The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	97163	152905	2932225	transposase	Burkholderia_phage(33.33%)	49	NA	NA
WP_004872674.1|97163_98210_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.1	8.7e-13
WP_014002076.1|98389_99514_-	Fic family protein	NA	NA	NA	NA	NA
WP_004869991.1|100326_101781_+	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_041635726.1|101811_102474_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_004870006.1|102466_105859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002078.1|105855_107049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004870010.1|107111_107375_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004870013.1|107386_107728_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004870015.1|108287_109595_-	ParB/RepB/Spo0J family partition protein	NA	A0A160DCL1	Gordonia_phage	35.1	3.7e-05
WP_004870017.1|109587_110367_-	ParA family protein	NA	NA	NA	NA	NA
WP_004870019.1|110363_110795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038472437.1|110887_111433_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_014002082.1|111471_111756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038471395.1|111762_111987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038471398.1|111983_112259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004870028.1|112258_113458_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_014002084.1|113867_114188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169737325.1|115485_116430_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.7	3.2e-75
WP_038472440.1|116935_117391_-	DsrE family protein	NA	NA	NA	NA	NA
WP_004873230.1|117451_118813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038471414.1|118998_119478_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_141738303.1|119571_120042_-	DsrE family protein	NA	NA	NA	NA	NA
WP_014002087.1|120195_120750_-	FUSC family protein	NA	NA	NA	NA	NA
WP_004870041.1|120786_121692_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_077272838.1|121947_122244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038472443.1|122224_122566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002092.1|123789_124380_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	43.8	2.4e-12
WP_148262181.1|124607_124952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262236.1|125242_125902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002096.1|126142_126472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141738383.1|126557_127205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004870056.1|127310_127754_+	DedA family protein	NA	NA	NA	NA	NA
WP_187288659.1|128556_129300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002102.1|130408_131368_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	51.1	1.4e-81
WP_014002103.1|131377_133018_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_169737323.1|133271_134291_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014002105.1|134848_135805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004870074.1|136275_137121_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	48.5	1.3e-64
WP_004870079.1|140148_140847_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014002108.1|141637_141730_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_014002109.1|141726_143487_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_014002110.1|143491_145552_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.9	1.4e-35
WP_004870087.1|145562_146165_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_014002111.1|146411_147593_+	porin	NA	NA	NA	NA	NA
WP_014002112.1|147683_147878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077272696.1|147923_148826_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.5	8.5e-33
WP_004870098.1|149224_149674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004870103.1|150292_151870_+	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_169737325.1|151960_152905_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.7	3.2e-75
>prophage 2
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	158044	211416	2932225	integrase,transposase	Lysinibacillus_phage(18.18%)	47	193113:193172	221459:222760
WP_014002119.1|158044_159100_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014002120.1|159380_159866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049784599.1|159868_160579_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_014002122.1|160575_161235_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_041635730.1|161926_162685_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	30.2	3.3e-14
WP_041635731.1|162735_163326_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041635732.1|163418_163883_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014002127.1|164051_164723_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_014002128.1|164734_165907_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_014002129.1|165903_166824_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_014002130.1|166820_168137_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_014002131.1|168133_168406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288640.1|168431_168758_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_041635734.1|168754_168979_-	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_041635735.1|169173_171198_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	31.1	1.1e-32
WP_148262184.1|171194_171518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049784600.1|171514_172081_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_014002135.1|172102_174457_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_014002136.1|174678_175734_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014002137.1|175887_177282_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_012387019.1|177813_179028_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014002140.1|180940_181840_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_049784601.1|183082_183352_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_148262237.1|183882_184902_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041636623.1|184961_185132_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_187288641.1|185710_186316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002147.1|186370_187342_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014002148.1|187343_189491_+	cbb3-type cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_014002149.1|189557_190196_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_014002150.1|190375_190564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288642.1|190585_191509_+	cytochrome C oxidase assembly protein	NA	NA	NA	NA	NA
WP_014002151.1|191524_192469_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
193113:193172	attL	GGCTCTTCGTCAGATTGAGTGGGTAGGGGGTAGAATGCTGTGGAGCGGTCGTGCCCTGAA	NA	NA	NA	NA
WP_012387019.1|193185_194400_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_041636625.1|194609_195317_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_014002153.1|195371_197417_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	32.7	1.9e-16
WP_187288643.1|197800_197965_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014002154.1|198187_198598_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.7	2.1e-07
WP_014002155.1|198594_199080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635738.1|199082_201062_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_014002157.1|201061_201661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002158.1|201657_202404_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014002159.1|202513_203527_+	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.2	5.1e-10
WP_014002160.1|203604_204570_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	6.5e-31
WP_014002161.1|204566_205799_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	1.2e-13
WP_014002162.1|205875_207948_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014002163.1|208458_209622_-|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	40.1	5.8e-50
WP_014002164.1|209892_211416_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	29.9	6.3e-28
221459:222760	attR	TTCAGGGCACGACCGCTCCACAGCATTCTACCCCCTACCCACTCAATCTGACGAAGAGCCGAATCCGTGAGGATGATGGCCGCCTGTCGAACGCTTTCGGGGAGTTGTCGATTCAAGTACGCCACCCGTGCCGGCGGATGGGTATCGGGATAGCGGATATGGGAGAGATCATGAAAAGCGATCACGGTGGGCACGCGACTCTTGGGAGCGCCGTAATTGGGTCCGAAAACAACGTCGACAGGATTTTTCCGAAGGTGCATATGAAATACGGCATTGTCCAACAAATGGCGAAGTTCTCGACCCTTTGGGGTGTGCTCCTTGAGCCAGCGCATCACCCCCTGGCTGGACGACCGAATGGCCGGAGGCATGATGTCCGGCCAGCGGGTTACCCAGGCTGTGCCATAGAAGTAGAACAAGCCGACCCCCTGGTCCTGCTCCCAGCGATGGGTGATTTCCCAGGTATAGCGGCCGATCCCGGATCGGGGCGGGCGCATCGAGTTGGATTCGATGGCAATTTTCAGCATATTTGCTTCCTCGCCTACCTAGGAGGCTACTGAAAAATCCTACAAAATCTCATGCGATTCGTGGATTCATGGAAAAATTTCCTGAAATCGGGCTCTGAGTGAGCCCATCTTGCAGTTTTCATGGCTTTTCGCGGCCATTTTTCGGATTCCGGACGCACGAATCCCATCAAACCACCCCCAGTCGCGCCATCCGCACGAGGTTGTACGCGGTGGCCGCCAGGGAGAAGTGTAGCCTCACCCGATCCAATCCACGGAGTCGGGTTTTGCGCATTCCGCCCCCGGTCTTCATCCAGCCGAAGATGGACTCGATCCGACGACGGACGTGGATGCTCATCGCATAACCGGCGTGGCGGGTGGTGCGCCCGTCGATGGCAGATCCTTTGCGCTTACGAGCAACATGCGGCGCCCCATTCCGATACCGCAGATCCTGGACAAAGCCGTGGCGATCGTAACCCTTGTCGGCACCGAGGGTGATGCGCTGGTTCCCGTCCAGATCGTCCACGAGTTGGACGGCTGCTTCGACTTTCGCCGTACCGTCGGCGGTGGTGACCTGCTCGGCGGCAATGCGTCCGTGGCGATTGTCCATGAGCACATGCCCAAGATAGGCCAAACGAGAAGCTTCGCCGGGCGCCTTTTTGTAGAGCCGGGCATCGGGATCAGTTATGGAGGCGTGGGTTTCATTACTGCGGGTCTGGCCACGGAAATCGGAACCATCGCCCTCTCGGTCCTCAGGATCTTTCGGCTGGAAGGACTTCTGCGAAGCCCAAGCTTCCAGCAG	NA	NA	NA	NA
>prophage 3
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	216466	224636	2932225	transposase	Synechococcus_phage(33.33%)	11	NA	NA
WP_014002168.1|216466_217498_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3F7G9	Synechococcus_phage	56.6	2.1e-99
WP_041636628.1|217494_218379_-	GDP-mannose 4,6-dehydratase	NA	G8DDL6	Micromonas_pusilla_virus	31.5	2.0e-18
WP_014002170.1|218375_219527_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014002171.1|219526_220123_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012387019.1|220230_221445_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014002172.1|221448_221982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002173.1|222148_223144_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_148262187.1|223252_223408_-	GDP-mannose 4,6-dehydratase	NA	M1HKY0	Acanthocystis_turfacea_Chlorella_virus	55.6	3.4e-06
WP_187288644.1|223404_223893_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3IB21	Synechococcus_phage	38.3	9.9e-20
WP_014002174.1|223956_224253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148262189.1|224228_224636_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.4	4.9e-12
>prophage 4
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	477295	522293	2932225	transposase,protease,tRNA	Lysinibacillus_phage(21.43%)	41	NA	NA
WP_187288663.1|477295_478558_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004870606.1|478554_479652_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	39.7	7.5e-07
WP_004870608.1|479651_480524_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004870609.1|480507_481320_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_014002299.1|481337_483311_+	dynamin family protein	NA	NA	NA	NA	NA
WP_004870613.1|483316_483568_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	61.2	3.0e-20
WP_004870615.1|483605_484136_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	2.2e-25
WP_081254316.1|484132_484696_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_004870620.1|484796_486008_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	32.3	2.6e-13
WP_014002302.1|486004_486673_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	39.3	1.2e-31
WP_004870624.1|486669_487575_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004870626.1|487713_488571_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.9	2.5e-42
WP_004870628.1|488567_488900_+	DsrE family protein	NA	NA	NA	NA	NA
WP_014002303.1|489064_490144_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014002304.1|490216_491542_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.1	9.2e-44
WP_187288664.1|491544_492075_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_014002306.1|492086_493040_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	36.2	7.2e-14
WP_004870639.1|493046_493736_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_014002307.1|493732_494605_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014002308.1|494801_495716_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014002309.1|495773_496508_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014002310.1|496520_496754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002311.1|497224_498418_+	porin	NA	NA	NA	NA	NA
WP_014002312.1|498689_501425_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_014002313.1|501503_502610_-	cellulase	NA	NA	NA	NA	NA
WP_014002314.1|502644_503370_-	cellulose biosynthesis protein BcsS	NA	NA	NA	NA	NA
WP_014002315.1|503386_505924_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_014002316.1|505920_506604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002317.1|506619_507495_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012387019.1|507528_508743_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_081254391.1|508887_510573_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I518	Acanthocystis_turfacea_Chlorella_virus	27.8	2.2e-21
WP_014002319.1|510836_511844_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_014002320.1|511918_512638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002321.1|512717_514556_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	3.5e-57
WP_014002322.1|514715_514919_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	60.6	2.1e-16
WP_103415101.1|515313_516327_+	transporter	NA	NA	NA	NA	NA
WP_187288646.1|517709_517856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012387019.1|518429_519644_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014002330.1|519929_520589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002331.1|520650_521031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012387019.1|521078_522293_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
>prophage 5
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	583714	596252	2932225		Staphylococcus_phage(37.5%)	13	NA	NA
WP_014002384.1|583714_585220_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	23.1	4.0e-11
WP_004870713.1|585406_586276_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.4	5.0e-14
WP_004870714.1|586384_586939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002386.1|587981_589226_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	3.7e-95
WP_038472552.1|589228_589720_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_014002387.1|589730_590840_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.6	5.5e-42
WP_038471582.1|590812_591469_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	34.6	3.1e-16
WP_004870720.1|591465_592599_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	35.7	1.9e-53
WP_004870721.1|592591_593059_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.6	1.2e-33
WP_187288648.1|593062_593527_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_103415105.1|593635_594199_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004867332.1|594219_594552_-	LapA family protein	NA	NA	NA	NA	NA
WP_014002389.1|594566_596252_-	2-polyprenylphenol 6-hydroxylase	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	27.9	3.8e-34
>prophage 6
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	742924	789118	2932225	integrase,transposase	uncultured_virus(20.0%)	43	742597:742618	793198:793219
742597:742618	attL	TCGAATCCCTCTCTCTCCGCCA	NA	NA	NA	NA
WP_187288650.1|742924_744175_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_187288651.1|744342_746421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002449.1|748017_748374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049784620.1|748355_748589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041635926.1|748804_750322_-	Fic family protein	NA	NA	NA	NA	NA
WP_014002454.1|750523_751777_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_014002453.1|751776_752061_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014002455.1|752197_752554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635930.1|753144_753444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002457.1|754832_755453_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_014002458.1|755710_755965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635939.1|756007_756475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041635942.1|756508_756976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187288652.1|757008_757161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004867663.1|757901_758153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002462.1|758285_759599_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014002463.1|759601_760396_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014002464.1|760392_760590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002465.1|760805_761270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002466.1|761653_762058_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	75.8	4.0e-51
WP_049784623.1|762195_763158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002467.1|763282_763633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002468.1|763802_764207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002469.1|764456_765734_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_014002470.1|765723_766065_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014002471.1|766231_766681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002472.1|766910_767918_+	MarR family EPS-associated transcriptional regulator	NA	NA	NA	NA	NA
WP_041635946.1|768079_768487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635948.1|768503_769382_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_049784625.1|769378_771853_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_041635951.1|771859_772648_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041635953.1|772648_773368_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014002478.1|774840_775896_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041635955.1|775895_776099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041635958.1|776118_777153_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_082177278.1|777728_778556_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012387019.1|778603_779818_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_082177279.1|779848_780361_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	33.5	1.4e-19
WP_014002483.1|780920_781235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002484.1|781236_781479_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_014002485.1|781685_785942_+	glycosyltransferase	NA	A0A0E3FKP5	Synechococcus_phage	39.4	6.5e-06
WP_014002486.1|785958_787809_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	29.2	5.1e-32
WP_014002487.1|788062_789118_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
793198:793219	attR	TCGAATCCCTCTCTCTCCGCCA	NA	NA	NA	NA
>prophage 7
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	984390	1073914	2932225	integrase,transposase	Lysinibacillus_phage(25.0%)	85	1007979:1007993	1029912:1029926
WP_012387019.1|984390_985605_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_004871417.1|985892_986165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004871418.1|986182_986746_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_103415006.1|986820_987360_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004871422.1|987681_989910_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.6	4.1e-60
WP_004871423.1|989916_990693_-	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_004871425.1|990705_992094_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_038471696.1|992297_993353_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_004871429.1|993349_994105_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004871430.1|994089_994764_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_004871432.1|994756_995794_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.7	2.8e-72
WP_004871436.1|995963_996581_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_004871438.1|996818_997523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004871440.1|997519_998401_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_169737310.1|998518_998959_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_004871445.1|998939_999125_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_004871447.1|999152_1000178_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004871450.1|1000174_1001119_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_004871452.1|1001155_1002094_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_041636811.1|1002102_1002840_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004871455.1|1002933_1003182_+	acyl carrier protein	NA	A0A1S5R3K8	Pseudomonas_phage	43.0	3.2e-06
WP_004871456.1|1003221_1004463_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_158007121.1|1004470_1005346_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_004871466.1|1005333_1006341_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_004871467.1|1006333_1006987_+	dTMP kinase	NA	W8D0J5	Erwinia_phage	29.6	2.0e-15
WP_014002569.1|1006979_1007990_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_014002570.1|1007973_1008327_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
1007979:1007993	attL	TGGCGGCAGTGAGAG	NA	NA	NA	NA
WP_014002571.1|1008591_1009602_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	41.3	3.8e-66
WP_014002572.1|1009836_1012197_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_041636052.1|1012256_1012478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004868469.1|1012596_1013859_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	45.3	1.4e-89
WP_014002573.1|1013903_1015793_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014002574.1|1015807_1016131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041636059.1|1016197_1019416_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_014002576.1|1019412_1019985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041636062.1|1019977_1020220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002536.1|1020459_1021677_+|transposase	ISL3-like element ISAtc2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.2	6.4e-07
WP_012387019.1|1021769_1022984_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014002577.1|1022941_1025206_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_014002578.1|1025202_1026114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262191.1|1026110_1026614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002579.1|1027149_1028937_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014002580.1|1030210_1030996_+	hypothetical protein	NA	NA	NA	NA	NA
1029912:1029926	attR	TGGCGGCAGTGAGAG	NA	NA	NA	NA
WP_014002136.1|1031388_1032444_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081254375.1|1032609_1033521_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041636067.1|1033676_1035371_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_041636069.1|1035367_1037773_+	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
WP_014002584.1|1037859_1038906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636073.1|1038943_1039816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636817.1|1039902_1041588_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_014002588.1|1042155_1043142_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	31.8	2.8e-37
WP_014002589.1|1043162_1043990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636821.1|1044699_1045089_+	DUF2784 domain-containing protein	NA	NA	NA	NA	NA
WP_014002140.1|1045450_1046350_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_077272688.1|1046411_1047098_-	phosphoribosyl transferase	NA	NA	NA	NA	NA
WP_041636076.1|1047361_1047703_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_014002594.1|1048471_1049527_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049784635.1|1049689_1050268_-	AmmeMemoRadiSam system protein A	NA	NA	NA	NA	NA
WP_014002596.1|1050264_1051065_-	AmmeMemoRadiSam system protein B	NA	NA	NA	NA	NA
WP_014002597.1|1051191_1052340_+	AmmeMemoRadiSam system radical SAM enzyme	NA	NA	NA	NA	NA
WP_081254308.1|1052485_1052704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077272797.1|1053067_1053592_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_014002598.1|1053647_1055750_-	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
WP_041636844.1|1055746_1056205_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014002599.1|1056213_1056870_-	organomercurial lyase	NA	NA	NA	NA	NA
WP_014002600.1|1056886_1058551_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.7	5.8e-43
WP_014002601.1|1058672_1059017_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_041636087.1|1059056_1059482_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_082177288.1|1059934_1060408_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014002938.1|1060339_1060657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002603.1|1060640_1062203_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	30.3	1.3e-44
WP_148262189.1|1062211_1062619_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.4	4.9e-12
WP_004867952.1|1062594_1062891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002165.1|1063146_1063932_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.6	1.7e-32
WP_014002164.1|1063940_1065464_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	29.9	6.3e-28
WP_014002604.1|1065695_1066400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103415014.1|1066638_1068537_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_064306246.1|1068538_1069168_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_014002606.1|1069169_1069520_-	DsrE family protein	NA	NA	NA	NA	NA
WP_141738761.1|1069516_1069864_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_014002607.1|1069860_1070457_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014002608.1|1070453_1071167_-	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014002609.1|1071159_1072044_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_014002610.1|1072148_1072436_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_012387019.1|1072699_1073914_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
>prophage 8
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	1101151	1148698	2932225	integrase,transposase	Lysinibacillus_phage(22.22%)	42	1100599:1100621	1156357:1156379
1100599:1100621	attL	ACTCTAGCCAGACTCTAGCCAGA	NA	NA	NA	NA
WP_103415111.1|1101151_1102171_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082177451.1|1102192_1102426_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_014002464.1|1103451_1103649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002463.1|1103645_1104440_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014002462.1|1104442_1105756_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_004867663.1|1105888_1106140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002631.1|1106497_1107409_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_014002632.1|1107513_1108419_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_041636112.1|1109004_1109289_-	YrhK family protein	NA	NA	NA	NA	NA
WP_014002634.1|1110641_1111646_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.8	2.2e-05
WP_014002635.1|1111829_1112162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012387019.1|1112582_1113797_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014002637.1|1113798_1114032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636118.1|1114012_1116418_+	DEAD/DEAH box helicase family protein	NA	Q8QNK6	Ectocarpus_siliculosus_virus	31.0	1.1e-29
WP_187288655.1|1116857_1117070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262194.1|1117147_1117495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002639.1|1117496_1117796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002640.1|1117886_1119131_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_041636126.1|1119300_1119567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187288656.1|1119864_1120197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636129.1|1120286_1120682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002645.1|1120678_1122862_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	33.1	1.5e-51
WP_014002646.1|1122934_1123504_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_081254399.1|1123509_1123869_-	CbiX/SirB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049784639.1|1123865_1124657_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_041636133.1|1124670_1125687_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_014002648.1|1125683_1128446_-	nitrate reductase	NA	NA	NA	NA	NA
WP_041636914.1|1128442_1128763_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_014002650.1|1128767_1131215_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014002651.1|1131435_1132680_-	alginate export family protein	NA	NA	NA	NA	NA
WP_014002652.1|1132750_1134151_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_014002653.1|1134442_1135612_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082177292.1|1135820_1136384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187288667.1|1136510_1137455_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	48.7	4.7e-74
WP_014002656.1|1138048_1138396_+	hypothetical protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.8	2.9e-05
WP_014002657.1|1138476_1140633_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	25.3	1.2e-27
WP_014002658.1|1140629_1141265_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_148262195.1|1141261_1142605_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041636141.1|1142601_1143495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002536.1|1144577_1145795_+|transposase	ISL3-like element ISAtc2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.2	6.4e-07
WP_148262196.1|1146030_1146804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002164.1|1147174_1148698_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	29.9	6.3e-28
1156357:1156379	attR	ACTCTAGCCAGACTCTAGCCAGA	NA	NA	NA	NA
>prophage 9
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	1568705	1673538	2932225	transposase	Lysinibacillus_phage(20.0%)	83	NA	NA
WP_014002536.1|1568705_1569923_+|transposase	ISL3-like element ISAtc2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.2	6.4e-07
WP_148262207.1|1569942_1570167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004872038.1|1570355_1572323_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	3.2e-93
WP_004872040.1|1572392_1574918_-	alpha-glucan family phosphorylase	NA	NA	NA	NA	NA
WP_004872041.1|1575122_1576640_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_014002911.1|1576639_1577563_-	aldolase	NA	NA	NA	NA	NA
WP_004872044.1|1577549_1578953_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004872046.1|1578996_1579965_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_014002912.1|1579957_1580881_-	bifunctional enoyl-CoA hydratase/phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_014002916.1|1582438_1583374_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004872054.1|1583392_1584325_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_014002917.1|1584350_1585298_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_014002918.1|1585309_1586251_+	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_004872060.1|1586261_1587179_+	magnesium transporter	NA	NA	NA	NA	NA
WP_004872061.1|1587200_1588394_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004872063.1|1588653_1589361_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_103415044.1|1589424_1589634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002921.1|1590806_1591103_+	addiction module antitoxin RelB	NA	A0A141GEX6	Brucella_phage	60.0	9.6e-26
WP_004872065.1|1591108_1591402_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.3	1.4e-16
WP_103415125.1|1591637_1592597_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_014002923.1|1592920_1594546_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_049784663.1|1594593_1594980_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_012387019.1|1595011_1596226_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_004872071.1|1596498_1596999_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_014002926.1|1597008_1597869_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_004872078.1|1597869_1598793_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_014002927.1|1598877_1600890_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014002928.1|1600955_1602269_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_049784742.1|1602372_1602996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041637310.1|1603318_1603885_+	acyltransferase	NA	NA	NA	NA	NA
WP_014002931.1|1603924_1605274_+	acyltransferase	NA	NA	NA	NA	NA
WP_012387019.1|1605321_1606536_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014002932.1|1606569_1607319_+	acyltransferase	NA	NA	NA	NA	NA
WP_014002165.1|1607674_1608460_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.6	1.7e-32
WP_014002164.1|1608468_1609992_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	29.9	6.3e-28
WP_187288670.1|1611955_1612900_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.0	3.2e-75
WP_014002536.1|1613022_1614240_+|transposase	ISL3-like element ISAtc2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	23.2	6.4e-07
WP_004867952.1|1616148_1616445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148262189.1|1616420_1616828_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.4	4.9e-12
WP_014002937.1|1616836_1618399_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	30.3	1.3e-44
WP_014002938.1|1618382_1618700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002939.1|1618750_1619434_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.2	9.0e-35
WP_004872102.1|1620175_1621468_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_014002941.1|1621546_1622707_-	TDT family transporter	NA	NA	NA	NA	NA
WP_004872104.1|1623665_1624745_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014002943.1|1624793_1626248_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014002944.1|1626523_1627255_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_070118376.1|1629050_1629389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141738532.1|1629750_1630770_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014002948.1|1631678_1634795_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_004868233.1|1634819_1635902_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014003628.1|1638882_1639599_+	response regulator	NA	W8CYM9	Bacillus_phage	33.5	1.6e-29
WP_103415127.1|1639628_1640915_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_148262209.1|1641013_1642567_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_014002953.1|1642580_1643666_+	quinol oxidase	NA	NA	NA	NA	NA
WP_004872674.1|1643788_1644835_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	25.1	8.7e-13
WP_014002954.1|1645057_1645471_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_014002539.1|1646411_1647368_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	49.7	3.9e-76
WP_187288600.1|1647418_1648249_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_014002957.1|1648555_1649170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004872144.1|1649580_1651047_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014002958.1|1651124_1652219_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004872149.1|1652358_1652685_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_014002959.1|1652815_1655680_+	molybdopterin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_004872152.1|1655740_1656433_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	39.3	7.5e-29
WP_004872154.1|1656448_1657387_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_014002960.1|1657414_1658122_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_038471818.1|1658114_1658432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004872160.1|1658479_1658809_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_004872163.1|1658828_1659155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004872164.1|1659214_1659541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004872166.1|1659537_1660536_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_004868279.1|1660633_1660843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004867952.1|1661165_1661462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148262189.1|1661437_1661845_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.4	4.9e-12
WP_014002963.1|1661853_1663416_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	30.3	1.3e-44
WP_014002938.1|1663399_1663717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002967.1|1665936_1666926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002968.1|1668202_1668565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004872175.1|1668707_1669121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014002140.1|1669272_1670172_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014002938.1|1671674_1671992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014002937.1|1671975_1673538_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	30.3	1.3e-44
>prophage 11
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	2026626	2083144	2932225	protease,integrase,transposase	Lysinibacillus_phage(30.0%)	55	2020761:2020777	2064638:2064654
2020761:2020777	attL	CGAGCACCAGCACTCCC	NA	NA	NA	NA
WP_014003141.1|2026626_2027835_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	28.8	1.5e-16
WP_014003142.1|2027827_2028085_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_014003143.1|2028088_2028358_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_041636421.1|2028460_2029342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064306414.1|2029438_2029666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014003145.1|2029773_2030616_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_014003146.1|2030617_2031922_+	DNA primase family protein	NA	F8J1F0	Lactobacillus_phage	27.1	2.9e-34
WP_041636424.1|2031918_2032404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003148.1|2032591_2032987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148262215.1|2033096_2033624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003149.1|2033616_2034252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003150.1|2034630_2038305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003151.1|2038301_2038568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003152.1|2038603_2039170_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_041636428.1|2039405_2039630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003153.1|2039622_2039961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003154.1|2039962_2040280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064306413.1|2040493_2040916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003156.1|2041322_2042657_+|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	25.9	1.6e-27
WP_014003159.1|2044756_2045449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003160.1|2045608_2045923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262216.1|2045909_2046674_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_014003162.1|2046606_2047296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049784680.1|2047351_2048164_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_041637572.1|2048250_2049123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012387019.1|2049905_2051120_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014003165.1|2051293_2053684_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_041636436.1|2053837_2054374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003167.1|2054405_2054876_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_049784681.1|2054875_2055406_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_148262217.1|2056070_2056541_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014003169.1|2056540_2057275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003170.1|2057684_2058116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003171.1|2058112_2058832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187288617.1|2058884_2059718_-	ATP-binding protein	NA	A0A059WFK9	Vibrio_phage	36.3	4.0e-37
WP_187288619.1|2059726_2061355_-	hypothetical protein	NA	H2BD69	Pseudomonas_phage	45.7	6.3e-18
WP_014003174.1|2061629_2061911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003175.1|2061910_2062924_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_014003176.1|2063118_2065353_+	TraI domain-containing protein	NA	NA	NA	NA	NA
2064638:2064654	attR	CGAGCACCAGCACTCCC	NA	NA	NA	NA
WP_070114032.1|2065362_2067231_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_014003178.1|2067352_2067847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003179.1|2067847_2068480_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_082177366.1|2068510_2069482_-	antA/AntB antirepressor family protein	NA	Q7Y5W2	Haemophilus_phage	57.4	5.4e-25
WP_082177369.1|2069478_2070597_-	Helicase associated domain protein	NA	A0A076YNT4	Mesorhizobium_phage	39.1	8.7e-27
WP_041636438.1|2070586_2071294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041636441.1|2071769_2073299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636443.1|2073344_2073941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003184.1|2074194_2075235_+	CpaF family protein	NA	NA	NA	NA	NA
WP_014003185.1|2075249_2076332_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_014003186.1|2076331_2076664_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_014003187.1|2076657_2079021_+	type IV secretory pathway VirB4 components-like protein	NA	NA	NA	NA	NA
WP_012387019.1|2079009_2080224_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014003188.1|2080443_2081358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636445.1|2081360_2081882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012387019.1|2081929_2083144_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
>prophage 12
NC_015850	Acidithiobacillus caldus SM-1, complete sequence	2932225	2105640	2144630	2932225	transposase	Lysinibacillus_phage(33.33%)	46	NA	NA
WP_012387019.1|2105640_2106855_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014003211.1|2107038_2107809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003212.1|2107822_2108968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041636470.1|2108967_2110155_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_014003214.1|2110154_2111087_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_014003215.1|2111195_2111825_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041636472.1|2111821_2112037_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014003218.1|2112046_2112367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012387019.1|2112438_2113653_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_041636474.1|2113656_2113953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262221.1|2113963_2114758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262222.1|2114763_2114964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041636480.1|2114963_2115557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003221.1|2115546_2115909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003222.1|2115901_2116942_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_148262223.1|2118333_2118597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041636482.1|2118644_2118866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003226.1|2119050_2119317_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_041636484.1|2119303_2119585_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_014003228.1|2119691_2120918_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	30.4	4.7e-42
WP_148262224.1|2121609_2121774_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082177438.1|2121736_2122039_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_187288623.1|2122227_2122365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003230.1|2122414_2123371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003231.1|2123398_2124211_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_041636489.1|2124507_2124966_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_148262246.1|2125607_2127098_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2L1IV91	Escherichia_phage	33.5	1.1e-50
WP_049784684.1|2127108_2127735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003237.1|2129103_2129655_+	BsuBIPstI restriction endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_014003238.1|2129776_2130100_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049784685.1|2130523_2131537_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_014002165.1|2131442_2132228_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.6	1.7e-32
WP_014002164.1|2132236_2133760_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	29.9	6.3e-28
WP_148262247.1|2134216_2134978_+	ATP-binding domain-containing protein	NA	E3T5J8	Cafeteria_roenbergensis_virus	32.7	4.7e-08
WP_014003240.1|2135161_2135401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003241.1|2135409_2136792_+	conjugal transfer protein Dtr system	NA	NA	NA	NA	NA
WP_014003242.1|2136793_2137537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148262225.1|2137791_2137983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148262226.1|2138058_2138466_-	hypothetical protein	NA	A0A067XQV3	Caulobacter_phage	46.4	7.5e-29
WP_014003246.1|2138776_2139322_-	lytic transglycosylase domain-containing protein	NA	U5PVY0	Bacillus_phage	37.6	3.1e-14
WP_158007158.1|2139387_2139561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003248.1|2139656_2140547_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_041636497.1|2140661_2141450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003251.1|2141812_2142109_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	61.9	7.8e-28
WP_012387019.1|2142164_2143379_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
WP_014003049.1|2143412_2144630_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.6	2.6e-08
>prophage 1
NC_015851	Acidithiobacillus caldus SM-1 megaplasmid, complete sequence	251782	11681	59425	251782	transposase,integrase,protease	Acinetobacter_phage(21.43%)	44	9616:9675	39817:40356
9616:9675	attL	TATTAACCAGGCCCTTAAATATCTAACATCGCGTAGCGTGCTACGGGGTGGTGGAAATAG	NA	NA	NA	NA
WP_082177477.1|11681_13217_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.8	3.8e-134
WP_041638071.1|15919_18253_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014003648.1|18312_19296_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014003649.1|19742_21989_+	xanthine dehydrogenase family protein	NA	A0A0P0I429	Acinetobacter_phage	29.0	2.2e-69
WP_041638072.1|21988_22444_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	31.9	7.6e-14
WP_014003651.1|22440_23292_+	xanthine dehydrogenase family protein subunit M	NA	A0A0P0IVM8	Acinetobacter_phage	28.2	3.9e-19
WP_082177480.1|23310_23889_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_014003653.1|23898_24981_+	ring-opening amidohydrolase	NA	NA	NA	NA	NA
WP_014003654.1|24980_25940_+	XdhC family protein	NA	NA	NA	NA	NA
WP_041638073.1|25914_26112_+	DUF4089 domain-containing protein	NA	NA	NA	NA	NA
WP_041638170.1|26133_27507_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_014003657.1|27518_27905_+	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_081254407.1|27908_28520_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_041638074.1|28516_30133_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_014003659.1|30124_31045_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148262262.1|31215_32235_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	28.0	3.0e-18
WP_187288691.1|32591_32714_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014003661.1|32859_33324_-|protease	SOS-response repressor and protease LexA	protease	A0A218MND2	uncultured_virus	39.5	3.7e-16
WP_148262249.1|33347_33653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148262250.1|33621_33912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003663.1|34179_35112_+|integrase	tyrosine-type recombinase/integrase	integrase	A7XX23	Thermus_virus	28.9	7.7e-13
WP_014003664.1|35704_35980_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	46.7	2.7e-14
WP_014003665.1|35991_36354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003666.1|36444_36756_+	integration host factor subunit alpha	NA	G8GWC6	Rhodobacter_phage	33.3	2.0e-05
WP_014003667.1|36984_37275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003668.1|37271_37556_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_103415156.1|37832_38429_-	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	40.6	1.0e-10
WP_014003670.1|38425_38659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003673.1|39446_39779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003674.1|39830_40877_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	33.2	1.4e-39
39817:40356	attR	TATTAACCAGGCCCTTAAATATCTAACATCGCGTAGCGTGCTACGGGGTGGTGGAAATAGCGCGCGACTTTCTCGGGCAGTTGGCGTAGCCCGTTCATGAAAGTGGTTGCCTTCTCCAGCAAGCTTTGGGTATCTGTGCTCATGGGGCCCGTACGCAGAGCGGTTTTGAAATCGCGATTGAGATACTCGTCGGGGTTGGACTCTGGCGCATAGGGCGGCAGAAATACGAGCTCAATGCGGTCCTGTTTGTCGGCCAGCCACGCGCTTACCACCTTGGCGTGATGTACCCGCAGGTTGTCCACTACCAGGAAGACCTTCCGCGGCGCGCCGGTGATCAGCTTTTCCAGAAAGGCGATAAAACGCTCCGCATGGATACTGCCCTCCACGATCTCGAAGGCGATCTCTCCGCGCGGGGAAATTGCCGAAATCATCGACAGGGTGGTCCAGCGTGCCGGATGCTCAAGGATGGGGGTCTGCCCCTTGGGGGCATATCCCCGGACCCAGTGGGCATCCTCTTTGACGGCGGTTTCGTCGCCCCAG	NA	NA	NA	NA
WP_014003675.1|40927_42262_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_148262263.1|42692_43280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003677.1|43473_45513_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	23.8	1.5e-29
WP_014003678.1|45679_46282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041638076.1|46412_47555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103415180.1|47566_49786_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_014003681.1|49846_50158_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_103415159.1|50201_50618_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014003683.1|50796_51630_+	hypothetical protein	NA	A0A2I6PCS6	Staphylococcus_phage	35.9	6.3e-06
WP_014003684.1|51821_52103_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014003686.1|52475_53339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003687.1|53339_53621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081254359.1|54584_57308_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.8	2.0e-21
WP_148262264.1|58876_59425_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_015851	Acidithiobacillus caldus SM-1 megaplasmid, complete sequence	251782	150987	189001	251782	transposase,integrase	uncultured_Mediterranean_phage(15.38%)	29	145517:145531	156763:156777
145517:145531	attL	TCGAGCCAGTTCTCC	NA	NA	NA	NA
WP_014003781.1|150987_151911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	28.0	4.2e-11
WP_041638116.1|151936_152260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103415184.1|153066_154587_-|transposase	transposase	transposase	A0A0H3UZK2	Geobacillus_virus	32.4	3.0e-62
WP_049784773.1|154748_155048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014003784.1|155191_160486_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.7	2.9e-56
156763:156777	attR	GGAGAACTGGCTCGA	NA	NA	NA	NA
WP_014002165.1|160783_161569_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.0	1.5e-30
WP_014002164.1|161577_163101_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.5	1.8e-46
WP_009566302.1|165924_166146_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014003786.1|166145_166559_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_148262257.1|166513_170509_+	N-6 DNA methylase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.2	8.1e-43
WP_014003789.1|170660_171443_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_148262258.1|171522_171942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187288686.1|172048_172186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003790.1|172383_172632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014003791.1|172641_174405_-	DUF4942 domain-containing protein	NA	I1ZBH6	Salisaeta_icosahedral_phage	29.7	1.1e-07
WP_014003792.1|174408_174696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041638124.1|175237_175513_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	46.7	3.5e-14
WP_014003795.1|175933_176281_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	50.5	1.4e-20
WP_014002983.1|177103_178132_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014003798.1|178918_179578_-	reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_014003799.1|179639_180428_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.8	1.6e-59
WP_049784790.1|180427_181627_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	31.4	2.1e-34
WP_014003801.1|181720_182329_-	elongation factor GreAB	NA	A0A0U4J920	Pseudomonas_phage	43.5	3.2e-23
WP_014003803.1|183579_183723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064306286.1|183989_184529_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_014003805.1|185131_185887_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_014003806.1|185956_186355_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_187288687.1|186558_187803_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_012387019.1|187786_189001_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	26.8	1.8e-09
