The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017540	Klebsiella pneumoniae KCTC 2242, complete sequence	5259571	1037511	1086565	5259571	head,tRNA	Salmonella_phage(23.33%)	73	NA	NA
WP_004191607.1|1037511_1038897_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004223130.1|1038942_1039155_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1039156_1040023_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004223135.1|1041493_1041829_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_014599052.1|1041830_1042049_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_004223138.1|1042045_1042423_-	DUF2591 family protein	NA	A0A1J0GUX1	Halomonas_phage	30.7	2.0e-07
WP_004223140.1|1042419_1042986_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	48.3	9.1e-41
WP_004223143.1|1042982_1043204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223147.1|1043200_1043857_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	1.0e-112
WP_004223150.1|1043853_1044282_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	4.4e-64
WP_004223153.1|1044278_1044959_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	2.3e-123
WP_004223156.1|1044955_1045801_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	9.0e-69
WP_004223159.1|1045816_1046101_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	60.6	3.1e-29
WP_004223161.1|1046191_1046722_-	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	45.3	2.9e-33
WP_004223163.1|1046785_1046992_-	hypothetical protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	1.5e-30
WP_181875105.1|1046984_1047110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223168.1|1047418_1047622_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	2.3e-18
WP_004223171.1|1047657_1048062_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	84.3	1.9e-56
WP_004223174.1|1048058_1048727_-	hypothetical protein	NA	A0A0P0ZCT8	Stx2-converting_phage	87.8	1.7e-99
WP_004223177.1|1048723_1049011_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	95.8	1.5e-47
WP_071820781.1|1049272_1049962_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.2	5.1e-86
WP_004178811.1|1050066_1050300_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_004223188.1|1050339_1050561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032448145.1|1050694_1051423_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_004178817.1|1051419_1052196_+	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
WP_004223202.1|1052195_1052498_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004223205.1|1052494_1052719_+	hypothetical protein	NA	H9C169	Pectobacterium_phage	52.9	5.7e-15
WP_004223208.1|1052715_1053129_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	37.8	1.1e-11
WP_004223213.1|1053357_1053846_+	hypothetical protein	NA	A0A2H4N7C3	Pectobacterium_phage	34.9	1.9e-07
WP_004223219.1|1054201_1054582_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.2	6.0e-65
WP_004223223.1|1054578_1055577_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	76.2	5.9e-35
WP_004223227.1|1055576_1055780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223230.1|1055937_1056534_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_032413853.1|1056539_1056710_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_032448009.1|1056702_1057284_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	47.3	9.3e-41
WP_004223243.1|1057280_1057511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548467.1|1057507_1057648_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001548468.1|1057644_1058334_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	53.2	2.0e-58
WP_004223255.1|1059413_1059734_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.5e-44
WP_014599053.1|1059730_1060234_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	82.0	2.9e-75
WP_004223264.1|1060230_1060581_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.7	2.3e-10
WP_029497274.1|1061310_1061949_+	hypothetical protein	NA	I6S676	Salmonella_phage	75.0	2.1e-94
WP_004223268.1|1061979_1062459_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.8	1.4e-63
WP_004223271.1|1062445_1063924_+	hypothetical protein	NA	G0ZND4	Cronobacter_phage	86.4	2.7e-254
WP_004223274.1|1063993_1064410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223277.1|1064477_1065827_+	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	82.4	1.7e-215
WP_032448010.1|1065786_1066713_+|head	SPP1 gp7 family phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.2	1.5e-162
WP_004223282.1|1066715_1067981_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.7	4.2e-219
WP_004223284.1|1067993_1068443_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	85.2	7.1e-65
WP_004223286.1|1068460_1069537_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.0	2.9e-189
WP_004223289.1|1069546_1069840_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	87.6	3.6e-41
WP_004223291.1|1069906_1070308_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	74.6	4.7e-52
WP_004223294.1|1070307_1070478_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
WP_004223297.1|1070481_1070865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223307.1|1070861_1071224_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	46.7	4.8e-19
WP_004223309.1|1071323_1071866_+	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	46.8	6.9e-38
WP_004223311.1|1071917_1072286_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
WP_032448011.1|1072282_1072666_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	48.8	1.6e-28
WP_004223316.1|1072724_1073489_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.0	1.2e-40
WP_004223319.1|1073557_1074253_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.1e-63
WP_004223321.1|1074447_1074810_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	65.6	3.3e-12
WP_004223324.1|1074922_1075096_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	85.7	5.1e-19
WP_004223327.1|1075085_1075790_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	39.8	2.4e-38
WP_004223330.1|1075859_1076612_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	53.9	1.2e-59
WP_004223331.1|1076705_1076918_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	63.8	2.8e-11
WP_004223334.1|1076992_1077325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223337.1|1077321_1077792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223340.1|1077883_1080457_+	hypothetical protein	NA	F1C5E9	Cronobacter_phage	35.9	3.4e-95
WP_032448012.1|1080498_1080975_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	8.7e-37
WP_004223344.1|1080974_1081445_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	37.0	9.9e-25
WP_004223348.1|1081441_1081837_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	53.6	1.4e-35
WP_004223351.1|1081823_1084295_+	hypothetical protein	NA	F1C5A7	Cronobacter_phage	45.2	6.3e-203
WP_032448013.1|1084381_1086565_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.4	2.8e-82
>prophage 2
NC_017540	Klebsiella pneumoniae KCTC 2242, complete sequence	5259571	1535906	1612305	5259571	terminase,capsid,tRNA,portal,lysis,plate,integrase,protease,tail,head	Salmonella_phage(60.0%)	79	1535150:1535170	1568386:1568406
1535150:1535170	attL	GCTGTCGCCACTTTGTCGCCA	NA	NA	NA	NA
WP_162784327.1|1535906_1536860_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.6	2.0e-93
WP_004223857.1|1537011_1537383_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	6.2e-30
WP_004223864.1|1538443_1539028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223865.1|1539039_1539600_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	44.8	2.0e-40
WP_004223867.1|1539725_1539947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223868.1|1539979_1540489_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
WP_004223870.1|1540496_1540697_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	80.3	1.2e-24
WP_004223879.1|1540660_1541002_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	80.5	1.3e-45
WP_004223882.1|1541069_1541306_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	55.4	8.2e-12
WP_004223883.1|1541305_1541533_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	80.0	7.8e-28
WP_032448014.1|1544530_1546195_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
WP_004223897.1|1546241_1547270_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	6.2e-173
WP_032448015.1|1547269_1549033_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
WP_004223903.1|1549172_1550006_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	2.2e-99
WP_004223906.1|1550022_1551075_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.1	2.1e-171
WP_004174300.1|1551078_1551729_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.6	9.6e-103
WP_004223908.1|1551825_1552290_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	84.4	6.7e-74
WP_002896155.1|1552289_1552493_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004223911.1|1552496_1552712_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	85.9	1.5e-28
WP_004223915.1|1552692_1553202_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	9.5e-82
WP_004223918.1|1553206_1553635_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	5.6e-51
WP_162784326.1|1553609_1553768_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	3.1e-15
WP_004223921.1|1553730_1554162_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_004223923.1|1554154_1554607_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.4	6.5e-50
WP_014599113.1|1554619_1555282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223927.1|1555385_1555958_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
WP_004174325.1|1555954_1556317_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_004223930.1|1556303_1557212_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	3.4e-106
WP_004223933.1|1557204_1557801_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	1.8e-55
WP_004223940.1|1557806_1560032_+	hypothetical protein	NA	K4I5E8	Salmonella_phage	41.3	3.0e-10
WP_004223943.1|1560045_1560321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223945.1|1560490_1561558_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.8	1.2e-38
WP_004223947.1|1561696_1562869_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	5.4e-205
WP_004150986.1|1562878_1563394_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004223950.1|1563446_1563746_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	77.0	1.4e-32
WP_002896220.1|1563760_1563880_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004223954.1|1563872_1566503_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.9	6.8e-115
WP_004223957.1|1566499_1566985_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	5.0e-64
WP_004223960.1|1566981_1568079_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.2	4.5e-169
WP_004223962.1|1568165_1568384_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	66.2	8.3e-19
WP_002896351.1|1570555_1570939_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
1568386:1568406	attR	GCTGTCGCCACTTTGTCGCCA	NA	NA	NA	NA
WP_002896352.1|1570945_1571209_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|1571411_1571699_+	YbjC family protein	NA	NA	NA	NA	NA
WP_004179133.1|1571682_1572405_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_002896363.1|1572519_1573422_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|1573510_1573990_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_004223967.1|1574338_1575451_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|1575614_1576748_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|1576758_1577712_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|1577708_1578554_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|1578611_1579100_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_004223969.1|1579141_1580269_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	2.3e-19
WP_002896380.1|1580347_1581064_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|1581060_1582533_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896384.1|1582619_1583351_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191163.1|1583534_1584203_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896386.1|1584202_1584919_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|1584925_1585657_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004223976.1|1585677_1586406_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	7.9e-29
WP_004223978.1|1586632_1587148_-	lipoprotein	NA	NA	NA	NA	NA
WP_025368307.1|1588025_1589165_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004209681.1|1589196_1590027_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_002896399.1|1590023_1591037_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004223986.1|1591124_1592567_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004176702.1|1592577_1593579_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_004176700.1|1593617_1595336_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_014599114.1|1595487_1595922_+	DoxX family protein	NA	NA	NA	NA	NA
WP_004147771.1|1596133_1597102_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_004176696.1|1597112_1598765_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896434.1|1599922_1600618_-	aquaporin Z	NA	NA	NA	NA	NA
WP_004176693.1|1601037_1602696_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896440.1|1602842_1603958_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004191149.1|1603954_1605895_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_002896516.1|1605971_1606193_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1606518_1606836_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1606866_1609146_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1609265_1609484_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1609837_1610539_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004224003.1|1610583_1612305_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NC_017540	Klebsiella pneumoniae KCTC 2242, complete sequence	5259571	2279765	2290653	5259571		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2279765_2280386_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|2280378_2281644_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002903955.1|2281655_2282558_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2282819_2283581_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|2283601_2284462_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|2284759_2285020_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2285106_2286195_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|2286225_2287491_-	MFS transporter	NA	NA	NA	NA	NA
WP_004224683.1|2287545_2290653_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 4
NC_017540	Klebsiella pneumoniae KCTC 2242, complete sequence	5259571	3277438	3284345	5259571	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3277438_3278917_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3278913_3279636_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004899464.1|3279954_3281316_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|3281558_3282455_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|3282697_3283471_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|3283481_3284345_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NC_017541	Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence	202852	143087	194503	202852	integrase,transposase	Stx2-converting_phage(13.33%)	40	141498:141518	172921:172941
141498:141518	attL	CGTCGGCTTTGTTGAATAAAT	NA	NA	NA	NA
WP_004213833.1|143087_144224_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014599324.1|144289_144607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|144758_145082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154511.1|145833_146793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014599325.1|146835_147243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|147252_147696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|148959_149928_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_014599326.1|150255_151848_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	7.2e-176
WP_004189161.1|151878_152229_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|152225_152666_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004117790.1|154293_155265_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_014599327.1|155264_156431_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	9.8e-223
WP_004211839.1|157160_158171_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211835.1|160490_161027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|163777_164560_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_014599329.1|166586_166910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014599330.1|166906_167344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902347.1|167343_168375_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902350.1|168374_169241_-	ParA family protein	NA	NA	NA	NA	NA
WP_004902354.1|169764_170016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014599331.1|170204_171896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004225014.1|171913_172882_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004026379.1|173113_173524_+	hypothetical protein	NA	NA	NA	NA	NA
172921:172941	attR	ATTTATTCAACAAAGCCGACG	NA	NA	NA	NA
WP_004902361.1|173575_174064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902363.1|174148_174562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902367.1|174885_175416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902370.1|175418_175985_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_071820813.1|178545_179253_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014599332.1|179794_180427_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004213611.1|180806_181358_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213613.1|181430_182333_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004213615.1|182475_182697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014599333.1|182758_184933_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
WP_004902400.1|185392_186622_-	esterase family protein	NA	NA	NA	NA	NA
WP_050813274.1|186726_190371_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	7.2e-46
WP_004213623.1|190513_191629_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_074160420.1|191644_191872_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004213626.1|191978_192623_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
WP_004213628.1|192607_193840_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_011154590.1|194296_194503_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.2	2.7e-11
