The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017964	Advenella kashmirensis WT001, complete sequence	4365995	2121695	2128115	4365995	tRNA	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_014750706.1|2121695_2122538_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.0	5.5e-34
WP_041709314.1|2122530_2123286_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.1	2.9e-58
WP_014750708.1|2123417_2124053_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_014750709.1|2124062_2125097_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.9	7.1e-92
WP_014750710.1|2125327_2126617_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	39.9	4.6e-72
WP_014750711.1|2126899_2127283_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.2	8.6e-11
WP_014750712.1|2127521_2128115_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.2	7.3e-17
>prophage 2
NC_017964	Advenella kashmirensis WT001, complete sequence	4365995	2299950	2321148	4365995	tail,integrase,protease,head	Rhizobium_phage(25.0%)	19	2299610:2299659	2310613:2310662
2299610:2299659	attL	TTGGTCCCCCCGGCTGGACTCGAACCAGCGACCAAAGGATTATGAGTCCT	NA	NA	NA	NA
WP_148274654.1|2299950_2301147_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_014750868.1|2301204_2301459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171815157.1|2301470_2301629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014750869.1|2301729_2302434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014750870.1|2302546_2302747_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_148274527.1|2302748_2302967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014750872.1|2302967_2303372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041709377.1|2305192_2305723_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	46.1	4.0e-30
WP_014750876.1|2306981_2307293_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_014750877.1|2307360_2307750_+	putative TerS protein	NA	A0A0F7L441	uncultured_marine_virus	39.5	3.3e-18
WP_014750878.1|2309433_2309757_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	32.7	9.2e-14
WP_014750879.1|2309749_2310025_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_081489387.1|2310847_2313145_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.5	4.2e-36
2310613:2310662	attR	TTGGTCCCCCCGGCTGGACTCGAACCAGCGACCAAAGGATTATGAGTCCT	NA	NA	NA	NA
WP_148274528.1|2313110_2313431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081489274.1|2313500_2313701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014750883.1|2315387_2315600_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014750884.1|2315669_2316212_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014750885.1|2318890_2319811_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_014750886.1|2319822_2321148_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
