The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	609229	619120	3939203		Synechococcus_phage(50.0%)	9	NA	NA
WP_014469853.1|609229_610522_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_014469854.1|610597_611317_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	9.8e-48
WP_014469855.1|611316_611571_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	35.8	2.1e-05
WP_014469856.1|611567_612251_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014469857.1|612234_614463_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.8e-159
WP_014469858.1|614438_615869_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_014469859.1|615960_617001_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	8.2e-64
WP_014469860.1|616997_617585_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	1.0e-26
WP_014469861.1|617581_619120_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	2.3e-78
>prophage 2
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1072635	1078888	3939203		Staphylococcus_phage(66.67%)	9	NA	NA
WP_013352733.1|1072635_1073751_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
WP_014470033.1|1073731_1074379_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352731.1|1074393_1075590_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_013352730.1|1075622_1076087_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352729.1|1076203_1076578_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352728.1|1076643_1077165_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_076983148.1|1077252_1077342_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352727.1|1077549_1078305_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_013352726.1|1078294_1078888_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
>prophage 3
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1181555	1194344	3939203	holin	Bacillus_phage(100.0%)	13	NA	NA
WP_014470066.1|1181555_1182536_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.9	8.5e-79
WP_076982859.1|1182799_1183234_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470068.1|1183277_1184048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470069.1|1184554_1186441_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	55.0	5.6e-111
WP_014470070.1|1186453_1186912_+	SMI1/KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.2	5.2e-71
WP_009967548.1|1187219_1187336_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_014470071.1|1187564_1187768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470072.1|1188885_1189218_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	5.3e-41
WP_014470073.1|1189210_1190461_+	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	91.8	1.0e-222
WP_014472510.1|1191938_1192199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|1192554_1192806_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_014472511.1|1192818_1193190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470079.1|1193297_1194344_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	52.0	5.7e-81
>prophage 4
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1208992	1220670	3939203	integrase	Bacillus_phage(83.33%)	19	1199859:1199874	1227241:1227256
1199859:1199874	attL	CTTTTCAAAAGACAGT	NA	NA	NA	NA
WP_014470085.1|1208992_1209619_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	32.8	1.9e-23
WP_014470086.1|1209690_1210101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470087.1|1210194_1210377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470088.1|1210405_1211458_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	40.9	2.3e-61
WP_014470089.1|1211454_1211955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472516.1|1212122_1212338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470091.1|1212382_1213384_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	87.0	5.7e-171
WP_014470092.1|1213397_1213814_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	65.5	5.3e-46
WP_014470093.1|1213813_1214299_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.5	2.2e-59
WP_014470094.1|1214387_1215236_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014470095.1|1215254_1215407_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470096.1|1215407_1215683_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	1.2e-09
WP_014470097.1|1215696_1217028_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	42.6	1.3e-21
WP_014470098.1|1217027_1217384_-	hypothetical protein	NA	O64055	Bacillus_phage	78.8	2.4e-47
WP_014470099.1|1217455_1217923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470100.1|1217943_1218741_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.2	1.5e-17
WP_014470101.1|1218779_1219505_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	31.8	4.7e-26
WP_014470102.1|1219501_1220008_-	hypothetical protein	NA	O64060	Bacillus_phage	66.7	1.7e-62
WP_014470103.1|1220004_1220670_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	51.1	1.6e-49
1227241:1227256	attR	ACTGTCTTTTGAAAAG	NA	NA	NA	NA
>prophage 5
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1225974	1237168	3939203		Bacillus_phage(66.67%)	9	NA	NA
WP_014470110.1|1225974_1229040_-	heavy metal transporter	NA	A0A0K2FLD6	Brevibacillus_phage	30.0	8.1e-51
WP_014470111.1|1229039_1230047_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.5	9.6e-09
WP_014470112.1|1230155_1230656_-	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	32.5	1.1e-18
WP_014470114.1|1230889_1231042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470115.1|1231056_1232274_-	hypothetical protein	NA	O64073	Bacillus_phage	97.3	9.8e-226
WP_014470116.1|1232285_1232495_-	YonK family protein	NA	NA	NA	NA	NA
WP_014470117.1|1232763_1232964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470118.1|1234118_1234394_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	7.0e-39
WP_014470119.1|1234651_1237168_-	hypothetical protein	NA	O64076	Bacillus_phage	83.1	0.0e+00
>prophage 6
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1240269	1247718	3939203		Bacillus_phage(100.0%)	9	NA	NA
WP_014470124.1|1240269_1240446_+	hypothetical protein	NA	O64080	Bacillus_phage	92.1	1.3e-09
WP_076983670.1|1240499_1240715_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	95.8	1.6e-30
WP_003230987.1|1240759_1240948_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_014470125.1|1241029_1242247_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.7	6.4e-201
WP_014470126.1|1242562_1243417_+	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	85.6	5.3e-125
WP_014470127.1|1243422_1244340_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	87.9	2.4e-139
WP_014470128.1|1244341_1244944_+	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	99.5	1.1e-105
WP_014470129.1|1244945_1246742_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.7	0.0e+00
WP_014470130.1|1247010_1247718_+	phage antirepressor KilAC domain-containing protein	NA	A0A1P8CWY0	Bacillus_phage	49.2	1.3e-52
>prophage 7
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1256102	1283335	3939203	integrase	Bacillus_phage(82.35%)	47	1258446:1258459	1262274:1262287
WP_014417903.1|1256102_1256285_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
WP_014470146.1|1256355_1256607_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	7.1e-22
WP_014470147.1|1256609_1256825_+	hypothetical protein	NA	O64089	Bacillus_phage	52.1	8.8e-13
WP_014470148.1|1256836_1256968_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	2.7e-17
WP_014470150.1|1257068_1257605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470151.1|1257623_1258286_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_014470152.1|1258323_1258482_+	hypothetical protein	NA	NA	NA	NA	NA
1258446:1258459	attL	GGAAACTTTATTAT	NA	NA	NA	NA
WP_014470154.1|1258712_1259873_+	hypothetical protein	NA	A0A288WGA2	Bacillus_phage	23.2	1.6e-07
WP_014470155.1|1259899_1260028_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_014470156.1|1260354_1260555_+	hypothetical protein	NA	O64096	Bacillus_phage	61.5	1.9e-14
WP_014470157.1|1260560_1260899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470158.1|1260943_1261177_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	60.0	8.9e-11
WP_014470159.1|1261160_1262243_+|integrase	tyrosine-type recombinase/integrase	integrase	O64099	Bacillus_phage	63.3	1.1e-124
WP_014470160.1|1262329_1263721_+	hypothetical protein	NA	O64100	Bacillus_phage	74.6	9.6e-201
1262274:1262287	attR	ATAATAAAGTTTCC	NA	NA	NA	NA
WP_014470161.1|1263741_1264719_+	hypothetical protein	NA	O64101	Bacillus_phage	74.5	7.6e-136
WP_014470163.1|1265350_1265566_+	YopT family protein	NA	O64103	Bacillus_phage	64.3	2.8e-19
WP_014470166.1|1266126_1266375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472527.1|1266503_1266704_+	hypothetical protein	NA	M4ZRU5	Bacillus_phage	82.8	7.1e-25
WP_014470168.1|1266700_1267078_+	hypothetical protein	NA	R4JKA5	Bacillus_phage	38.8	1.9e-18
WP_014470169.1|1267077_1267287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470170.1|1267283_1267619_+	hypothetical protein	NA	O64111	Bacillus_phage	76.6	2.2e-42
WP_014470171.1|1267687_1268485_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	54.2	1.6e-70
WP_014470172.1|1268518_1268704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_186434520.1|1268709_1268961_+	hypothetical protein	NA	O64116	Bacillus_phage	83.3	1.1e-33
WP_014470174.1|1268984_1269179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470175.1|1269211_1269604_+	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.9	6.3e-25
WP_014470176.1|1269642_1270482_+	site-specific DNA-methyltransferase	NA	A0A2H4IZ65	uncultured_Caudovirales_phage	59.1	1.6e-78
WP_096034861.1|1270604_1270826_+	hypothetical protein	NA	O64123	Bacillus_phage	93.0	3.7e-30
WP_014470178.1|1270839_1271214_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	63.4	1.7e-35
WP_014470179.1|1271328_1271493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470180.1|1271578_1271830_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	56.5	1.6e-18
WP_014470181.1|1271869_1272232_+	hypothetical protein	NA	A0A0S2MUT8	Bacillus_phage	49.0	4.4e-33
WP_014470184.1|1273082_1273280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470186.1|1273497_1274310_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.1	4.2e-140
WP_014470187.1|1274379_1275054_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_014470188.1|1275124_1275370_+	hypothetical protein	NA	O64132	Bacillus_phage	84.1	2.5e-27
WP_014471975.1|1275395_1275647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470190.1|1275662_1276142_+	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	35.4	4.0e-13
WP_014470191.1|1276190_1277078_+	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_014470192.1|1277067_1277340_+	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_014470193.1|1277414_1277633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470194.1|1277743_1278565_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	61.0	1.3e-85
WP_014470195.1|1278561_1280304_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.5	1.0e-220
WP_014470196.1|1280342_1281059_+	serine/threonine protein phosphatase	NA	M4H0M1	Listeria_phage	38.3	9.7e-40
WP_014470197.1|1281080_1281458_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	4.5e-52
WP_014470198.1|1281608_1281965_+	hypothetical protein	NA	O64139	Bacillus_phage	76.1	2.0e-41
WP_014470199.1|1281997_1283335_+	hypothetical protein	NA	A0A0K2FMB7	Brevibacillus_phage	28.5	7.7e-06
>prophage 8
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1286734	1314402	3939203	tRNA	Bacillus_phage(90.0%)	39	NA	NA
WP_014470202.1|1286734_1287799_+	hypothetical protein	NA	A0A218KBY7	Bacillus_phage	38.9	6.5e-64
WP_014470203.1|1287810_1289499_+	DHH family phosphoesterase	NA	A0A1P8CX07	Bacillus_phage	43.3	3.3e-123
WP_014470204.1|1289516_1291808_+	DNA polymerase I	NA	A0A0K0N6N8	Gordonia_phage	28.0	7.8e-06
WP_014470205.1|1291815_1292562_+	3D domain-containing protein	NA	O64147	Bacillus_phage	53.0	1.6e-53
WP_014470208.1|1293104_1293308_+	YorP family protein	NA	O64150	Bacillus_phage	82.1	3.5e-27
WP_014470209.1|1293312_1293471_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	66.7	8.4e-13
WP_014470210.1|1293467_1293965_+	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	81.2	8.7e-72
WP_014470211.1|1293973_1294492_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	87.2	4.5e-87
WP_014470212.1|1294512_1294755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144653880.1|1294840_1296334_+	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	99.2	1.8e-266
WP_014470214.1|1296380_1296599_+	hypothetical protein	NA	O64155	Bacillus_phage	61.4	1.1e-15
WP_014470217.1|1297368_1297593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470219.1|1297919_1298393_+	hypothetical protein	NA	O64162	Bacillus_phage	67.3	2.1e-59
WP_014470221.1|1298546_1298867_+	hypothetical protein	NA	A0A1P8CX20	Bacillus_phage	79.2	8.4e-44
WP_014470222.1|1298879_1299287_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	74.0	1.3e-49
WP_014470223.1|1299300_1299648_+	hypothetical protein	NA	O64164	Bacillus_phage	89.5	4.5e-51
WP_014470224.1|1299692_1299998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470225.1|1300039_1300333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470226.1|1300366_1300744_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	47.4	4.2e-18
WP_014470227.1|1300750_1300963_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.4	2.3e-29
WP_014470228.1|1300976_1301309_+	hypothetical protein	NA	O64168	Bacillus_phage	86.0	5.5e-14
WP_014470229.1|1301360_1301717_+	hypothetical protein	NA	O64171	Bacillus_phage	96.6	2.3e-58
WP_014470230.1|1301713_1302109_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	1.5e-63
WP_104843608.1|1302116_1302794_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	1.4e-120
WP_014470236.1|1305626_1306148_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	88.4	4.0e-83
WP_014470238.1|1306706_1307426_+	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	44.7	5.2e-49
WP_014470241.1|1307896_1308253_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
WP_014470242.1|1308301_1308730_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.1	2.0e-72
WP_014470243.1|1308851_1309016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470244.1|1309357_1309630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470245.1|1309622_1309922_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	57.0	3.2e-21
WP_014470247.1|1310393_1311233_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	89.6	9.4e-151
WP_014470248.1|1311232_1311751_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.6	7.1e-32
WP_014470249.1|1311849_1312176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470250.1|1312187_1312571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470251.1|1312567_1312927_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	46.3	1.9e-20
WP_014470252.1|1312926_1313280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470254.1|1313510_1313750_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_014470255.1|1313847_1314402_+	Holliday junction resolvase RecU	NA	O64195	Bacillus_phage	92.7	1.1e-91
>prophage 9
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	1562911	1573260	3939203		Bacillus_phage(71.43%)	14	NA	NA
WP_007611720.1|1562911_1563532_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_013352414.1|1563880_1564309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352413.1|1564464_1564914_+	YndM family protein	NA	NA	NA	NA	NA
WP_013352412.1|1564941_1565772_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352411.1|1565758_1565908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352410.1|1566014_1566836_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352409.1|1567041_1567227_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352408.1|1567236_1567671_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352407.1|1567841_1568081_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_014470354.1|1568368_1570786_+	peptidase G2	NA	D6R401	Bacillus_phage	50.1	5.0e-221
WP_014472556.1|1570951_1571107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352404.1|1571435_1571972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016935991.1|1572388_1572478_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352403.1|1572639_1573260_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
>prophage 10
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	2114869	2151407	3939203	portal,holin,capsid,terminase,plate,tail	Bacillus_phage(30.3%)	47	NA	NA
WP_014470491.1|2114869_2115748_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
WP_014470492.1|2115761_2116025_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	6.7e-23
WP_013351964.1|2116038_2116302_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_014470493.1|2116355_2117153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470494.1|2117207_2117372_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.4	1.0e-13
WP_014470495.1|2117371_2117698_-	XkdW family protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	39.8	1.2e-13
WP_014470496.1|2117709_2119473_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	50.0	6.6e-13
WP_013351959.1|2119475_2119748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470497.1|2119744_2120323_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	1.8e-12
WP_014470498.1|2120306_2121353_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.0e-69
WP_014470499.1|2121345_2121771_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.2	3.3e-11
WP_013351955.1|2121920_2122187_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_013351954.1|2122186_2123164_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351953.1|2123177_2123837_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_041481990.1|2123829_2128098_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	7.3e-42
WP_015239684.1|2129750_2129903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|2129944_2130391_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|2130465_2130909_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_013351950.1|2130910_2132308_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_013351949.1|2132307_2132517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351948.1|2132513_2132960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351947.1|2132956_2133460_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351946.1|2133456_2133813_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_014470501.1|2133809_2134193_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_013351945.1|2134209_2135145_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_013351944.1|2135171_2136014_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_044051899.1|2136033_2137425_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351942.1|2137473_2138772_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_014472581.1|2138768_2139563_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.0	1.0e-58
WP_013351940.1|2139677_2140187_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_013351939.1|2140299_2140503_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351938.1|2140492_2140834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154863.1|2140931_2141099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470503.1|2141098_2141899_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.7	8.0e-59
WP_014470504.1|2141798_2142626_-	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_014470505.1|2142615_2142795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351934.1|2142985_2143324_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351933.1|2143471_2144062_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351932.1|2144204_2144807_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351931.1|2144916_2145294_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351930.1|2145331_2146285_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_003154881.1|2146428_2146563_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_088030497.1|2146552_2147689_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_013351928.1|2147893_2148361_+	DinB family protein	NA	NA	NA	NA	NA
WP_014470506.1|2148504_2149269_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014470507.1|2149436_2149628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470508.1|2150054_2151407_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	1.0e-13
>prophage 11
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	2186775	2189781	3939203		Bacillus_phage(100.0%)	6	NA	NA
WP_013351886.1|2186775_2187150_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
WP_014470521.1|2187163_2187373_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351885.1|2187823_2188099_+	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_013351884.1|2188748_2189141_-	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351883.1|2189133_2189463_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351882.1|2189622_2189781_+	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
>prophage 12
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	2193939	2264073	3939203	portal,coat,holin,terminase,integrase,plate,head,tail	uncultured_Caudovirales_phage(51.79%)	102	2199627:2199644	2249068:2249085
WP_127721184.1|2193939_2194020_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_013351878.1|2194303_2194639_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.8	3.2e-25
WP_013351877.1|2194842_2195304_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014470524.1|2195428_2195650_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	69.4	1.6e-25
WP_014470525.1|2195959_2196904_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_014470526.1|2196976_2197534_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	82.2	1.4e-89
WP_014470527.1|2197583_2197838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471698.1|2198446_2198800_+	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	50.4	2.4e-23
WP_013351872.1|2198821_2199157_+	hypothetical protein	NA	NA	NA	NA	NA
2199627:2199644	attL	GTCCCCAATTCGTCCCCA	NA	NA	NA	NA
WP_014470529.1|2199742_2200780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470530.1|2200798_2201521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470531.1|2201537_2202086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158306074.1|2202234_2202561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472584.1|2202839_2204660_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	43.2	3.9e-109
WP_014470534.1|2204672_2205113_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014470535.1|2205278_2205509_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_014470536.1|2205978_2206854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470537.1|2206869_2207247_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_014470538.1|2207287_2208445_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	64.1	4.7e-68
WP_014470539.1|2208499_2208763_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	2.0e-27
WP_013351240.1|2208778_2209057_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.7	1.1e-28
WP_014470541.1|2209120_2209315_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	64.5	8.2e-18
WP_014470542.1|2209304_2209769_-	hypothetical protein	NA	O64053	Bacillus_phage	34.9	6.6e-05
WP_014470543.1|2209787_2211008_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	41.3	6.1e-50
WP_014470544.1|2211022_2211652_-	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	82.8	1.4e-90
WP_014470545.1|2211648_2212824_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	71.9	1.1e-152
WP_014470546.1|2212816_2213173_-	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	60.2	5.7e-33
WP_014472588.1|2213169_2213517_-	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	58.3	2.9e-29
WP_014470548.1|2213516_2214485_-	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	58.9	7.6e-104
WP_014470549.1|2214468_2214828_-	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	72.9	1.1e-44
WP_014470550.1|2214842_2215400_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	67.0	2.4e-62
WP_014470551.1|2215400_2220056_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	49.7	5.2e-118
WP_014470552.1|2220214_2220514_-	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	41.7	1.7e-06
WP_014470553.1|2220614_2221010_-	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	2.3e-38
WP_014470554.1|2221026_2222061_-	DUF3383 family protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	63.6	7.0e-124
WP_014470555.1|2222065_2222536_-	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	57.0	4.4e-49
WP_014470556.1|2222492_2222882_-	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	58.8	9.3e-29
WP_014470557.1|2222881_2223385_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	58.9	6.2e-49
WP_014470558.1|2223389_2223725_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J6J9	uncultured_Caudovirales_phage	56.8	1.2e-29
WP_014470559.1|2223739_2224609_-	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	43.0	3.9e-51
WP_014470560.1|2224620_2224824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470561.1|2224837_2225698_-	hypothetical protein	NA	A0A1L2JY55	Aeribacillus_phage	77.1	4.5e-124
WP_014470562.1|2225712_2226432_-	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	50.6	2.5e-51
WP_014470564.1|2226699_2228133_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	58.9	4.2e-151
WP_014470565.1|2228136_2229342_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.0	1.2e-202
WP_014470566.1|2229328_2230084_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	57.2	7.1e-57
WP_014470567.1|2230261_2230573_-	hypothetical protein	NA	Q9T202	Bacillus_phage	54.6	2.1e-23
WP_014470568.1|2230701_2231331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470569.1|2231477_2231939_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	51.2	4.4e-25
WP_014470570.1|2231938_2232145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470572.1|2232489_2232780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470573.1|2232985_2233624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472594.1|2233633_2234356_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_014470575.1|2234487_2234658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472595.1|2234668_2235103_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.1	2.8e-50
WP_014470577.1|2235237_2235588_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_014470578.1|2235798_2236212_-	hypothetical protein	NA	O64129	Bacillus_phage	86.8	5.0e-65
WP_014470579.1|2236293_2237133_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0S2SXP3	Bacillus_phage	57.2	7.8e-89
WP_014470580.1|2237136_2237394_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	41.2	3.9e-07
WP_014470581.1|2237407_2237809_-	hypothetical protein	NA	A0A0S2MUR2	Bacillus_phage	45.2	4.5e-26
WP_014470582.1|2237805_2238036_-	hypothetical protein	NA	J9PL10	Bacillus_phage	44.2	2.3e-11
WP_014470583.1|2238032_2238500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155894.1|2238531_2238735_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_014470584.1|2238816_2238969_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.6e-08
WP_014470585.1|2239026_2239455_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	3.6e-42
WP_014470586.1|2239549_2239693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031378524.1|2239685_2240480_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.0	4.5e-62
WP_014472599.1|2240397_2241105_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_076983677.1|2241302_2242040_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RUC1	Clostridium_phage	44.0	2.2e-50
WP_014470591.1|2242059_2242977_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.1	1.5e-88
WP_014470592.1|2242976_2243162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470593.1|2243264_2243468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470594.1|2243464_2243722_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.7	2.1e-08
WP_014470595.1|2243718_2244291_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.6	3.4e-59
WP_014470596.1|2244441_2244633_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470597.1|2244643_2244868_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	79.7	3.6e-25
WP_014470598.1|2245025_2245412_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	70.7	1.1e-26
WP_014470599.1|2245730_2246705_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	77.5	4.5e-80
WP_014470600.1|2246721_2247204_+	PH domain-containing protein	NA	O64019	Bacillus_phage	90.6	4.8e-75
WP_014470601.1|2247270_2247792_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	64.0	1.6e-55
WP_014470602.1|2247796_2249026_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	50.0	4.2e-107
WP_013351871.1|2249367_2250543_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
2249068:2249085	attR	GTCCCCAATTCGTCCCCA	NA	NA	NA	NA
WP_014470603.1|2250535_2251657_-	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_013351869.1|2252026_2252749_+	esterase family protein	NA	NA	NA	NA	NA
WP_013351868.1|2252774_2253290_+	YjcG family protein	NA	NA	NA	NA	NA
WP_013351867.1|2253294_2253726_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351866.1|2253883_2254117_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013351865.1|2254117_2254855_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	6.7e-28
WP_013351864.1|2254847_2255570_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351863.1|2255606_2256359_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_013351862.1|2256424_2256679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470605.1|2256799_2259085_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	32.9	5.4e-84
WP_013351860.1|2259152_2259407_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_014470606.1|2259573_2259753_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013351859.1|2259844_2260042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351858.1|2260330_2260687_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_014470608.1|2260857_2261244_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|2261281_2261596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351855.1|2261688_2262189_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|2262338_2262821_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|2262978_2263422_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_164848957.1|2263479_2264073_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 13
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	2583972	2643415	3939203	coat,tRNA,protease	uncultured_Mediterranean_phage(33.33%)	58	NA	NA
WP_013353029.1|2583972_2584416_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014470772.1|2584428_2586633_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.5e-09
WP_013353031.1|2586791_2587304_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	7.2e-29
WP_013353032.1|2587309_2589667_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	2.8e-91
WP_013353033.1|2589722_2590049_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_013353034.1|2590112_2590610_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_013353035.1|2590740_2592960_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.9	3.5e-27
WP_013353036.1|2592996_2593293_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_013353037.1|2593407_2594964_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_013353038.1|2594971_2595628_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013353039.1|2595794_2596181_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2596233_2596494_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014470773.1|2596525_2597668_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.6	1.4e-88
WP_013353042.1|2598749_2598950_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013353043.1|2598942_2599947_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	5.2e-07
WP_003152683.1|2599957_2600563_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038463270.1|2600697_2601174_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014470776.1|2601583_2602177_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014470777.1|2602325_2603477_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014470778.1|2603603_2604707_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014470779.1|2604706_2605555_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014470780.1|2605536_2607102_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013353051.1|2607207_2608359_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.5	5.1e-30
WP_013353052.1|2608355_2608898_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013353053.1|2608924_2609782_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2609797_2610241_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_013353054.1|2610294_2611581_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013353055.1|2611612_2612191_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2612507_2612792_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038462961.1|2612804_2613146_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2613148_2613457_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013353057.1|2613602_2614469_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013353058.1|2614461_2615265_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2615393_2616197_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013353059.1|2616199_2616880_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014470782.1|2616933_2617452_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013353061.1|2617448_2618312_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013353062.1|2618342_2619356_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_013353063.1|2619447_2620143_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013353064.1|2620174_2620744_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013353065.1|2620885_2621887_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013353066.1|2622013_2622766_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013353067.1|2622905_2624198_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013353068.1|2624256_2626899_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_013353069.1|2627349_2627541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353070.1|2627555_2628578_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013353071.1|2628611_2630135_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353072.1|2630267_2631557_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_088613212.1|2631585_2632560_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013353074.1|2632562_2633345_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013353075.1|2633334_2634276_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2634310_2635141_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_013353076.1|2635148_2636516_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013353077.1|2636712_2637204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353078.1|2637236_2637824_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013353079.1|2637820_2640145_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	8.8e-183
WP_013353080.1|2640343_2642002_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_014470784.1|2642152_2643415_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	2.5e-147
>prophage 14
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	2868157	2943703	3939203	portal,protease,holin,capsid,terminase,integrase,plate,head,tail	Bacillus_phage(28.57%)	79	2906108:2906155	2943875:2943922
WP_014470850.1|2868157_2868562_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2868697_2869135_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2869259_2869409_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2869405_2869849_-	FixH family protein	NA	NA	NA	NA	NA
WP_013353278.1|2869965_2870439_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2870564_2870792_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2870788_2871358_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2871484_2871733_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2871929_2873261_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2873283_2874324_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2874381_2874540_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2874712_2875828_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_014470853.1|2875824_2877288_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.9	2.4e-77
WP_013353287.1|2877375_2878194_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2878252_2879077_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_014470854.1|2879064_2880801_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2880797_2882210_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2882493_2883213_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013353292.1|2883356_2883827_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_014470856.1|2891174_2891756_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2891787_2893317_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2893336_2893867_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013353296.1|2894013_2894502_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2894503_2895085_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2895155_2896364_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|2896381_2897854_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|2898054_2898615_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|2898781_2899321_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_013353302.1|2899484_2900153_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|2900176_2901022_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|2901161_2902337_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|2903253_2903577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|2904269_2905400_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|2905787_2905991_+	hypothetical protein	NA	NA	NA	NA	NA
2906108:2906155	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_013353310.1|2908683_2909079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353311.1|2909068_2909482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470866.1|2909667_2909892_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
WP_014470867.1|2910014_2910317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470868.1|2910372_2910678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353313.1|2910692_2912108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470869.1|2912158_2912524_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_014470870.1|2912554_2912797_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
WP_013353316.1|2913260_2913932_-	M15 family metallopeptidase	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
WP_013353317.1|2913973_2914381_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	67.2	1.6e-39
WP_013353318.1|2914418_2914592_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
WP_013353319.1|2914594_2914876_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
WP_038463007.1|2914872_2916150_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	52.9	1.8e-81
WP_013353321.1|2916163_2918752_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
WP_013353322.1|2918766_2920647_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	26.8	8.5e-51
WP_013353323.1|2920661_2921495_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013353324.1|2921506_2925280_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	56.4	9.5e-110
WP_013353325.1|2925346_2925532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353326.1|2925543_2925894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353327.1|2925981_2926566_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
WP_013353328.1|2926598_2926982_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014470873.1|2926978_2927362_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
WP_013353329.1|2927361_2927685_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
WP_014470874.1|2927671_2927968_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
WP_013353330.1|2928023_2929217_-|capsid	phage major capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
WP_014470875.1|2929254_2929851_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
WP_013353331.1|2929843_2931088_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
WP_014470876.1|2931092_2931296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353332.1|2931307_2933011_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
WP_013353333.1|2933007_2933481_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_013353334.1|2933752_2933986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353335.1|2934000_2934384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470877.1|2934398_2934689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470878.1|2934682_2934874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353336.1|2935260_2935539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353337.1|2935535_2935715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470882.1|2936137_2936329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470883.1|2936509_2936680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353339.1|2936694_2937444_-	Bro-N domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	39.8	1.6e-21
WP_014470884.1|2939866_2940040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470885.1|2940306_2940441_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_013353340.1|2940485_2941448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470886.1|2941652_2941832_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013353341.1|2942018_2942552_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013353342.1|2942551_2943703_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.8	7.8e-31
2943875:2943922	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
>prophage 15
NC_017191	Bacillus amyloliquefaciens XH7, complete sequence	3939203	3048913	3101349	3939203	bacteriocin,portal,coat,holin,terminase,integrase,plate,tail	Bacillus_phage(28.57%)	61	3040792:3040807	3098056:3098071
3040792:3040807	attL	TTTTCCGGCTGATTCT	NA	NA	NA	NA
WP_003151973.1|3048913_3049249_-|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014470922.1|3049315_3049888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470925.1|3051060_3051822_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470927.1|3052307_3052610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470928.1|3052736_3052994_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	56.5	6.6e-23
WP_038463031.1|3053014_3053953_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.0	1.4e-94
WP_013351581.1|3054032_3054242_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_014470930.1|3054245_3054434_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|3054434_3054704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080292733.1|3054718_3056269_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	54.0	6.1e-55
WP_014470933.1|3056314_3058879_-	peptidase G2	NA	D6R401	Bacillus_phage	74.3	0.0e+00
WP_014470934.1|3058893_3060294_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_014470935.1|3060305_3061730_-|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	3.1e-61
WP_014470936.1|3061736_3063959_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	37.8	3.4e-59
WP_014470937.1|3064207_3064816_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_014470938.1|3065148_3065520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470939.1|3065577_3066132_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_014470940.1|3066156_3066546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470941.1|3066552_3066960_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
WP_038463040.1|3066956_3067292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470943.1|3067292_3067679_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	4.6e-20
WP_014470944.1|3067692_3067884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470945.1|3067940_3068849_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	52.5	9.3e-80
WP_014470946.1|3068880_3069447_-	hypothetical protein	NA	M1NRH2	Streptococcus_phage	30.7	6.1e-05
WP_014470947.1|3069537_3070362_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	52.4	2.0e-73
WP_014470948.1|3070361_3072002_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	55.5	1.4e-163
WP_014470949.1|3072007_3072439_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	2.5e-30
WP_014470950.1|3072455_3074210_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
WP_014470951.1|3074292_3074841_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_014470954.1|3075341_3075587_-	hypothetical protein	NA	A0A2H4IZN0	uncultured_Caudovirales_phage	68.3	1.6e-05
WP_014470955.1|3075858_3076137_-	hypothetical protein	NA	A0A217EQU8	Bacillus_phage	42.4	3.9e-13
WP_014470956.1|3076973_3077573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470957.1|3078265_3079057_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	31.9	7.2e-28
WP_014470958.1|3079143_3079641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470959.1|3079654_3080431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470960.1|3080543_3080777_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470961.1|3080893_3081697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470962.1|3082196_3082373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470963.1|3082365_3082707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470964.1|3082703_3083030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470965.1|3083067_3083610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470966.1|3083602_3083740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470967.1|3084207_3085383_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	35.3	2.9e-57
WP_014470968.1|3085502_3085718_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014470970.1|3086033_3086372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470972.1|3086967_3087195_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014470973.1|3087254_3087437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470974.1|3087467_3088193_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	31.9	6.6e-20
WP_014470975.1|3088352_3089384_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.3	6.7e-34
WP_013353444.1|3089614_3089977_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.9	4.0e-18
WP_014470976.1|3090051_3090906_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014470977.1|3091026_3092247_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.5	1.7e-12
WP_014470978.1|3092381_3092618_-	YuzB family protein	NA	NA	NA	NA	NA
WP_014470979.1|3092884_3093952_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014470980.1|3093989_3094316_-	YuzD family protein	NA	NA	NA	NA	NA
WP_171866182.1|3094395_3094731_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	43.5	2.9e-10
WP_038463286.1|3094763_3096746_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_013353450.1|3096847_3097777_-	homoserine kinase	NA	NA	NA	NA	NA
WP_014470982.1|3097773_3098832_-	threonine synthase	NA	NA	NA	NA	NA
3098056:3098071	attR	TTTTCCGGCTGATTCT	NA	NA	NA	NA
WP_014472655.1|3098831_3100133_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_014472214.1|3100332_3101349_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
