	4.5e-42
WP_006521266.1|1093962_1094160_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	2532402	2543603	4855529		Prochlorococcus_phage(37.5%)	11	NA	NA
WP_006521630.1|2532402_2533944_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.0e-65
WP_006521631.1|2534169_2534781_-	phosphoribosylglycinamide formyltransferase	NA	Q58MV3	Prochlorococcus_phage	32.2	2.4e-18
WP_041285419.1|2534822_2535890_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.6	8.1e-75
WP_041285420.1|2535916_2537332_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.6e-57
WP_006521634.1|2537390_2538095_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	38.7	5.8e-37
WP_006521635.1|2538249_2539545_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	1.9e-17
WP_006521636.1|2539541_2540075_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.6	9.8e-21
WP_006521637.1|2540750_2540966_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006521638.1|2540985_2541186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521639.1|2541182_2541932_+	Fic family protein	NA	NA	NA	NA	NA
WP_006521640.1|2542061_2543603_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	1.7e-20
>prophage 4
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	3472461	3500191	4855529	integrase,transposase	Erysipelothrix_phage(28.57%)	30	3485151:3485171	3503197:3503217
WP_157872713.1|3472461_3473862_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006524602.1|3473749_3474352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006524603.1|3474338_3474692_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006524604.1|3475555_3476503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157872802.1|3476523_3476736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157872803.1|3476734_3477451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041284949.1|3477460_3477652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006524607.1|3478239_3478812_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	33.7	1.3e-10
WP_006524608.1|3478990_3479614_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006524609.1|3479626_3480361_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	8.5e-23
WP_006524610.1|3480353_3481511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524611.1|3481507_3481942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157872962.1|3482165_3482333_-	hypothetical protein	NA	A0A2K5B251	Erysipelothrix_phage	57.8	1.3e-08
WP_006524612.1|3482404_3482722_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_041284950.1|3482705_3482993_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_006524614.1|3483393_3483996_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041285625.1|3484336_3485098_-|transposase	transposase	transposase	NA	NA	NA	NA
3485151:3485171	attL	AGAACCGTCCCCTGTTCTGCC	NA	NA	NA	NA
WP_015617995.1|3485473_3485860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083940038.1|3486622_3488143_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	28.6	1.7e-09
WP_006524340.1|3488534_3488855_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006524339.1|3488860_3489472_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_006524338.1|3489476_3490703_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_006520307.1|3490911_3492129_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	52.8	1.3e-55
WP_006524337.1|3492630_3493995_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	35.6	7.0e-71
WP_006524336.1|3494367_3495066_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_041285626.1|3495225_3496410_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_006524334.1|3496513_3496807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157872964.1|3497035_3497659_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_006524332.1|3498188_3499334_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_006524331.1|3499330_3500191_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.9	9.3e-29
3503197:3503217	attR	AGAACCGTCCCCTGTTCTGCC	NA	NA	NA	NA
>prophage 5
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	4461467	4560757	4855529	integrase,terminase,protease,capsid,tail,holin,portal,transposase,head	uncultured_Caudovirales_phage(13.64%)	96	4523939:4523998	4562180:4562241
WP_006521334.1|4461467_4462346_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	29.2	2.6e-26
WP_006521333.1|4462408_4463341_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.4	1.6e-26
WP_083939990.1|4463599_4463749_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_006521332.1|4463859_4464045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083939991.1|4464337_4464634_+	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	48.3	3.3e-10
WP_006521331.1|4464704_4465562_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	24.6	1.4e-13
WP_006521330.1|4465577_4466336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521329.1|4466412_4467399_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	30.4	7.7e-19
WP_006521328.1|4467521_4470317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041285023.1|4471022_4471223_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.0	6.9e-12
WP_041285024.1|4471242_4473015_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_006521325.1|4473007_4473463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521324.1|4473455_4474466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006521323.1|4474819_4475086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521322.1|4475311_4475857_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006521321.1|4475972_4476248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521320.1|4476301_4477498_+	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	63.6	7.1e-144
WP_015618021.1|4477503_4477872_+	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	48.9	1.5e-23
WP_006521319.1|4477793_4479494_+	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	50.0	1.8e-132
WP_006521318.1|4479515_4479968_+	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	41.0	7.3e-25
WP_041285769.1|4479972_4481664_+	DNA polymerase	NA	A0A2H4J041	uncultured_Caudovirales_phage	53.4	5.3e-185
WP_083940043.1|4481663_4482314_+	hypothetical protein	NA	A0A1S5S8E1	Streptococcus_phage	66.7	3.6e-33
WP_006521315.1|4482601_4484512_+	primase	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	50.1	1.4e-181
WP_006521314.1|4484712_4485057_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	47.7	6.5e-26
WP_006521313.1|4485046_4485271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006521311.1|4485800_4486007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015618022.1|4486283_4486667_+	HNH endonuclease	NA	A0A1X9I6D0	Streptococcus_phage	42.5	1.3e-22
WP_006521309.1|4486709_4486982_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_006521308.1|4486968_4487244_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_006521307.1|4487504_4488899_+	DNA modification methylase	NA	D0R0C5	Streptococcus_phage	32.6	5.7e-52
WP_015618023.1|4488902_4490126_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	57.5	5.0e-137
WP_006524197.1|4490194_4490959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524198.1|4490959_4491148_+	hypothetical protein	NA	A0A127AWS3	Bacillus_phage	52.5	1.7e-07
WP_006524199.1|4491286_4492195_+	amidoligase family protein	NA	A0A1B1IUD7	uncultured_Mediterranean_phage	46.5	5.0e-65
WP_006524200.1|4492255_4492594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524788.1|4493439_4493913_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXI5	Streptococcus_phage	69.9	2.6e-57
WP_041285027.1|4493935_4495498_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	63.6	1.9e-197
WP_006524757.1|4495567_4495879_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_006524758.1|4495868_4496198_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_083940044.1|4496279_4497509_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	61.8	3.9e-145
WP_006524760.1|4497501_4498215_+|protease	Clp protease ClpP	protease	E4ZFM4	Streptococcus_phage	53.4	3.3e-64
WP_006524762.1|4499865_4501686_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.9	1.9e-31
WP_169406868.1|4501704_4502046_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	71.7	6.7e-31
WP_006524210.1|4502056_4502743_+	FIVAR domain-containing protein	NA	A0A2K5B289	Erysipelothrix_phage	45.1	1.8e-06
WP_006524211.1|4502764_4503067_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_006524212.1|4503066_4503399_+|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	51.9	2.9e-23
WP_006524213.1|4503391_4503763_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	34.5	4.4e-12
WP_006524214.1|4503759_4504086_+	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	36.9	1.7e-15
WP_006524521.1|4504086_4504653_+|tail	tail protein	tail	E2ELJ1	Clostridium_phage	47.0	1.8e-33
WP_006524520.1|4504657_4504957_+	hypothetical protein	NA	A0A2H4JBA8	uncultured_Caudovirales_phage	29.7	7.0e-08
WP_006524519.1|4504968_4505124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524518.1|4505208_4505475_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_006524517.1|4505461_4505782_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_006524516.1|4505832_4509261_+|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	49.9	1.2e-98
WP_006524515.1|4509271_4510123_+|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	48.4	2.8e-70
WP_006524514.1|4510137_4511208_+	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	59.7	1.7e-64
WP_006524513.1|4511209_4512007_+	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	45.1	7.1e-15
WP_006524512.1|4511999_4513862_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_006524511.1|4513876_4514155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524510.1|4514154_4514295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524509.1|4514368_4515079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524508.1|4515105_4516203_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	42.3	1.3e-83
WP_006524507.1|4516250_4516661_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	56.5	3.4e-37
WP_006524506.1|4516653_4517340_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	40.3	2.3e-30
WP_006524505.1|4517471_4518329_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	23.2	1.8e-11
WP_006524504.1|4518343_4519129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524503.1|4519200_4519467_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_006524231.1|4519479_4519719_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_157872838.1|4519846_4522528_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
4523939:4523998	attL	TGCTCGGGTCGGAAGCTGGACGGGGCTCAAAAAGCCCCATCCAGTTCCTCCCAAAAGGGG	NA	NA	NA	NA
WP_157872839.1|4524086_4524332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083939992.1|4525227_4526037_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_006524500.1|4526026_4526908_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_006524499.1|4527763_4528789_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_041285030.1|4528843_4529284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524497.1|4529321_4530362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524496.1|4530693_4531188_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006524493.1|4532292_4533261_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	29.7	9.8e-19
WP_006524492.1|4533974_4534424_+	S-layer protein	NA	NA	NA	NA	NA
WP_006524491.1|4534552_4534708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006524490.1|4534912_4537213_+	peptidase C11	NA	NA	NA	NA	NA
WP_006524489.1|4537480_4538908_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	A0A1P8BL30	Lactococcus_phage	50.0	1.1e-07
WP_006524487.1|4539648_4541166_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015618025.1|4541237_4544585_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	38.4	5.4e-40
WP_006524485.1|4544686_4545418_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_006524484.1|4545646_4546531_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006524482.1|4547579_4548167_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_006524481.1|4548725_4549019_-	virulence factor	NA	NA	NA	NA	NA
WP_006524480.1|4549484_4549853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157872840.1|4549889_4550897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006520600.1|4551095_4551407_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_006520599.1|4551400_4551760_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	47.1	1.2e-19
WP_041285577.1|4551826_4553392_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.6	3.3e-72
WP_006524246.1|4554473_4554899_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_157872841.1|4555440_4555641_-	DUF5348 domain-containing protein	NA	NA	NA	NA	NA
WP_157872842.1|4557209_4557725_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_006524239.1|4559179_4560757_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
4562180:4562241	attR	CCCCTTTTGGGAGGAACTGGATGGGGCTTTTTGAGCCCCGTCCAGCTTCCGACCCGAGCATC	NA	NA	NA	NA
>prophage 6
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	4571593	4598529	4855529	integrase,protease,terminase,capsid,tail,holin,portal,head	Erysipelothrix_phage(20.83%)	32	4567841:4567854	4573534:4573547
4567841:4567854	attL	CGGTAATGTAGTCA	NA	NA	NA	NA
WP_006524228.1|4571593_4572451_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	24.6	7.1e-13
WP_041285790.1|4572600_4573254_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L6BY22	Clostridium_phage	48.1	1.5e-31
WP_006524226.1|4573240_4573663_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	59.3	8.3e-39
4573534:4573547	attR	CGGTAATGTAGTCA	NA	NA	NA	NA
WP_006524225.1|4573710_4574808_-	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	41.3	1.3e-80
WP_006524224.1|4574831_4574972_-	hypothetical protein	NA	S6B9W8	Thermus_phage	61.4	1.2e-05
WP_006524223.1|4574971_4575250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006524222.1|4575264_4577127_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_006524221.1|4577119_4577917_-	hypothetical protein	NA	E5DV66	Deep-sea_thermophilic_phage	47.1	1.9e-15
WP_006524220.1|4577918_4578995_-	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	59.2	7.5e-60
WP_006524219.1|4579009_4579861_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	46.4	2.1e-65
WP_006524218.1|4579872_4583292_-|tail	phage tail tape measure protein	tail	A0A2I7SBZ5	Paenibacillus_phage	34.5	1.3e-57
WP_006524217.1|4583329_4583485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006524216.1|4583496_4583790_-	hypothetical protein	NA	H0USX2	Bacillus_phage	32.6	8.1e-09
WP_006524215.1|4583793_4584600_-	FIVAR domain-containing protein	NA	E2ELJ1	Clostridium_phage	44.9	2.0e-33
WP_006524214.1|4584600_4584927_-	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	36.9	1.7e-15
WP_006524213.1|4584923_4585295_-	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	34.5	4.4e-12
WP_015618030.1|4585287_4585620_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	52.8	2.0e-24
WP_015618031.1|4585619_4585922_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_006524210.1|4585943_4586630_-	FIVAR domain-containing protein	NA	A0A2K5B289	Erysipelothrix_phage	45.1	1.8e-06
WP_006524209.1|4586640_4587825_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	70.0	3.8e-150
WP_006524208.1|4587831_4588530_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	54.5	1.9e-64
WP_052544049.1|4588522_4589758_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	62.3	1.3e-148
WP_006524206.1|4589827_4590154_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006524205.1|4590143_4590455_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_041285033.1|4590524_4592087_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	64.1	3.1e-200
WP_006524203.1|4592109_4592583_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXI5	Streptococcus_phage	69.9	2.6e-57
WP_006524791.1|4593439_4593778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006524792.1|4593838_4594747_-	amidoligase family protein	NA	A0A1B1IUD7	uncultured_Mediterranean_phage	46.5	1.7e-65
WP_006524198.1|4594885_4595074_-	hypothetical protein	NA	A0A127AWS3	Bacillus_phage	52.5	1.7e-07
WP_006524793.1|4595074_4595839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015618032.1|4595907_4597131_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	57.2	2.1e-135
WP_006524195.1|4597134_4598529_-	DNA modification methylase	NA	D0R0C5	Streptococcus_phage	33.0	4.7e-54
>prophage 7
NC_021184	Desulfallas gibsoniae DSM 7213, complete sequence	4855529	4602183	4615015	4855529		Erysipelothrix_phage(54.55%)	13	NA	NA
WP_006524189.1|4602183_4603536_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	71.0	1.2e-160
WP_006524188.1|4603516_4603798_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	63.3	3.8e-24
WP_006524187.1|4603950_4606197_-	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	49.3	3.8e-207
WP_006524186.1|4606224_4606872_-	antA/AntB antirepressor family protein	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	51.5	1.7e-27
WP_006524185.1|4606859_4607267_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	53.3	2.6e-37
WP_006524184.1|4607212_4607470_-	hypothetical protein	NA	A0A2K5B269	Erysipelothrix_phage	59.4	2.4e-17
WP_006524183.1|4607721_4610022_-	hypothetical protein	NA	A0A2K5B2B0	Erysipelothrix_phage	56.5	1.9e-246
WP_006524182.1|4610080_4610638_-	DUF2815 family protein	NA	E4ZFK3	Streptococcus_phage	75.4	6.1e-74
WP_006524181.1|4610651_4611773_-	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	56.6	1.5e-119
WP_041285797.1|4611765_4612077_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	42.6	7.5e-13
WP_006524179.1|4612060_4612222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006524178.1|4612349_4612847_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006524177.1|4613152_4615015_-	helix-turn-helix transcriptional regulator	NA	E4ZFJ9	Streptococcus_phage	30.0	1.2e-73
