The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015968	Enterobacter soli, complete sequence	4812833	2146908	2155490	4812833		Escherichia_phage(66.67%)	10	NA	NA
WP_014070141.1|2146908_2147523_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.2	6.2e-27
WP_014070142.1|2147567_2148422_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	33.2	1.2e-23
WP_014069571.1|2148423_2149041_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
WP_014070143.1|2149051_2151490_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	1.4e-215
WP_014070144.1|2151634_2151928_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_080562856.1|2152038_2152749_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_014070146.1|2152770_2153331_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_014070147.1|2153346_2153685_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_041162057.1|2153837_2154164_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	3.2e-22
WP_014070149.1|2154275_2155490_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.0	5.7e-48
>prophage 2
NC_015968	Enterobacter soli, complete sequence	4812833	2863178	2911035	4812833	integrase,head,tail,holin,terminase	Cronobacter_phage(28.85%)	68	2896643:2896658	2916526:2916541
WP_014070777.1|2863178_2863496_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	75.2	3.1e-38
WP_014070778.1|2863495_2863735_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	76.9	2.6e-29
WP_014070779.1|2863939_2865769_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	30.3	1.2e-65
WP_014070780.1|2865803_2867966_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	59.1	9.5e-38
WP_014070781.1|2868024_2870502_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	89.1	0.0e+00
WP_014070782.1|2870488_2870905_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	85.3	2.4e-67
WP_014070783.1|2870867_2871338_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	90.4	6.5e-77
WP_014070784.1|2871337_2871835_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	1.0e-88
WP_014070785.1|2871834_2874168_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	49.2	8.4e-149
WP_014070786.1|2874225_2874600_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.4	7.9e-25
WP_014070787.1|2874672_2875416_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.4	4.4e-59
WP_014070788.1|2875466_2876222_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	51.8	7.1e-57
WP_014070789.1|2876281_2876665_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	55.9	3.2e-37
WP_014070790.1|2876661_2877030_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.9e-45
WP_014070792.1|2877427_2877775_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	60.9	1.6e-32
WP_014070793.1|2877767_2878103_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	66.3	1.0e-31
WP_014070795.1|2878266_2878545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014070796.1|2878544_2878925_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.9	1.5e-31
WP_014070798.1|2879337_2880393_-	DUF2184 domain-containing protein	NA	R9TMI8	Aeromonas_phage	52.9	1.2e-102
WP_014070799.1|2880389_2880851_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	2.2e-29
WP_014070800.1|2880850_2882221_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.1	6.1e-123
WP_014070801.1|2882244_2882589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064555895.1|2882589_2883597_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.5	3.8e-114
WP_014070803.1|2883523_2884993_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.0	9.0e-149
WP_014070804.1|2885005_2886478_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.0e-248
WP_014070805.1|2886477_2886993_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	75.3	1.5e-66
WP_014070806.1|2887022_2887229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014070807.1|2887386_2887605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014070808.1|2887734_2888184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014070809.1|2888649_2888874_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	2.3e-19
WP_041162086.1|2889128_2889650_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	32.1	1.3e-06
WP_088201865.1|2889646_2890090_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	66.4	1.7e-47
WP_014070812.1|2890073_2890415_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	6.3e-29
WP_014070813.1|2891946_2892282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014070814.1|2892504_2893320_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	80.1	2.3e-122
WP_014070816.1|2893431_2894043_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	71.4	1.5e-60
WP_014070817.1|2894035_2894206_-	NinE family protein	NA	G8C7V4	Escherichia_phage	87.3	6.9e-21
WP_014070818.1|2894198_2894654_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	5.6e-33
WP_014070821.1|2895435_2895777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014070822.1|2895779_2896091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014070823.1|2896087_2896384_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	65.2	1.3e-27
WP_014070824.1|2896380_2896956_-	winged helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	42.1	6.9e-12
2896643:2896658	attL	CTCAATACCGACATGA	NA	NA	NA	NA
WP_014070825.1|2896957_2897647_-	replication P family protein	NA	G8C7U6	Escherichia_phage	96.9	1.6e-127
WP_014070826.1|2897643_2898579_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	85.3	1.4e-70
WP_014070827.1|2898764_2899307_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	90.6	3.1e-86
WP_000102594.1|2899324_2899558_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	62.3	2.6e-18
WP_014070828.1|2899599_2900352_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	63.5	4.5e-72
WP_014070829.1|2901421_2901610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014070830.1|2901620_2901779_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	86.5	4.6e-19
WP_000607101.1|2901775_2901985_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	97.1	3.9e-34
WP_014070831.1|2902055_2902451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014070832.1|2902444_2902606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014070833.1|2902583_2903240_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.3	4.6e-20
WP_014070834.1|2903243_2903909_+	hypothetical protein	NA	A0A2D1GLT5	Escherichia_phage	45.2	4.9e-46
WP_014070835.1|2903920_2904634_+	hypothetical protein	NA	A0A2L1IV75	Escherichia_phage	32.3	1.6e-13
WP_014070836.1|2904645_2904798_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_014070837.1|2904794_2906039_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	34.0	1.0e-44
WP_014070838.1|2906050_2906653_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014070839.1|2906649_2907231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014070840.1|2907475_2907706_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	38.4	8.5e-06
WP_014070841.1|2907794_2907941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041162087.1|2907941_2908160_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	66.2	1.1e-18
WP_014070843.1|2908159_2908672_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	1.6e-68
WP_014070844.1|2908634_2908874_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_176408562.1|2908883_2909051_+	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_014070845.1|2909242_2909443_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	72.7	7.4e-22
WP_014070846.1|2909451_2909697_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	67.9	9.4e-27
WP_014070847.1|2909742_2911035_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	66.2	1.5e-176
2916526:2916541	attR	CTCAATACCGACATGA	NA	NA	NA	NA
>prophage 3
NC_015968	Enterobacter soli, complete sequence	4812833	2973526	2981334	4812833		Enterobacteria_phage(33.33%)	7	NA	NA
WP_014070907.1|2973526_2974138_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.6	1.6e-14
WP_014070908.1|2974176_2975157_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_014070909.1|2975350_2976355_+	NAD-dependent epimerase	NA	A0A2K9KZK0	Tupanvirus	24.5	2.3e-18
WP_014070910.1|2976411_2977578_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	52.7	6.5e-110
WP_014070911.1|2977829_2979236_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	1.5e-36
WP_014070912.1|2979387_2980254_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	7.0e-109
WP_014070913.1|2980269_2981334_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	1.0e-101
>prophage 4
NC_015968	Enterobacter soli, complete sequence	4812833	3262336	3352527	4812833	tRNA,integrase,head,tail,holin,portal,terminase,protease,capsid	Enterobacteria_phage(16.67%)	97	3307690:3307707	3353246:3353263
WP_014071142.1|3262336_3263149_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_014071143.1|3263148_3264162_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014071144.1|3264229_3265366_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	3.6e-20
WP_014071145.1|3265479_3266484_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_014071146.1|3266552_3267731_-	MFS transporter	NA	NA	NA	NA	NA
WP_014071147.1|3267799_3269017_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_014071148.1|3269175_3271176_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_014071149.1|3271238_3271514_-	YfcL family protein	NA	NA	NA	NA	NA
WP_014071150.1|3271527_3272073_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_014071151.1|3272072_3272882_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014071152.1|3272881_3273706_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_014071153.1|3273708_3274794_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	8.5e-88
WP_041162095.1|3274854_3275787_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014071154.1|3275932_3276484_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_014071155.1|3276521_3277007_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_014071156.1|3277216_3279364_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_014071157.1|3279363_3280674_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_014071158.1|3280912_3281197_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_014071159.1|3281568_3282915_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_014071160.1|3282959_3283712_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_014071161.1|3284026_3284956_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	84.2	3.1e-139
WP_014071162.1|3285204_3285525_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	77.4	1.5e-40
WP_014071163.1|3285524_3285764_-	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	73.4	9.8e-29
WP_128738905.1|3285833_3286274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014071165.1|3286370_3288386_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	52.4	7.7e-34
WP_014071166.1|3288431_3291509_-	kinase	NA	A0A286S259	Klebsiella_phage	47.9	8.7e-271
WP_014071167.1|3291505_3291886_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	72.2	2.5e-50
WP_014071168.1|3291896_3292379_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	73.1	2.6e-60
WP_014071169.1|3292375_3292846_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.4	1.5e-52
WP_014071170.1|3292845_3295266_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	43.0	3.5e-142
WP_041162097.1|3295269_3295524_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	65.1	1.8e-25
WP_041162098.1|3295535_3295916_-|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	70.2	6.1e-41
WP_014071172.1|3295966_3296449_-	hypothetical protein	NA	Q9MCU9	Escherichia_phage	57.7	9.1e-50
WP_014071173.1|3296502_3296871_-	hypothetical protein	NA	K7PHI9	Enterobacteria_phage	67.2	3.7e-43
WP_041162260.1|3296867_3297353_-	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	56.9	2.0e-44
WP_014071175.1|3297345_3297681_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	84.7	5.9e-48
WP_014071176.1|3297685_3297898_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	63.9	4.8e-11
WP_014071177.1|3297966_3298290_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	45.5	1.1e-19
WP_167320596.1|3298333_3298525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014071179.1|3298671_3299880_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	83.4	1.9e-189
WP_176408566.1|3299894_3300545_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.6	1.9e-103
WP_014071181.1|3300534_3301764_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	82.9	6.3e-204
WP_014071183.1|3301957_3303691_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	93.1	0.0e+00
WP_014071184.1|3303687_3304182_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	91.5	1.9e-82
WP_014071185.1|3304313_3304664_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	7.5e-54
WP_014071186.1|3304772_3304961_-	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	82.0	8.5e-20
WP_014071188.1|3305171_3305738_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	77.3	2.3e-60
WP_014071189.1|3305734_3306175_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	65.8	3.3e-46
WP_014071190.1|3306161_3306503_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	6.3e-29
WP_014071191.1|3306674_3307079_-	antitermination protein	NA	S5M7R9	Escherichia_phage	52.4	2.1e-31
WP_014071192.1|3307068_3307713_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	65.9	3.8e-83
3307690:3307707	attL	GCAGTAGATAAGTTGATA	NA	NA	NA	NA
WP_014071193.1|3307709_3308327_-	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	57.9	4.7e-43
WP_014071194.1|3308323_3309295_-	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	62.2	3.0e-108
WP_014071195.1|3309291_3310821_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.2	9.2e-205
WP_014071196.1|3310813_3311089_-	NUMOD4 domain-containing protein	NA	NA	NA	NA	NA
WP_014071198.1|3311563_3312034_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	76.9	1.7e-61
WP_014071199.1|3312059_3312257_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	51.7	1.1e-12
WP_014071200.1|3312352_3313006_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	58.5	3.7e-70
WP_041162262.1|3313412_3314486_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.3	4.4e-52
WP_014071202.1|3314868_3315228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014071203.1|3315269_3316082_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_014071204.1|3316168_3317008_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.8	1.6e-73
WP_014071205.1|3317209_3318001_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	57.0	1.3e-24
WP_128738906.1|3317946_3318954_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A193GZ89	Enterobacter_phage	98.1	1.7e-186
WP_014071207.1|3318957_3319347_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	69.6	9.4e-21
WP_014071208.1|3319348_3319915_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.7	1.6e-69
WP_014071209.1|3319925_3320111_+	50S ribosomal protein L7/L12	NA	A0A2R2Z2X2	Escherichia_phage	57.9	2.6e-13
WP_014071210.1|3320094_3321264_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	83.5	2.3e-195
WP_014071211.1|3321718_3323008_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.6	1.4e-73
WP_014071212.1|3323007_3323949_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	48.9	8.4e-07
WP_000153152.1|3324062_3324275_+	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	49.2	6.9e-10
WP_014071213.1|3324324_3324504_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	54.2	4.4e-10
WP_001118612.1|3324635_3324812_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_014071214.1|3324804_3325164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014071215.1|3325195_3325480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014071216.1|3325476_3325866_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_014071217.1|3325862_3328535_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	2.1e-58
WP_014071218.1|3328935_3329697_+|capsid	phage capsid morphogenesis protein encoded in CP-933I	capsid	NA	NA	NA	NA
WP_014071219.1|3329696_3329969_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	1.4e-07
WP_014071220.1|3330292_3331963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014071221.1|3332662_3333139_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_088201875.1|3333445_3334366_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.9	9.8e-77
WP_099458937.1|3334706_3334778_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_014071223.1|3334845_3336069_-	alanine transaminase	NA	NA	NA	NA	NA
WP_014071224.1|3336455_3338153_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014071225.1|3338166_3338898_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	6.5e-15
WP_014071226.1|3338935_3339901_-	glucokinase	NA	NA	NA	NA	NA
WP_014071227.1|3340105_3341341_+	ion channel protein	NA	NA	NA	NA	NA
WP_014071228.1|3341341_3343000_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_014071229.1|3343184_3344183_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014071230.1|3344309_3344645_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_014071231.1|3344679_3345918_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_014071232.1|3346268_3347456_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_074392908.1|3347500_3349654_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014071234.1|3350314_3350671_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_128738936.1|3350693_3351068_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014071236.1|3351111_3352527_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
3353246:3353263	attR	TATCAACTTATCTACTGC	NA	NA	NA	NA
>prophage 5
NC_015968	Enterobacter soli, complete sequence	4812833	4190828	4293257	4812833	tRNA,integrase,head,tail,portal,terminase,protease,capsid	uncultured_Caudovirales_phage(50.0%)	95	4213227:4213250	4297686:4297709
WP_014071964.1|4190828_4193684_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	2.7e-141
WP_014071965.1|4193807_4194311_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014071966.1|4194394_4195414_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	30.7	1.9e-44
WP_014071967.1|4195506_4197153_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_014071968.1|4197290_4198796_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	1.1e-82
WP_128738943.1|4198775_4199717_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	36.8	3.1e-17
WP_041162137.1|4200403_4204864_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014071970.1|4204873_4206292_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
WP_014071971.1|4206327_4206795_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_014071972.1|4206806_4207661_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_014071973.1|4207641_4208346_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_014071974.1|4208350_4209841_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	1.1e-08
WP_014071975.1|4209933_4210827_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_014071976.1|4210949_4211732_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_041162289.1|4211834_4212332_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.7	8.6e-27
WP_014071978.1|4212337_4212976_-	stringent starvation protein A	NA	NA	NA	NA	NA
4213227:4213250	attL	ATAAAAAAACCCGCCGAAGCGGGT	NA	NA	NA	NA
WP_003860436.1|4213284_4213677_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_014071979.1|4213692_4214121_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_014071980.1|4214411_4215536_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_014071981.1|4215725_4216124_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_014071982.1|4216295_4217663_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.8	1.3e-21
WP_014071983.1|4217755_4218823_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_014071984.1|4218909_4219848_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003860428.1|4220245_4220716_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_014071985.1|4221094_4221358_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_014071986.1|4221464_4221731_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_014071987.1|4221798_4222071_-	barstar family protein	NA	NA	NA	NA	NA
WP_014071988.1|4222116_4223571_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014071989.1|4223659_4225627_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_014071990.1|4225632_4226565_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|4226572_4226776_-	AaeX family protein	NA	NA	NA	NA	NA
WP_014071991.1|4226955_4227882_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_014071992.1|4228099_4228714_+	YagU family protein	NA	NA	NA	NA	NA
WP_014071993.1|4228764_4230210_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_014071994.1|4230296_4234097_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_014071995.1|4234140_4235610_-	ribonuclease G	NA	NA	NA	NA	NA
WP_014071996.1|4235599_4236193_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_014071997.1|4236202_4236691_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_014071998.1|4236690_4237707_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4237769_4238813_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_014071999.1|4239093_4241034_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_014072000.1|4241217_4242192_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014072001.1|4242269_4243271_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_014072002.1|4243271_4243871_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_014072003.1|4244105_4244558_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_014072004.1|4244579_4245044_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_014072005.1|4245054_4246404_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_014072006.1|4246512_4246755_+	YhdT family protein	NA	NA	NA	NA	NA
WP_014072007.1|4246744_4248196_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_014072008.1|4248207_4249089_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014072009.1|4249226_4249967_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_014072010.1|4250297_4251263_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4251286_4251583_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_014072011.1|4251751_4252516_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_014072012.1|4252555_4252810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041162292.1|4253262_4253601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014072014.1|4253609_4254209_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	73.2	4.7e-72
WP_014072015.1|4254222_4255884_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.6	0.0e+00
WP_000113647.1|4255867_4256224_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_014072018.1|4256499_4256943_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	6.8e-76
WP_001549740.1|4256942_4257236_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	81.4	9.4e-42
WP_014072019.1|4257228_4257567_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	4.3e-22
WP_014072020.1|4257563_4258799_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.1	2.8e-236
WP_000848270.1|4258800_4259361_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	7.7e-101
WP_014072021.1|4259412_4260579_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	1.3e-214
WP_041162293.1|4260962_4261565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014072023.1|4261642_4262152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014072024.1|4262186_4262447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014072025.1|4262661_4264026_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	96.9	4.4e-259
WP_014072026.1|4264022_4264391_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
WP_006178882.1|4264387_4264609_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	57.1	3.4e-12
WP_128738910.1|4264601_4264814_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	93.4	7.1e-23
WP_128738911.1|4264779_4265850_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	31.8	7.0e-26
WP_014072030.1|4265860_4266070_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	97.1	3.1e-31
WP_014072031.1|4266185_4267028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014072032.1|4267024_4268248_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	96.3	1.4e-235
WP_014072033.1|4268620_4268785_+	DUF2556 family protein	NA	NA	NA	NA	NA
WP_014072034.1|4268924_4271006_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	37.1	4.9e-23
WP_014072035.1|4271000_4271648_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_014072036.1|4272047_4273187_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014072037.1|4273198_4276309_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_008502867.1|4276612_4276834_+	lipoprotein	NA	NA	NA	NA	NA
WP_014072039.1|4277324_4278350_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.7	2.8e-72
WP_014072040.1|4278417_4279599_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014072041.1|4279608_4280712_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014072042.1|4280719_4281478_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
WP_014072043.1|4287334_4287889_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_014072044.1|4287864_4288113_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_041162295.1|4288109_4288928_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_014072046.1|4288932_4289505_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	28.3	1.1e-09
WP_014072047.1|4289497_4290052_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_014072048.1|4290079_4290553_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041162296.1|4290524_4291649_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_014072050.1|4291776_4292286_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	5.1e-19
WP_014072051.1|4292309_4293257_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.0	1.3e-07
4297686:4297709	attR	ATAAAAAAACCCGCCGAAGCGGGT	NA	NA	NA	NA
>prophage 1
NC_015963	Enterobacter soli plasmid pENTAS01, complete sequence	166725	88327	130024	166725	integrase,transposase,plate	Escherichia_phage(57.14%)	34	119668:119681	122020:122033
WP_014063907.1|88327_88912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.3	1.4e-47
WP_014063908.1|89379_89931_+	type I fimbrial protein, A chain	NA	NA	NA	NA	NA
WP_014063909.1|90003_90555_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_049796703.1|91575_94107_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_167320615.1|94084_94309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128738954.1|94305_94563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014063912.1|94690_95299_+	fimbrial protein	NA	NA	NA	NA	NA
WP_014063913.1|95502_96303_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014063914.1|96299_96698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506106.1|97394_97559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014063917.1|97714_98416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014063918.1|98503_99316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064555910.1|99774_100353_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_088201860.1|100575_101744_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	94.7	1.9e-173
WP_014063922.1|102000_102612_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.9	2.9e-53
WP_014063923.1|103115_104105_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.7	1.7e-05
WP_014063924.1|104354_106709_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014063925.1|106710_108003_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_014063926.1|108004_109567_-	aspartate aminotransferase family protein	NA	S4W1T5	Pandoravirus	28.6	9.9e-13
WP_041162320.1|110218_110896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157506106.1|111134_111299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014063914.1|111995_112394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014063913.1|112390_113191_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014063928.1|113395_114394_-	fimbrial protein	NA	NA	NA	NA	NA
WP_014063929.1|114384_117117_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014063930.1|117177_117948_-	molecular chaperone	NA	NA	NA	NA	NA
WP_014063909.1|118135_118687_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014063931.1|118759_119281_-	hypothetical protein	NA	NA	NA	NA	NA
119668:119681	attL	ATTATCTGATGATA	NA	NA	NA	NA
WP_014063907.1|119777_120362_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.3	1.4e-47
WP_014063932.1|120940_122056_-	hypothetical protein	NA	NA	NA	NA	NA
122020:122033	attR	TATCATCAGATAAT	NA	NA	NA	NA
WP_014063933.1|122042_124577_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	29.7	3.8e-86
WP_014063934.1|124596_128031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014063935.1|128039_128648_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014063936.1|128650_130024_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NC_015969	Enterobacter soli plasmid pENTAS02, complete sequence	32574	55	32350	32574	head,integrase,terminase,plate,holin,tail,capsid,portal	Enterobacteria_phage(42.86%)	39	6944:6955	32369:32380
WP_014072459.1|55_310_-	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	39.4	1.9e-06
WP_014072460.1|349_1486_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	75.2	1.8e-160
WP_041162341.1|1639_2821_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	75.7	7.2e-173
WP_014072462.1|2821_3334_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.9	2.1e-60
WP_014072463.1|3386_3704_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.1	1.7e-20
WP_032424037.1|3709_3865_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_014072464.1|3851_6818_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	53.6	1.4e-265
WP_014072465.1|6832_7321_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	2.4e-66
6944:6955	attL	GCAAAATGGCAG	NA	NA	NA	NA
WP_014072466.1|7474_7879_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.0	1.2e-26
WP_014072467.1|7890_9942_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	81.0	5.4e-91
WP_014072468.1|9953_10481_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	75.0	1.3e-73
WP_014072469.1|10473_11370_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	66.8	1.6e-103
WP_014072470.1|11356_11725_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	62.6	7.0e-34
WP_014072471.1|11721_12297_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	66.1	1.4e-68
WP_014072472.1|12293_12932_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.6	3.5e-57
WP_014072473.1|12909_13395_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	64.9	1.7e-59
WP_014072474.1|13399_13936_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	76.8	4.4e-29
WP_014072475.1|13932_14373_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	83.6	4.1e-65
WP_014072476.1|14359_14692_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	90.0	6.5e-47
WP_014072477.1|14701_14902_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	77.3	1.5e-22
WP_014072478.1|14901_15426_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.6	5.4e-40
WP_014072479.1|15524_16382_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	62.2	3.1e-69
WP_014072480.1|16427_17477_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	51.9	4.8e-104
WP_014072481.1|17500_18337_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.2	5.4e-98
WP_014072482.1|18496_20227_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	77.2	4.2e-270
WP_014072483.1|20226_21285_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.8	1.1e-143
WP_014072484.1|21721_22360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014072485.1|22363_23362_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_014072486.1|23520_25920_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	87.3	0.0e+00
WP_014072487.1|25923_27225_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	33.2	2.1e-40
WP_014072488.1|27224_28196_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.3	1.1e-137
WP_014072489.1|28197_28410_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	66.7	3.1e-18
WP_041162342.1|28495_28726_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	86.8	6.9e-32
WP_128738957.1|28715_28919_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	58.8	1.4e-15
WP_014072492.1|28926_29130_-	hypothetical protein	NA	R9TMQ7	Vibrio_phage	46.2	6.4e-05
WP_014072494.1|29440_29824_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	58.6	4.0e-24
WP_014072495.1|29833_30463_+	membrane protein	NA	NA	NA	NA	NA
WP_014072496.1|30479_31346_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_014072497.1|31342_32350_+|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	56.1	1.1e-105
32369:32380	attR	CTGCCATTTTGC	NA	NA	NA	NA
