The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015978	Lactobacillus sanfranciscensis TMW 1.1304, complete sequence	1298316	76163	130989	1298316	transposase,protease,integrase	Streptococcus_phage(25.0%)	55	73938:73954	87322:87338
73938:73954	attL	TTTTTTATTTTAAATTT	NA	NA	NA	NA
WP_014081416.1|76163_76325_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_014081418.1|76827_78207_-	amino acid permease	NA	NA	NA	NA	NA
WP_014081419.1|78419_79850_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.9	1.3e-38
WP_049777565.1|79964_81446_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	35.4	5.1e-67
WP_041817497.1|81659_82436_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.6	1.3e-26
WP_014081422.1|82428_82641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041817499.1|82735_84592_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_014081424.1|84807_85047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081425.1|85033_85387_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_014081426.1|85458_87006_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_167534413.1|87121_87268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049777566.1|87337_88177_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
87322:87338	attR	TTTTTTATTTTAAATTT	NA	NA	NA	NA
WP_014081428.1|88296_88605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144011127.1|88625_89018_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_041817501.1|89165_89726_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_041817502.1|90065_90386_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014081432.1|90385_90796_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014081433.1|90800_91205_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014081434.1|91333_91825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081435.1|91837_92302_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	38.6	8.8e-18
WP_014081436.1|92636_93458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081437.1|93518_94517_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	33.7	2.0e-38
WP_014081438.1|94516_95524_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_103434512.1|95611_96121_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014081440.1|96122_96578_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014081441.1|97523_99110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081442.1|99170_100379_-	peptidase T	NA	NA	NA	NA	NA
WP_041817503.1|100390_101239_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014081444.1|101661_102063_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_014081445.1|102155_102608_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049777567.1|102890_103139_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_049777641.1|104327_105629_+	cytosine permease	NA	NA	NA	NA	NA
WP_041817505.1|105859_106414_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_014081448.1|106637_107063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049777569.1|107288_107792_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014081451.1|107827_108193_-	YisL family protein	NA	NA	NA	NA	NA
WP_103434664.1|108260_109184_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014081453.1|109265_109898_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014081454.1|109955_110384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014081455.1|110393_111038_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_041817507.1|111037_112432_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	27.5	2.4e-10
WP_014081457.1|112639_112810_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014081459.1|113260_113659_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_014081481.1|113658_114834_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	2.2e-113
WP_014081461.1|114987_115416_+	MFS transporter	NA	NA	NA	NA	NA
WP_014081462.1|115437_115752_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014081463.1|115817_116930_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	55.7	8.7e-104
WP_014081464.1|117142_117850_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_014081465.1|117836_118163_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_014081467.1|118389_118914_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	36.4	6.9e-19
WP_041817509.1|118999_120178_-	thiolase family protein	NA	NA	NA	NA	NA
WP_014081469.1|120264_120810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081472.1|127742_128798_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.6e-27
WP_014081473.1|128797_129502_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014081475.1|130125_130989_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.4	1.5e-42
>prophage 2
NC_015978	Lactobacillus sanfranciscensis TMW 1.1304, complete sequence	1298316	135052	195990	1298316	transposase,tRNA,integrase	Bacillus_phage(23.81%)	56	167256:167271	183029:183044
WP_014081459.1|135052_135451_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_014081481.1|135450_136626_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	2.2e-113
WP_081462384.1|136742_137045_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_049777571.1|137117_137351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144011128.1|137378_137561_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041817511.1|137591_139706_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_014081483.1|139853_140624_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_081462385.1|140779_141058_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014081484.1|141149_141347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014081485.1|141447_142923_-	amino acid permease	NA	NA	NA	NA	NA
WP_014081486.1|142941_144270_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014081487.1|144406_145570_-	MFS transporter	NA	NA	NA	NA	NA
WP_081462386.1|145556_146591_-	MFS transporter	NA	NA	NA	NA	NA
WP_049777573.1|146707_147580_+	MFS transporter	NA	NA	NA	NA	NA
WP_041817514.1|149258_150611_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_041817516.1|150704_152963_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_041817517.1|153019_154003_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_014081491.1|154005_154677_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_014081492.1|154747_155251_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041817518.1|155250_156105_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	3.6e-41
WP_014081494.1|156171_156534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014081495.1|156839_157427_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	32.4	2.8e-21
WP_041817521.1|157880_159017_+	EpsG family protein	NA	NA	NA	NA	NA
WP_163600789.1|159050_159443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041817518.1|160248_161103_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	3.6e-41
WP_041817523.1|162003_163110_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_049777577.1|163488_164409_+	capsular polysaccharide synthesis protein	NA	NA	NA	NA	NA
WP_049777578.1|164474_165683_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.1e-27
WP_041817525.1|165779_166394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081503.1|166950_167919_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
167256:167271	attL	TTTCTTAAATATTTTA	NA	NA	NA	NA
WP_014081504.1|167923_169372_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_014081505.1|169468_170437_+	glycosyltransferase family 2 protein	NA	K7Z8A5	Megavirus	26.2	2.6e-11
WP_014081507.1|170634_171063_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	42.3	1.3e-20
WP_103434659.1|172334_172490_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	49.0	5.2e-07
WP_014081510.1|172766_174434_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_014081511.1|174452_175844_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_014081512.1|176265_176541_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.8e-08
WP_144011130.1|176675_177371_+	HAD-IA family hydrolase	NA	Q6J1X2	Lactobacillus_phage	36.4	1.3e-09
WP_041817528.1|177513_179067_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	25.9	2.9e-12
WP_041817529.1|179077_180214_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.3	1.5e-47
WP_041817531.1|180443_181631_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014081516.1|182246_182891_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014081517.1|182903_183542_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.0e-24
183029:183044	attR	TTTCTTAAATATTTTA	NA	NA	NA	NA
WP_041817533.1|183538_184372_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014081519.1|184446_184956_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041817535.1|184949_185804_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	1.2e-41
WP_014081521.1|185871_186408_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_049777580.1|186570_187128_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_014081459.1|187250_187649_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_014081523.1|187648_188791_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	5.8e-111
WP_041817537.1|188940_189324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014081524.1|189325_189838_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014081525.1|189978_190821_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	39.4	2.7e-17
WP_014081526.1|190978_192172_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	35.8	1.4e-54
WP_081462390.1|192215_193625_-	cation transporting ATPase C-terminal domain-containing protein	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	34.7	1.8e-13
WP_041817539.1|193722_195990_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	29.6	1.7e-114
>prophage 3
NC_015978	Lactobacillus sanfranciscensis TMW 1.1304, complete sequence	1298316	205404	262230	1298316	transposase,tRNA,integrase	Lactobacillus_phage(17.65%)	52	192411:192427	255590:255606
192411:192427	attL	CATTTTATTAGAAAGAA	NA	NA	NA	NA
WP_014081459.1|205404_205803_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_014081534.1|205802_206978_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	54.7	2.9e-113
WP_041817544.1|207546_210162_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_014081536.1|210200_211085_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014081537.1|211203_212847_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_014081538.1|212927_213920_+	AEC family transporter	NA	NA	NA	NA	NA
WP_081462391.1|213988_214132_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_049777581.1|214073_214379_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	37.0	4.0e-11
WP_144011143.1|215851_218329_+	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_041818032.1|220192_220831_+	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	30.8	3.7e-14
WP_049777583.1|220901_221213_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_049777584.1|221291_221501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049777642.1|221543_223568_+	KUP/HAK/KT family potassium transporter	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	33.3	1.0e-62
WP_014081545.1|223646_224207_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_014081546.1|224218_224548_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014081547.1|224585_225092_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_041817546.1|225211_226792_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_014081549.1|226866_227745_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	1.8e-40
WP_041817547.1|227832_228558_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014081551.1|228744_231138_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_049777585.1|231194_232076_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	2.3e-06
WP_041817549.1|232129_232570_-	universal stress protein	NA	NA	NA	NA	NA
WP_041817551.1|232929_234111_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_014081555.1|234231_234639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081556.1|234651_234975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081557.1|234985_235141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081558.1|235351_235891_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041817552.1|235899_236745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014081560.1|236757_237165_-	helix-turn-helix domain-containing protein	NA	A0A0H4ITV7	Staphylococcus_phage	39.4	1.1e-06
WP_041817553.1|237328_238921_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_041817554.1|238953_240507_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_014081563.1|240740_241139_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014081564.1|241188_242001_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_163600771.1|243501_243660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014081570.1|243834_244314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041817556.1|244683_245646_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014081572.1|245773_246550_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014081573.1|246600_247590_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	28.7	9.1e-20
WP_014081574.1|247635_249774_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.4	4.3e-160
WP_041817557.1|249924_250584_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_103434678.1|250688_251066_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041817559.1|251085_253098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041817561.1|253135_254059_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_049777586.1|254214_254859_+	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.6	3.8e-19
WP_014081579.1|254872_255613_+	membrane protein	NA	A0A068EP98	Bacillus_phage	42.9	2.9e-39
255590:255606	attR	CATTTTATTAGAAAGAA	NA	NA	NA	NA
WP_014081580.1|255615_255951_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	1.1e-17
WP_014081581.1|255943_257326_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_041817562.1|257642_258305_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	37.7	3.2e-13
WP_041817564.1|258561_259398_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	96.8	1.7e-152
WP_014081584.1|259451_259703_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.8	5.1e-36
WP_103434667.1|259816_260425_+	sugar phosphate isomerase	NA	NA	NA	NA	NA
WP_014081587.1|260976_262230_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CYK4	Yersinia_phage	44.1	1.8e-89
>prophage 4
NC_015978	Lactobacillus sanfranciscensis TMW 1.1304, complete sequence	1298316	521711	530037	1298316	transposase,tRNA	Lactococcus_phage(16.67%)	10	NA	NA
WP_041817663.1|521711_524012_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.1	1.3e-90
WP_014081830.1|524026_524500_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	1.2e-41
WP_041817664.1|524606_525110_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041817666.1|525109_525964_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	1.1e-40
WP_014081833.1|526056_526746_+	uracil-DNA glycosylase	NA	A0A060LC41	Elephant_endotheliotropic_herpesvirus	43.2	4.5e-42
WP_014081834.1|526758_527745_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014081835.1|527751_528225_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_014081836.1|528217_528700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041817667.1|528719_529253_-	3'-5' exonuclease	NA	M1PFD8	Streptococcus_phage	40.4	2.0e-26
WP_041817669.1|529266_530037_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	37.9	2.0e-43
>prophage 5
NC_015978	Lactobacillus sanfranciscensis TMW 1.1304, complete sequence	1298316	716482	732501	1298316	tRNA	Bacillus_phage(20.0%)	16	NA	NA
WP_041817762.1|716482_718441_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.1	3.8e-126
WP_041817764.1|718598_719228_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_049777605.1|719262_720147_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_014082014.1|720237_721170_-	tyrosine recombinase XerC	NA	M4W8M4	Mycobacterium_phage	28.9	2.1e-18
WP_041817766.1|721222_723346_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.2	9.8e-96
WP_081462407.1|723434_724070_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.6	3.3e-23
WP_014082016.1|724033_724309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163600775.1|724350_725121_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.8	8.3e-29
WP_014082018.1|725117_725981_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014082019.1|725991_726213_-	YozE family protein	NA	NA	NA	NA	NA
WP_014082020.1|726225_726717_-	dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	33.7	4.5e-20
WP_014082021.1|726729_727680_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.0	1.9e-120
WP_041817768.1|727699_729595_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.6	3.4e-55
WP_041817770.1|729602_730814_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.2	2.2e-44
WP_014082024.1|730898_732161_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014082025.1|732225_732501_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.5	5.8e-25
>prophage 6
NC_015978	Lactobacillus sanfranciscensis TMW 1.1304, complete sequence	1298316	1114816	1166191	1298316	tRNA,transposase,integrase	Lactobacillus_virus(14.29%)	58	1132957:1132995	1166769:1166807
WP_014082395.1|1114816_1116106_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	40.1	1.8e-84
WP_014082396.1|1116364_1117003_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	50.2	1.2e-49
WP_014082397.1|1117084_1118545_-	amino acid permease	NA	NA	NA	NA	NA
WP_014082399.1|1119533_1120310_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_014082400.1|1120584_1120782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014082401.1|1121034_1121700_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_041817933.1|1121821_1122667_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014082403.1|1122666_1123041_+	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_041817666.1|1123112_1123967_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	1.1e-40
WP_041817664.1|1123966_1124470_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014082404.1|1124546_1124915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103423446.1|1127784_1128105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014082407.1|1128208_1130035_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_014082408.1|1130093_1130294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144011138.1|1130409_1130835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014082409.1|1130950_1131580_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_014082410.1|1131595_1132042_-	universal stress protein	NA	NA	NA	NA	NA
WP_081462423.1|1132281_1132449_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
1132957:1132995	attL	TGATGTGAACCCATAAAGTTGGACACATTATTTAGTTTT	NA	NA	NA	NA
WP_144011139.1|1132996_1133512_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B1P773	Bacillus_phage	44.4	1.1e-24
WP_144011140.1|1133571_1133850_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081462424.1|1134163_1135753_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.1e-06
WP_041817936.1|1135924_1136494_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_041818141.1|1136504_1137194_-	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	37.2	5.9e-34
WP_014082414.1|1137312_1137753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014082416.1|1138066_1138864_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_014082417.1|1138929_1139106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041818142.1|1139107_1139794_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041817938.1|1140024_1140228_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	68.8	1.0e-18
WP_041817938.1|1140469_1140673_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	68.8	1.0e-18
WP_014082420.1|1140783_1141323_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014082421.1|1141338_1142091_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_041817939.1|1142093_1142855_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_014082423.1|1142920_1143691_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_014082424.1|1143683_1144520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014082425.1|1144509_1145880_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_041817940.1|1145888_1146299_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_014082427.1|1146300_1146726_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_014082428.1|1146725_1147967_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_041817941.1|1147992_1148730_-	3-oxoacyl-ACP reductase FabG	NA	A0A0M4JSW6	Mollivirus	26.3	4.2e-14
WP_014082430.1|1148729_1149647_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_014082431.1|1149661_1149916_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_041817943.1|1149945_1150920_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_014082433.1|1150922_1151369_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_014082434.1|1151613_1151784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014082435.1|1152045_1152945_+	membrane protein	NA	NA	NA	NA	NA
WP_014082436.1|1152993_1154379_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_014082437.1|1154657_1155920_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.8	3.0e-68
WP_014082438.1|1155973_1156552_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_014082439.1|1156572_1156827_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_041817945.1|1156906_1158022_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_014082441.1|1158072_1158327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014081724.1|1158560_1159736_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	9.8e-114
WP_014081459.1|1159735_1160134_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_041817946.1|1160193_1160781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014082442.1|1160880_1161765_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.2	4.2e-61
WP_014082443.1|1161810_1162989_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_041817947.1|1163063_1165205_-	SH3 domain-containing protein	NA	A7J2B5	Streptococcus_phage	26.2	5.4e-17
WP_144011141.1|1165912_1166191_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1166769:1166807	attR	AAAACTAAATAATGTGTCCAACTTTATGGGTTCACATCA	NA	NA	NA	NA
>prophage 1
NC_015979	Lactobacillus sanfranciscensis TMW 1.1304 plasmid pLS1, complete sequence	58739	9892	18605	58739	transposase	Bacillus_virus(25.0%)	9	NA	NA
WP_014082567.1|9892_10249_+	CrcB family protein	NA	A0A2H4J148	uncultured_Caudovirales_phage	40.7	1.6e-06
WP_041818216.1|11079_11664_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	2.2e-18
WP_014082570.1|12004_12553_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.4	4.5e-29
WP_014082571.1|12554_13994_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	9.2e-98
WP_014082572.1|14109_14814_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	31.1	6.9e-06
WP_014082573.1|15223_16153_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.1	6.7e-25
WP_041818220.1|16256_16673_+	MFS transporter	NA	NA	NA	NA	NA
WP_014082574.1|16825_18160_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	1.0e-29
WP_049777660.1|18230_18605_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.7	7.4e-15
