The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	260625	285405	4225490	protease,transposase,tRNA,tail	Synechococcus_phage(14.29%)	22	NA	NA
WP_015446520.1|260625_261126_+|tail	phage tail protein	tail	F5B3N6	Synechococcus_phage	51.9	3.8e-06
WP_015446521.1|261140_261671_+|tail	phage tail protein	tail	A0A2R3ZX78	Enterobacter_phage	46.6	1.5e-08
WP_007508865.1|261702_262236_+|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	30.1	4.9e-12
WP_157769786.1|262313_262790_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007508868.1|262782_263076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007508871.1|263253_265131_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.1	1.3e-38
WP_007508873.1|265298_265739_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015446523.1|265843_266737_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_015446524.1|266789_267536_-	pteridine reductase	NA	NA	NA	NA	NA
WP_015446525.1|267606_268221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015446526.1|268405_270592_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015446527.1|270734_271928_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_007508886.1|271936_272347_+	VanZ family protein	NA	NA	NA	NA	NA
WP_027489626.1|272323_274549_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_007508890.1|274593_275841_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.9	1.2e-74
WP_041676645.1|276838_280303_+	sugar-binding protein	NA	NA	NA	NA	NA
WP_157769689.1|280400_281276_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_007508893.1|281359_281680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155950937.1|281726_281972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051061193.1|282289_282652_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_015446532.1|282671_284207_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	5.4e-88
WP_015446533.1|284247_285405_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	32.0	2.1e-52
>prophage 2
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	521152	560846	4225490	plate,protease,tail,tRNA	Bacillus_phage(50.0%)	43	NA	NA
WP_015446701.1|521152_521716_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_007511662.1|521762_522137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446702.1|522139_522661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007511659.1|522691_523414_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_007511657.1|523437_523692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015446703.1|523894_524806_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_015446704.1|525066_525525_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_007511652.1|525590_525779_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_015446705.1|525782_526436_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	31.3	2.3e-19
WP_041676848.1|526540_526927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446707.1|526931_527714_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_007511648.1|527725_529120_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_015446708.1|529138_530506_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_007514701.1|530537_531116_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_007514703.1|531258_531924_-	TonB family protein	NA	NA	NA	NA	NA
WP_007514705.1|532447_533113_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_007514707.1|533109_533442_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_015446709.1|533445_535218_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_015446710.1|535289_535772_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_015446711.1|535943_536720_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_027485314.1|537236_538214_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_041676658.1|538429_538666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446714.1|538702_540304_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	33.0	5.3e-54
WP_007514723.1|540314_540842_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_015446715.1|540847_541582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446716.1|541578_542325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446717.1|542321_543566_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_015446718.1|543562_545710_+	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	31.2	2.0e-08
WP_015446719.1|545706_545994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446720.1|545995_546817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446721.1|546809_547724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446722.1|547733_548282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446723.1|548446_550126_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_015446724.1|550139_550919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446725.1|550915_551692_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_007512630.1|551688_552345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446726.1|552344_552665_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015446727.1|552657_553794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446728.1|553804_554311_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_015446729.1|554322_554646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015446730.1|554656_555016_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_015446731.1|555012_557736_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_015446732.1|557732_560846_+|plate	putative baseplate assembly protein	plate	J9PV89	Bacillus_phage	26.7	1.5e-15
>prophage 3
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	623249	634087	4225490		Escherichia_phage(37.5%)	9	NA	NA
WP_015446786.1|623249_625796_-	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.6e-39
WP_015446787.1|625924_627337_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	7.3e-55
WP_015446788.1|627341_628277_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.8	1.3e-23
WP_015446789.1|628273_628831_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.7	6.4e-47
WP_015446790.1|628827_629718_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.3	4.8e-97
WP_041676849.1|629714_630764_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.6	5.7e-81
WP_015446792.1|630959_632126_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_041676662.1|632176_632980_+	FkbM family methyltransferase	NA	A0A222Z098	Streptomyces_phage	35.1	7.6e-09
WP_015446794.1|633010_634087_+	NAD-dependent epimerase/dehydratase family protein	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	25.5	9.9e-20
>prophage 4
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	1617441	1626742	4225490		Bacillus_virus(14.29%)	10	NA	NA
WP_015447423.1|1617441_1620015_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.4	1.3e-113
WP_015447424.1|1620113_1620338_-	helix-turn-helix domain-containing protein	NA	S5M643	Brevibacillus_phage	48.1	9.2e-05
WP_015447425.1|1620341_1620773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007513250.1|1620918_1621401_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	46.7	2.0e-20
WP_015447426.1|1621541_1622000_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_007513253.1|1622096_1622990_+	DnaJ domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	64.2	4.4e-13
WP_007513255.1|1623060_1623426_-	twitching motility response regulator PilH	NA	W8CYM9	Bacillus_phage	31.6	5.3e-10
WP_015447427.1|1623494_1624493_-	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_015447428.1|1624515_1625112_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	25.4	9.0e-07
WP_015447429.1|1625317_1626742_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.0	4.2e-42
>prophage 6
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	2083465	2091574	4225490		Vibrio_phage(25.0%)	13	NA	NA
WP_015447778.1|2083465_2083987_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	60.0	8.1e-36
WP_157769720.1|2084153_2084363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015447780.1|2084346_2085885_+	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.5	5.5e-48
WP_015447781.1|2085878_2086796_+	recombination-associated protein RdgC	NA	A0A2I7RNT5	Vibrio_phage	35.5	8.3e-44
WP_015447782.1|2086819_2087233_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	45.6	6.7e-17
WP_157769721.1|2087337_2087730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157769722.1|2087726_2088329_+	hypothetical protein	NA	Q71T85	Escherichia_phage	37.9	2.3e-10
WP_041676731.1|2088325_2088754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015447786.1|2088750_2089734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015447787.1|2089769_2090411_+	hypothetical protein	NA	I6R980	Salmonella_phage	29.7	3.7e-06
WP_015447788.1|2090407_2090890_+	DUF1643 domain-containing protein	NA	D4FUM9	Pseudomonas_phage	53.1	6.3e-43
WP_015447789.1|2090991_2091363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015447790.1|2091409_2091574_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	59.6	1.1e-10
>prophage 7
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	2177009	2241848	4225490	integrase,transposase	Salmonella_phage(28.57%)	57	2183941:2183972	2243020:2243051
WP_157769734.1|2177009_2178119_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015447876.1|2178315_2178816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015447877.1|2178817_2178994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015447878.1|2178990_2179224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015447879.1|2179255_2180002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015447880.1|2179988_2180351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041676756.1|2180638_2182315_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015447882.1|2182304_2182991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157769735.1|2183179_2183410_+	hypothetical protein	NA	NA	NA	NA	NA
2183941:2183972	attL	GGCTAATTTTGCCCAACCCCCAAAAATGTAAA	NA	NA	NA	NA
WP_015447883.1|2183973_2187078_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.6	2.2e-48
WP_015447884.1|2187356_2188376_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	45.7	1.6e-72
WP_015447885.1|2188372_2190088_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_015447886.1|2190187_2191603_+	TolC family protein	NA	NA	NA	NA	NA
WP_015447887.1|2191599_2192652_+	multidrug transporter	NA	NA	NA	NA	NA
WP_015447888.1|2192648_2195783_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.0	4.5e-73
WP_041677002.1|2195791_2196469_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015447890.1|2196458_2197703_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_015447891.1|2197787_2198969_+	MFS transporter	NA	NA	NA	NA	NA
WP_015447892.1|2199058_2199460_+	GtrA family protein	NA	NA	NA	NA	NA
WP_015447893.1|2199550_2200714_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_015447894.1|2200808_2202452_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_015447895.1|2202509_2202734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015447896.1|2202783_2205867_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.4	7.6e-57
WP_157769805.1|2207089_2208694_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015447899.1|2208771_2209803_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_015447900.1|2209832_2210363_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_015447901.1|2210595_2211009_-	universal stress protein	NA	NA	NA	NA	NA
WP_015447902.1|2211102_2212632_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_015447903.1|2212913_2213381_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015447904.1|2213546_2214677_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015447905.1|2214673_2217409_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	9.2e-22
WP_081602816.1|2217405_2218242_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_081602817.1|2218229_2219288_+	FUSC family protein	NA	NA	NA	NA	NA
WP_015447907.1|2219293_2219503_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_037090337.1|2219532_2220462_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015447909.1|2220458_2221814_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_008209282.1|2221945_2224879_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_008209284.1|2224918_2225554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008209286.1|2225634_2226042_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_153021737.1|2226107_2226701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015447712.1|2226812_2227034_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_015447711.1|2227250_2227535_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_015447710.1|2227546_2228419_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_015447709.1|2228393_2229143_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_015447708.1|2229228_2229591_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_015447707.1|2229610_2229889_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_015447706.1|2229908_2230316_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_015447910.1|2230615_2232340_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.4	1.4e-39
WP_008214502.1|2232356_2232722_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_008214504.1|2232718_2232937_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_008214506.1|2233024_2233402_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_041677010.1|2233436_2234768_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.0	4.0e-39
WP_015447702.1|2236006_2237143_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_015447701.1|2237252_2238191_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_157769711.1|2239397_2240504_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015447913.1|2240547_2240688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015447914.1|2240684_2241848_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2243020:2243051	attR	TTTACATTTTTGGGGGTTGGGCAAAATTAGCC	NA	NA	NA	NA
>prophage 8
NC_020541	Rhodanobacter denitrificans, complete sequence	4225490	2958576	2995381	4225490	protease,head,transposase,tail	Pseudomonas_phage(63.33%)	57	NA	NA
WP_015448355.1|2958576_2958933_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.8	1.2e-11
WP_157769751.1|2959025_2959310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041676786.1|2959345_2959759_+	hypothetical protein	NA	I6P8D5	Pseudomonas_phage	47.7	1.0e-25
WP_015448358.1|2959758_2961711_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A1B0T6H2	Thiobacimonas_phage	39.4	4.0e-112
WP_015448359.1|2961784_2962750_+	AAA family ATPase	NA	A0A2P9JZG8	Alteromonadaceae_phage	43.1	2.5e-59
WP_157769752.1|2962746_2963043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448361.1|2963053_2963437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041676788.1|2963429_2963708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448363.1|2963707_2964418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448364.1|2964414_2965032_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	61.0	2.4e-63
WP_041676789.1|2965033_2965477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448365.1|2965473_2965896_+	hypothetical protein	NA	A0A286N3D2	Arthrobacter_phage	42.1	1.9e-14
WP_157769753.1|2965921_2966212_+	hypothetical protein	NA	A0A0F6SJ59	Sinorhizobium_phage	75.6	2.6e-15
WP_015448368.1|2966208_2966418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448369.1|2966414_2966807_+	hypothetical protein	NA	A0A0M4U437	Ralstonia_phage	32.3	4.0e-11
WP_015448370.1|2966806_2967013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448371.1|2966996_2967452_+	regulatory protein GemA	NA	A0A0M3LP80	Mannheimia_phage	30.8	6.2e-08
WP_015448372.1|2967453_2967696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448373.1|2967695_2967956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448374.1|2967948_2968218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448375.1|2968217_2968808_+	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	50.3	2.1e-32
WP_015448376.1|2968804_2969218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448377.1|2969349_2969673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448378.1|2969669_2969864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448379.1|2969860_2970613_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	48.6	2.5e-38
WP_015448380.1|2970609_2971053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051061184.1|2971060_2971267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448381.1|2971263_2971479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448382.1|2971475_2971718_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_015448383.1|2971714_2972008_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_015448384.1|2972004_2972313_+	hypothetical protein	NA	A0A1B0T6F4	Thiobacimonas_phage	38.8	4.8e-12
WP_015448385.1|2972315_2972867_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	51.4	4.6e-29
WP_015448386.1|2972863_2974468_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	58.7	7.5e-157
WP_015448387.1|2974461_2976090_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	59.7	2.8e-175
WP_015448389.1|2976213_2977479_+|head	phage head morphogenesis protein, SPP1 gp7	head	J9STS2	Pseudomonas_phage	59.8	2.1e-82
WP_015448390.1|2977478_2977958_+	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	28.0	2.3e-08
WP_015448391.1|2978185_2979268_+|protease	phage protease	protease	J9SH47	Pseudomonas_phage	55.9	2.7e-94
WP_015448392.1|2979337_2979742_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	58.3	1.4e-30
WP_015448393.1|2979839_2980736_+|head	Mu-like prophage major head subunit gpT family protein	head	J9SVY7	Pseudomonas_phage	50.2	2.8e-84
WP_015448394.1|2980816_2981182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448395.1|2981305_2981566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448396.1|2981568_2982081_+	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	52.1	1.7e-38
WP_051061203.1|2982098_2982545_+	hypothetical protein	NA	J9SH57	Pseudomonas_phage	41.8	7.4e-22
WP_157769754.1|2982541_2982709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448399.1|2982712_2983471_+	hypothetical protein	NA	Q5ZQX2	Pseudomonas_phage	45.7	1.5e-51
WP_015448400.1|2983473_2984007_+	hypothetical protein	NA	Q5ZQX1	Pseudomonas_phage	39.1	1.4e-22
WP_015448402.1|2984132_2984399_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015448403.1|2984437_2987290_+|tail	phage tail length tape measure family protein	tail	J9SH65	Pseudomonas_phage	46.8	2.8e-45
WP_015448404.1|2987291_2988146_+	hypothetical protein	NA	H6WU10	Pseudomonas_phage	40.0	4.4e-55
WP_015448405.1|2988145_2989042_+	hypothetical protein	NA	A0A0M3MXF1	Stenotrophomonas_phage	35.1	2.8e-36
WP_157769755.1|2989051_2990752_+	hypothetical protein	NA	B7SDV7	Pseudomonas_virus	43.6	3.7e-114
WP_015448407.1|2990748_2991540_+	phage BR0599 family protein	NA	I6XM63	Pseudomonas_phage	40.6	3.0e-50
WP_015448408.1|2991549_2991792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448409.1|2991791_2992022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015448410.1|2992014_2994216_+	hypothetical protein	NA	Q5ZQV9	Pseudomonas_phage	41.0	1.3e-138
WP_015448411.1|2994218_2995055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085999895.1|2995087_2995381_+|tail	phage tail protein	tail	NA	NA	NA	NA
