The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007806	Brevibacillus laterosporus LMG 15441 chromosome, complete genome	5114147	611989	618880	5114147		Pneumococcus_phage(28.57%)	9	NA	NA
WP_003335541.1|611989_613180_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.4e-29
WP_003335540.1|613255_613444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003335539.1|613525_614356_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	4.6e-57
WP_003335538.1|614415_615252_-	DUF4915 domain-containing protein	NA	NA	NA	NA	NA
WP_003335537.1|615407_616082_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	42.7	3.5e-23
WP_003335536.1|616434_617103_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.8	2.5e-66
WP_003335535.1|617086_617575_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	69.6	1.7e-59
WP_119912803.1|617564_618311_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.4	8.0e-61
WP_041751932.1|618373_618880_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.8	1.1e-53
>prophage 2
NZ_CP007806	Brevibacillus laterosporus LMG 15441 chromosome, complete genome	5114147	2205016	2249787	5114147		Brevibacillus_phage(100.0%)	37	NA	NA
WP_003337249.1|2205016_2206024_-	replication initiation protein	NA	A0A0K2CNV5	Brevibacillus_phage	24.2	2.5e-17
WP_003337250.1|2206309_2206546_+	hypothetical protein	NA	A0A0K2CPH0	Brevibacillus_phage	43.6	1.3e-12
WP_041752551.1|2206744_2207011_+	hypothetical protein	NA	A0A0K2CNW3	Brevibacillus_phage	63.5	5.0e-26
WP_003337252.1|2207367_2208426_+	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	77.0	5.9e-142
WP_031309176.1|2208587_2209079_+	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	68.7	2.9e-51
WP_022584841.1|2209264_2209414_+	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	54.2	2.5e-06
WP_119912807.1|2209479_2213961_+	hypothetical protein	NA	A0A0K2CPN3	Brevibacillus_phage	37.4	1.3e-219
WP_003337256.1|2214087_2214705_+	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	73.3	7.0e-87
WP_003337257.1|2214704_2215757_+	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	60.7	1.3e-130
WP_003337258.1|2215767_2219229_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0K2CNY2	Brevibacillus_phage	64.3	0.0e+00
WP_003337259.1|2219347_2219764_+	hypothetical protein	NA	A0A0K2CP80	Brevibacillus_phage	62.6	1.3e-44
WP_041752553.1|2219767_2220154_+	hypothetical protein	NA	A0A0K2CPN7	Brevibacillus_phage	71.1	1.2e-52
WP_003337261.1|2220170_2222831_+	PKD domain-containing protein	NA	A0A0K2CPJ7	Brevibacillus_phage	58.9	2.0e-300
WP_003337262.1|2222870_2224292_+	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	68.6	1.5e-196
WP_003337263.1|2224326_2226162_+	major virion structural protein	NA	A0A0K2CNY7	Brevibacillus_phage	70.1	4.0e-263
WP_041752091.1|2226184_2230330_+	hypothetical protein	NA	A0A0K2CP84	Brevibacillus_phage	54.5	7.0e-05
WP_003337265.1|2230305_2231424_+	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	63.3	4.4e-140
WP_003337266.1|2231437_2232271_+	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	60.6	1.3e-88
WP_003337267.1|2232346_2233579_+	hypothetical protein	NA	A0A0K2CP47	Brevibacillus_phage	68.8	6.9e-09
WP_003337268.1|2233818_2234310_+	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	55.8	6.4e-43
WP_003337270.1|2234358_2234976_+	hypothetical protein	NA	A0A0K2CP89	Brevibacillus_phage	56.4	6.6e-61
WP_003337271.1|2234960_2237951_+	hypothetical protein	NA	A0A0K2CPK6	Brevibacillus_phage	35.4	1.7e-13
WP_003337272.1|2237988_2241789_+	LamG domain-containing protein	NA	A0A0K2CP88	Brevibacillus_phage	26.8	9.8e-30
WP_003337273.1|2242006_2242324_+	hypothetical protein	NA	A0A0K2CNZ6	Brevibacillus_phage	60.0	3.5e-10
WP_141397653.1|2242420_2242612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337275.1|2242608_2242905_+	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	51.6	2.8e-17
WP_003337276.1|2243619_2244153_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	57.4	1.3e-49
WP_003337277.1|2244520_2245651_+	hypothetical protein	NA	A0A0K2CPR2	Brevibacillus_phage	60.8	2.7e-137
WP_041752093.1|2245653_2245869_+	hypothetical protein	NA	A0A0K2CP13	Brevibacillus_phage	64.8	1.7e-24
WP_003337280.1|2245903_2246137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337281.1|2246123_2246408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337282.1|2246442_2246772_+	hypothetical protein	NA	A0A0K2CPQ6	Brevibacillus_phage	52.3	2.5e-30
WP_003337283.1|2246873_2247203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337284.1|2247240_2247528_+	hypothetical protein	NA	A0A0K2CP23	Brevibacillus_phage	43.0	8.7e-16
WP_041752094.1|2247524_2247770_+	hypothetical protein	NA	A0A0K2CNT1	Brevibacillus_phage	43.8	2.9e-12
WP_003337286.1|2247940_2248552_+	transglycosylase SLT domain-containing protein	NA	A0A0K2CNS6	Brevibacillus_phage	48.9	1.8e-34
WP_081870807.1|2248734_2249787_+	RNA polymerase subunit sigma	NA	A0A0K2CPD8	Brevibacillus_phage	62.1	3.8e-109
>prophage 3
NZ_CP007806	Brevibacillus laterosporus LMG 15441 chromosome, complete genome	5114147	2353191	2362790	5114147		Bacillus_virus(55.56%)	10	NA	NA
WP_003337401.1|2353191_2354013_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.5	2.4e-74
WP_003337402.1|2354014_2354653_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	39.2	2.9e-35
WP_003337403.1|2354667_2356302_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.6	9.8e-112
WP_003337404.1|2356355_2356910_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	45.1	6.6e-36
WP_003337405.1|2356985_2357762_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	48.6	3.5e-51
WP_003337406.1|2358090_2358474_+	VOC family protein	NA	NA	NA	NA	NA
WP_003337408.1|2359230_2360385_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.7	1.0e-54
WP_003337409.1|2360400_2361075_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.0	3.6e-36
WP_003337410.1|2361100_2362297_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.9	8.5e-105
WP_003337412.1|2362316_2362790_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.6	1.4e-39
>prophage 4
NZ_CP007806	Brevibacillus laterosporus LMG 15441 chromosome, complete genome	5114147	3407741	3489778	5114147	integrase,tRNA,tail,capsid,transposase,holin,plate	Brevibacillus_phage(73.17%)	79	3404448:3404468	3460091:3460111
3404448:3404468	attL	AAGATGAATTTCGTTACAAGT	NA	NA	NA	NA
WP_003338835.1|3407741_3408641_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	5.1e-46
WP_003335764.1|3409778_3410399_-	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	93.7	1.2e-110
WP_154071885.1|3410637_3410790_-	hypothetical protein	NA	A0A0K2CND1	Brevibacillus_phage	90.7	2.4e-12
WP_003335761.1|3411010_3411391_-	VOC family protein	NA	NA	NA	NA	NA
WP_003335759.1|3412466_3419480_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.7	2.9e-88
WP_003335758.1|3420015_3420315_-	hypothetical protein	NA	G9BWD6	Planktothrix_phage	46.3	1.7e-06
WP_003335757.1|3420271_3420682_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	44.6	5.4e-19
WP_003335756.1|3420699_3420960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041752253.1|3421659_3421938_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	89.0	2.5e-44
WP_003335754.1|3422067_3422238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003343659.1|3422259_3422421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022586652.1|3422436_3422733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003335750.1|3423190_3423592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003335748.1|3423887_3424091_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	91.7	2.6e-22
WP_003335745.1|3424978_3425191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003335744.1|3425415_3427167_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	24.3	4.2e-20
WP_003335742.1|3427941_3428760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154071886.1|3428825_3429002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003335740.1|3429091_3429229_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_119912812.1|3429248_3429554_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	48.0	1.3e-17
WP_003335738.1|3429666_3429795_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158332776.1|3429791_3430142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003335133.1|3430351_3430648_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158332762.1|3430665_3431511_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	2.0e-47
WP_003335736.1|3431760_3432714_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_003335734.1|3433427_3434087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003335733.1|3434100_3434658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164496774.1|3435140_3435770_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003343687.1|3437711_3439043_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003335725.1|3439091_3439499_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041752627.1|3439720_3442093_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003335722.1|3442287_3443556_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003335721.1|3443577_3444867_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003335720.1|3445090_3446065_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.1	2.2e-50
WP_003335719.1|3446202_3447858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051876123.1|3447848_3448403_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003335717.1|3448762_3449584_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_051876124.1|3449966_3452738_+	NTTRR-F1 domain	NA	NA	NA	NA	NA
WP_003337170.1|3452993_3453920_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173645584.1|3453924_3454719_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.1	1.1e-12
WP_003337168.1|3454868_3455111_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003337167.1|3455140_3456094_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003337166.1|3456090_3456882_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003337165.1|3458303_3459008_-	hypothetical protein	NA	S5M5V1	Brevibacillus_phage	95.7	5.9e-122
WP_041752263.1|3459480_3459705_+	XRE family transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	97.3	6.5e-35
WP_003337163.1|3459795_3460134_-	YolD-like family protein	NA	S5MAC2	Brevibacillus_phage	90.1	7.8e-56
3460091:3460111	attR	AAGATGAATTTCGTTACAAGT	NA	NA	NA	NA
WP_003337162.1|3460448_3461663_+	kelch repeat protein	NA	A0A0K2CNX3	Brevibacillus_phage	54.8	2.4e-67
WP_003337161.1|3461960_3462617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337160.1|3462606_3463770_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.9	3.4e-42
WP_003337159.1|3463990_3464413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337157.1|3464490_3465051_-	DUF3238 domain-containing protein	NA	NA	NA	NA	NA
WP_003337156.1|3465163_3465403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003337155.1|3465408_3465936_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003337154.1|3466034_3466658_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	92.3	1.6e-110
WP_119912689.1|3466654_3466897_-	hypothetical protein	NA	S5MNY8	Brevibacillus_phage	91.2	3.6e-31
WP_003337152.1|3466896_3467367_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_041752629.1|3467770_3467983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337150.1|3468038_3468473_-	hypothetical protein	NA	S5M9X7	Brevibacillus_phage	97.2	3.2e-78
WP_003337149.1|3468517_3469990_-	hypothetical protein	NA	S5M9X7	Brevibacillus_phage	69.9	2.7e-193
WP_003337148.1|3470006_3470405_-	hypothetical protein	NA	S5MU74	Brevibacillus_phage	97.0	1.5e-66
WP_003337147.1|3470401_3470725_-	hypothetical protein	NA	S5M5T9	Brevibacillus_phage	91.6	7.4e-48
WP_003337146.1|3470709_3471288_-	DUF2313 domain-containing protein	NA	S5MNM6	Brevibacillus_phage	95.3	1.0e-100
WP_003337145.1|3471297_3472419_-|plate	baseplate J/gp47 family protein	plate	S5MBX0	Brevibacillus_phage	94.4	5.3e-202
WP_003337143.1|3472435_3472822_-	DUF2634 domain-containing protein	NA	S5M9X2	Brevibacillus_phage	93.0	3.4e-63
WP_003337142.1|3472818_3473169_-	hypothetical protein	NA	S5MU69	Brevibacillus_phage	96.6	1.2e-62
WP_003337141.1|3473165_3474308_-	hypothetical protein	NA	S5M5T7	Brevibacillus_phage	98.9	2.1e-222
WP_003337140.1|3474300_3474897_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MNM1	Brevibacillus_phage	81.8	9.4e-89
WP_003337139.1|3474896_3477776_-|tail	phage tail tape measure protein	tail	S5MBW5	Brevibacillus_phage	89.4	0.0e+00
WP_003337137.1|3478027_3478375_-	hypothetical protein	NA	S5MU64	Brevibacillus_phage	88.7	1.6e-51
WP_003337136.1|3478387_3478822_-	hypothetical protein	NA	S5M5T1	Brevibacillus_phage	99.3	1.1e-75
WP_041752267.1|3478821_3480348_-|tail	phage tail protein	tail	S5MNL6	Brevibacillus_phage	95.3	9.9e-284
WP_003337132.1|3480894_3481452_-	hypothetical protein	NA	S5MC52	Brevibacillus_phage	98.9	1.4e-97
WP_003337131.1|3481451_3481856_-	hypothetical protein	NA	S5M9W2	Brevibacillus_phage	99.2	1.5e-66
WP_003337130.1|3481855_3482383_-	hypothetical protein	NA	S5MU57	Brevibacillus_phage	93.7	1.6e-92
WP_003337129.1|3482351_3482690_-	hypothetical protein	NA	S5MNV6	Brevibacillus_phage	54.2	1.2e-27
WP_041752632.1|3482704_3485638_-	hypothetical protein	NA	S5M5S9	Brevibacillus_phage	71.5	0.0e+00
WP_041752269.1|3485693_3485921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119912691.1|3485931_3488082_-|capsid	minor capsid protein	capsid	S5MNL1	Brevibacillus_phage	74.7	6.9e-307
WP_003337125.1|3488095_3489778_-	hypothetical protein	NA	M4MCI5	Vibrio_phage	31.1	2.7e-40
>prophage 5
NZ_CP007806	Brevibacillus laterosporus LMG 15441 chromosome, complete genome	5114147	3499795	3516036	5114147		Brevibacillus_phage(40.0%)	30	NA	NA
WP_003337106.1|3499795_3500323_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.9	8.5e-41
WP_003337105.1|3500325_3500514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337104.1|3500510_3500744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337103.1|3500775_3501441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337101.1|3501461_3501995_-	hypothetical protein	NA	A0A0C5AJ42	Paenibacillus_phage	42.3	4.9e-28
WP_003337099.1|3502369_3502546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337098.1|3502545_3503880_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	46.5	1.0e-98
WP_003337097.1|3503872_3504685_-	ATP-binding protein	NA	S5MU12	Brevibacillus_phage	31.9	6.1e-14
WP_003337096.1|3504626_3505454_-	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	37.3	4.6e-41
WP_154071874.1|3505468_3505639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164496763.1|3505642_3505804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337095.1|3505821_3506241_-	single-stranded DNA-binding protein	NA	S5MNH0	Brevibacillus_phage	71.9	1.6e-50
WP_119912694.1|3506252_3506984_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0A7RVR3	Clostridium_phage	46.8	7.8e-53
WP_003337093.1|3507021_3507903_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.1	5.5e-93
WP_003337092.1|3507984_3508203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119912695.1|3508220_3508409_-	hypothetical protein	NA	S5MNR1	Brevibacillus_phage	65.3	2.2e-07
WP_003337090.1|3508500_3508758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337089.1|3508741_3508978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337088.1|3509039_3509744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003337086.1|3509740_3510016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041752278.1|3509999_3510182_-	hypothetical protein	NA	S5MUE4	Brevibacillus_phage	73.3	7.7e-18
WP_041752280.1|3510342_3510612_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	80.9	1.5e-38
WP_003337083.1|3510736_3510958_-	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	38.5	1.1e-05
WP_003337082.1|3510972_3511758_-	Rha family transcriptional regulator	NA	A0A2I7SDG8	Paenibacillus_phage	49.6	9.9e-54
WP_041752282.1|3511792_3511987_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051876125.1|3512157_3512535_+	helix-turn-helix transcriptional regulator	NA	A6XML9	Bacillus_virus	45.3	9.1e-13
WP_003337079.1|3512564_3512720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003337078.1|3512897_3513044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041752284.1|3513045_3514356_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003337074.1|3515226_3516036_-	hypothetical protein	NA	S5M5V5	Brevibacillus_phage	76.0	1.6e-107
