The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015914	Cyclobacterium marinum DSM 745, complete sequence	6221273	1631729	1683105	6221273	transposase,tRNA,protease,integrase	Vibrio_phage(20.0%)	43	1640970:1641018	1692885:1692933
WP_014019442.1|1631729_1632455_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014019443.1|1632461_1632992_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_014019444.1|1633006_1633588_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_157466636.1|1634423_1635521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014019446.1|1635557_1637183_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.7	3.1e-25
WP_014019447.1|1637193_1638054_+	universal stress protein	NA	NA	NA	NA	NA
WP_041934582.1|1638798_1639119_-	hypothetical protein	NA	NA	NA	NA	NA
1640970:1641018	attL	GATTTTGGCGGTATTGTTGCTTTTTTTTTGCAACAATGCTGACAAAATC	NA	NA	NA	NA
WP_014019451.1|1641660_1642668_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014019452.1|1642763_1643369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014019453.1|1643429_1645193_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_014019454.1|1645189_1645564_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014019455.1|1645711_1646464_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	35.6	6.0e-24
WP_014019456.1|1646800_1647922_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.0	2.4e-24
WP_041934588.1|1648131_1648941_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	34.3	1.1e-36
WP_014019457.1|1648940_1650113_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014019458.1|1650425_1651133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014019459.1|1651276_1651687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041934589.1|1652080_1652404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157466928.1|1652870_1653965_+	serine hydrolase	NA	NA	NA	NA	NA
WP_014019464.1|1654292_1654835_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014019465.1|1654831_1655623_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041934590.1|1655910_1656117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014019466.1|1656354_1656825_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014019467.1|1656922_1657300_+	DoxX family protein	NA	NA	NA	NA	NA
WP_014019468.1|1657336_1658356_+	pirin family protein	NA	NA	NA	NA	NA
WP_014019469.1|1658434_1659307_+	pirin family protein	NA	NA	NA	NA	NA
WP_014019470.1|1659433_1660540_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_014019471.1|1660718_1661480_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014019472.1|1661525_1662668_-	MFS transporter	NA	NA	NA	NA	NA
WP_014019473.1|1663855_1665373_+	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_014019474.1|1665466_1665706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014019476.1|1666793_1667777_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_014019477.1|1668116_1670126_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_014019478.1|1670115_1671198_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_014019479.1|1671262_1674901_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014019480.1|1674913_1675771_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_149394941.1|1675869_1677015_+	HD domain-containing protein	NA	A0A1B1IT47	uncultured_Mediterranean_phage	32.7	9.9e-10
WP_014019482.1|1677240_1677891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014019483.1|1677914_1678826_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_052316301.1|1678896_1679760_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014019485.1|1679855_1680845_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_014019487.1|1680994_1681933_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014019488.1|1682166_1683105_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1692885:1692933	attR	GATTTTGGCGGTATTGTTGCTTTTTTTTTGCAACAATGCTGACAAAATC	NA	NA	NA	NA
