The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007031	Marichromatium purpuratum 984, complete genome	3779112	1202033	1243779	3779112	tRNA,integrase,tail,portal,terminase,protease,head	Pseudomonas_phage(16.67%)	52	1209863:1209912	1251588:1251637
WP_005220596.1|1202033_1203950_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.0	1.1e-127
WP_025275132.1|1204015_1204549_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.3	8.6e-09
WP_005220599.1|1204704_1204902_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005220602.1|1204929_1205286_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005220604.1|1205557_1206589_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.2	9.1e-31
WP_005220606.1|1206758_1209137_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005220608.1|1209141_1209441_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.1e-12
WP_005220610.1|1209421_1209796_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
1209863:1209912	attL	CTGAATGGGGTTCAGGTGGTCGGAGGTTCAAATCCTCTCGCCCCGACCAA	NA	NA	NA	NA
WP_005220612.1|1209945_1211025_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	49.4	3.2e-87
WP_156929233.1|1210901_1211225_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005220614.1|1211430_1211691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005220616.1|1211687_1212842_-	recombination-associated protein RdgC	NA	Q8H9Q5	Vibrio_phage	36.2	3.3e-53
WP_005220619.1|1212887_1214237_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	54.0	2.2e-56
WP_005220624.1|1214249_1215086_-	GP60 protein	NA	V5R922	Arthrobacter_phage	33.8	9.6e-31
WP_005220625.1|1215191_1215521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005220627.1|1215522_1215729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005220629.1|1215823_1216093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005220631.1|1216095_1216500_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005220633.1|1216496_1216910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156929234.1|1217036_1217660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005220641.1|1217949_1218159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220643.1|1218131_1218326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005220645.1|1218467_1218965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220648.1|1219157_1220126_+	hypothetical protein	NA	A0A2I7RHJ6	Vibrio_phage	37.4	2.0e-11
WP_005220650.1|1220115_1220937_+	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	35.3	1.8e-13
WP_005220651.1|1220936_1221416_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	57.7	2.4e-42
WP_084015143.1|1221586_1221991_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1J0GV15	Halomonas_phage	32.5	9.8e-05
WP_156929235.1|1222013_1222754_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.9	2.7e-16
WP_005220658.1|1222805_1223351_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	40.5	4.2e-11
WP_005220660.1|1223340_1225365_+|terminase	terminase GpA	terminase	A5LH27	Enterobacteria_phage	44.1	2.6e-154
WP_005220662.1|1225368_1225629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220664.1|1225705_1225915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084015144.1|1225844_1227290_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	37.5	7.9e-73
WP_005220669.1|1227551_1228340_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_156929323.1|1228447_1229017_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_084015145.1|1230031_1231336_-	hypothetical protein	NA	A0A0H3UZF1	Geobacillus_virus	44.5	1.4e-20
WP_156929324.1|1231357_1231630_-	hypothetical protein	NA	A0A0H3UZF1	Geobacillus_virus	36.5	3.5e-06
WP_005220689.1|1231871_1232159_-	hypothetical protein	NA	Q2A091	Sodalis_phage	31.5	4.1e-05
WP_005220691.1|1232330_1232765_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_043763150.1|1232775_1232982_-	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	65.9	3.9e-10
WP_005220702.1|1234592_1235669_+|protease	Clp protease ClpP	protease	Q9XJT4	Pseudomonas_phage	35.9	4.0e-21
WP_005220704.1|1235672_1236047_+|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	45.9	1.6e-09
WP_084015146.1|1236046_1237003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220706.1|1237010_1237313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220707.1|1237305_1237731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051415192.1|1237799_1237994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220710.1|1237974_1238208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220711.1|1238207_1238597_+	M15 family metallopeptidase	NA	A0A2D1GMU0	Marinobacter_phage	62.4	1.4e-40
WP_005220713.1|1238593_1238932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220714.1|1238963_1239719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005220715.1|1239738_1240167_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	41.5	1.8e-09
WP_005220716.1|1240167_1243779_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
1251588:1251637	attR	CTGAATGGGGTTCAGGTGGTCGGAGGTTCAAATCCTCTCGCCCCGACCAA	NA	NA	NA	NA
>prophage 2
NZ_CP007031	Marichromatium purpuratum 984, complete genome	3779112	2477957	2488118	3779112	transposase	Bacillus_phage(33.33%)	10	NA	NA
WP_005223272.1|2477957_2479415_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.4	2.7e-20
WP_005223271.1|2479411_2480122_+	response regulator	NA	W8CYM9	Bacillus_phage	37.8	1.6e-34
WP_025275285.1|2480476_2482048_+	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
WP_005223269.1|2482044_2484675_+	glycosyltransferase	NA	M1I277	Paramecium_bursaria_Chlorella_virus	27.2	3.4e-21
WP_005223268.1|2484850_2485255_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	57.1	1.7e-17
WP_156929264.1|2485722_2486193_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	1.1e-26
WP_156929265.1|2486202_2486367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005223265.1|2486326_2486560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156929266.1|2486765_2487083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005223264.1|2487104_2488118_-	RNA-directed DNA polymerase	NA	D4HTV9	Vibrio_phage	39.6	5.2e-55
>prophage 3
NZ_CP007031	Marichromatium purpuratum 984, complete genome	3779112	2781579	2794416	3779112		Enterobacteria_phage(42.86%)	10	NA	NA
WP_005225007.1|2781579_2784012_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.4	2.2e-139
WP_005225008.1|2784118_2785540_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_156929273.1|2785687_2785825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005225009.1|2785881_2786793_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	34.7	5.2e-30
WP_025275317.1|2786789_2787353_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.8	2.2e-47
WP_005225011.1|2787352_2788231_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	3.3e-98
WP_005225012.1|2788241_2789297_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.2	8.9e-90
WP_005225013.1|2789333_2789909_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	70.4	1.2e-45
WP_005225014.1|2790076_2791495_-	MFS transporter	NA	NA	NA	NA	NA
WP_005225015.1|2791590_2794416_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	53.5	2.2e-292
