The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	201552	262183	4987957	tRNA,transposase,protease,plate	Saccharomonospora_phage(20.0%)	52	NA	NA
WP_001295561.1|201552_202905_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|202934_205367_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|205488_205974_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139295.1|205977_207003_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|207107_207563_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|207566_208355_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139686.1|208354_209503_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569428.1|209499_210096_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	6.7e-26
WP_001294757.1|210132_213615_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|213627_214587_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020989.1|214685_216827_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|216883_217273_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176528.1|217337_218636_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|218684_218945_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|218931_219132_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185309.1|219297_219843_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|219839_220262_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239194.1|220275_220986_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360447.1|221015_221840_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|221892_223611_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094022.1|223721_224429_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|224425_224830_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|224947_225763_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|225802_226456_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|226448_227480_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|227667_228240_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997027.1|234001_234805_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	7.1e-39
WP_000648581.1|234801_235716_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|235956_236757_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211700.1|236834_237605_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644680.1|237651_239010_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052722.1|239081_239837_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|239870_240593_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|240589_241057_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|241121_241853_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001053625.1|242392_243178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236629.1|243326_243794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|244059_245268_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000908073.1|245327_246056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|246099_246582_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087587.1|246605_247958_-	membrane protein	NA	NA	NA	NA	NA
WP_122986715.1|247968_251403_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240540.1|251511_252927_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088866.1|252931_253675_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614409.1|253671_256455_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.6	3.6e-82
WP_000343111.1|256463_257225_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246417.1|257229_258561_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|258563_259088_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113718.1|259084_260365_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_047938329.1|260389_261145_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000526142.1|261235_261694_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_000348801.1|261814_262183_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	980849	1045761	4987957	head,transposase,terminase,portal,plate,tail,protease,integrase,capsid,holin,tRNA	Enterobacteria_phage(67.8%)	73	998978:998997	1036398:1036417
WP_000520781.1|980849_981170_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934042.1|981200_983477_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|984342_984561_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|984845_985550_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202143.1|985591_987313_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.3	9.9e-22
WP_001043573.1|987313_989080_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537432.1|989202_990168_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|990712_991207_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077033.1|991341_995448_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001305929.1|995606_996218_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|996228_997572_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|997662_998955_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
998978:998997	attL	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000078920.1|999260_999401_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488099.1|999592_999853_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_047938336.1|999895_1001005_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	2.0e-193
WP_000005453.1|1001162_1002347_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	4.9e-222
WP_000290462.1|1002346_1002859_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651568.1|1002914_1003289_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.0e-36
WP_000333503.1|1003297_1003453_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_001375849.1|1003439_1006247_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.8	0.0e+00
WP_000979945.1|1006259_1006748_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001375851.1|1006774_1007374_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.0e-86
WP_072272109.1|1007388_1007958_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.7	1.7e-23
WP_000072167.1|1007957_1008572_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_047938337.1|1008578_1010291_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.6	1.1e-118
WP_000071724.1|1010287_1010896_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111976.1|1010888_1011785_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_001376193.1|1011788_1012139_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	1.0e-58
WP_001271944.1|1012135_1012717_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_000356371.1|1012713_1013349_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_000921131.1|1013341_1013809_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	6.1e-83
WP_047938338.1|1013832_1015713_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.8	9.3e-300
WP_000780577.1|1015851_1016247_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|1016243_1016636_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|1016632_1016956_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|1016958_1017159_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|1017158_1017653_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632368.1|1017754_1018555_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	93.2	8.4e-133
WP_001055082.1|1018600_1019653_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
WP_001262649.1|1019676_1020513_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	6.7e-149
WP_000613759.1|1020667_1022419_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_000087814.1|1022418_1023465_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236496.1|1023479_1024004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224227.1|1024590_1024854_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001167295.1|1024855_1025347_-	hypothetical protein	NA	G9L661	Escherichia_phage	91.4	2.4e-82
WP_001080491.1|1025349_1025664_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	95.2	2.9e-49
WP_001163784.1|1025660_1025993_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
WP_000211251.1|1026056_1026368_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	4.2e-48
WP_000686505.1|1026372_1027332_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_000123426.1|1027408_1030231_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000599375.1|1030237_1030603_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_113772492.1|1030599_1031217_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	48.1	5.0e-08
WP_000104308.1|1031228_1031528_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_000153700.1|1031524_1031791_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|1031787_1031991_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|1032014_1032425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|1032518_1032632_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|1032628_1032871_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|1032882_1033161_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|1033171_1033522_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|1033659_1033851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|1033857_1034280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|1034284_1034806_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|1034910_1035252_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023738.1|1035321_1036314_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
WP_000526135.1|1036563_1037022_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
1036398:1036417	attR	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000850305.1|1037324_1039769_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213096.1|1039779_1040397_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	2.9e-77
WP_000534642.1|1040398_1041262_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|1041296_1041923_-	hydrolase	NA	NA	NA	NA	NA
WP_000109286.1|1042237_1043386_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918526.1|1043595_1045026_+	amino acid permease	NA	NA	NA	NA	NA
WP_000526146.1|1045302_1045761_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.4e-12
>prophage 3
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	1385223	1453076	4987957	head,transposase,terminase,portal,tail,integrase,protease,capsid,holin	Escherichia_phage(28.81%)	83	1385060:1385087	1437229:1437256
1385060:1385087	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113696.1|1385223_1386354_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	2.0e-103
WP_000113189.1|1386331_1386580_-	excisionase	NA	NA	NA	NA	NA
WP_000048521.1|1386644_1389116_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	2.3e-56
WP_001090200.1|1389208_1389400_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1389396_1389585_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_012601410.1|1390079_1390346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394541.1|1390334_1390673_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_000379586.1|1390684_1390837_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362153.1|1391102_1391522_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1391622_1391904_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693943.1|1391887_1392313_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1392335_1393298_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_047938339.1|1393769_1395308_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	5.5e-298
WP_000612591.1|1395357_1395705_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1395701_1396082_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000004324.1|1396207_1396462_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	92.9	5.3e-41
WP_001002675.1|1396454_1396766_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	95.1	2.9e-57
WP_001224665.1|1396894_1397077_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_001289985.1|1397242_1397602_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	2.3e-37
WP_001167293.1|1397604_1398096_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.0e-84
WP_000224220.1|1398097_1398361_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000207980.1|1398371_1399274_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	57.6	1.3e-78
WP_000967408.1|1399508_1399721_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001329966.1|1399888_1400161_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265092.1|1400162_1401218_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140009.1|1401218_1401599_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.3e-35
WP_000762910.1|1401595_1402417_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	2.5e-79
WP_000917749.1|1402641_1402839_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935514.1|1402989_1404039_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	90.5	1.0e-186
WP_106104550.1|1404336_1404423_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|1404911_1405124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586961.1|1405194_1405530_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	4.0e-44
WP_047938340.1|1405790_1407647_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	89.2	0.0e+00
WP_000284510.1|1407797_1408013_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1408017_1408362_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369851.1|1408327_1408600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|1408705_1409239_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_032140280.1|1409793_1409880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|1410101_1410287_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000736383.1|1410372_1410597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1410795_1410996_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1411037_1411403_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958372.1|1411692_1412256_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001376198.1|1412252_1413914_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_000173030.1|1413977_1415915_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1415959_1416181_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032167421.1|1416126_1418712_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125969.1|1418708_1419035_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	4.5e-53
WP_001007905.1|1419044_1419395_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573362.1|1419391_1419838_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|1419834_1420179_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1420243_1420960_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1420974_1421349_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1421444_1421654_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_021520064.1|1421701_1424944_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_000807924.1|1424936_1425278_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_001375867.1|1425277_1425976_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_000194703.1|1425986_1426730_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	2.9e-148
WP_061089814.1|1426675_1427308_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_047938341.1|1427650_1431040_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	87.2	0.0e+00
WP_001228337.1|1431106_1431706_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.7e-101
WP_000741748.1|1431770_1434146_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	2.2e-168
WP_000654140.1|1434145_1434427_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	7.0e-18
WP_000235977.1|1434436_1435141_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.1	1.7e-57
WP_000355601.1|1435151_1435445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240999.1|1435638_1436307_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937498.1|1436363_1436633_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_001079500.1|1437406_1437913_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1437229:1437256	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056485.1|1437958_1438459_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1438544_1438724_-	general stress protein	NA	NA	NA	NA	NA
WP_000443040.1|1439104_1439911_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1439910_1441104_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001366234.1|1441115_1442474_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.0e-37
WP_000763524.1|1442477_1444073_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194620.1|1444072_1445635_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1445726_1445771_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285688.1|1445908_1446790_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1446786_1447407_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001366283.1|1447434_1449336_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1449546_1450422_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278889.1|1450461_1451052_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559270.1|1451048_1451807_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	1.5e-06
WP_000422045.1|1452026_1453076_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	1752093	1764886	4987957	head,terminase,portal,protease,capsid	uncultured_Caudovirales_phage(88.89%)	17	NA	NA
WP_001260850.1|1752093_1752915_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046669.1|1752953_1753283_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1753269_1753635_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133421.1|1754948_1755230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127876.1|1755243_1756905_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.9e-276
WP_000113645.1|1756888_1757245_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|1757368_1757551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|1757534_1757975_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134109.1|1757974_1758271_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001020662.1|1758267_1758606_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000267605.1|1758602_1759814_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504056.1|1759815_1760388_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137337.1|1760427_1761585_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000233313.1|1761872_1762145_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126693.1|1762157_1762568_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557476.1|1762564_1762843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761834.1|1763131_1764886_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	2.4e-92
>prophage 5
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	2205869	2217128	4987957		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
WP_000704872.1|2205869_2207036_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.9e-110
WP_000043487.1|2207284_2208691_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
WP_000736848.1|2208854_2210225_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
WP_000868618.1|2210249_2210996_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
WP_001361571.1|2211079_2212465_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
WP_001042472.1|2212476_2212932_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000163129.1|2212934_2213900_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
WP_000335121.1|2213903_2215025_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
WP_000699785.1|2215035_2216043_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000026027.1|2216111_2217128_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	43.7	6.3e-77
>prophage 6
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	2323353	2332795	4987957		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292747.1|2323353_2324490_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	6.5e-163
WP_001366299.1|2324486_2326487_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2326611_2327073_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2327113_2327584_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2327630_2328350_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2328346_2330032_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|2330253_2330985_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2331044_2331152_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|2331132_2331864_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|2331868_2332795_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 7
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	2710331	2753684	4987957	holin,tail,terminase,integrase	Escherichia_phage(61.22%)	53	2736247:2736263	2750421:2750437
WP_000017552.1|2710331_2710484_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2710501_2710693_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|2711003_2711522_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|2711537_2712077_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001375980.1|2712294_2712777_-	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	100.0	5.5e-79
WP_000403796.1|2712773_2713403_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	94.7	3.8e-112
WP_000256102.1|2713392_2713701_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_000116028.1|2713687_2714092_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	93.3	1.1e-61
WP_001188250.1|2716586_2716844_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	2.8e-42
WP_000126406.1|2717157_2717844_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	81.8	3.5e-103
WP_000163644.1|2717967_2718294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000479990.1|2718280_2718793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|2718874_2719036_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001147903.1|2719067_2719364_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	6.2e-49
WP_001248456.1|2719560_2722035_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	96.6	0.0e+00
WP_000119844.1|2722040_2723843_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	98.0	0.0e+00
WP_001145656.1|2723839_2726353_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.4	0.0e+00
WP_000332878.1|2726352_2726898_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_000568023.1|2726897_2727362_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_001018551.1|2727361_2729833_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_000179265.1|2729832_2730438_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
WP_000424489.1|2730437_2730761_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
WP_000012374.1|2730811_2731147_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	2.9e-55
WP_000627063.1|2731157_2731595_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	97.2	3.4e-72
WP_000268715.1|2731646_2732633_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_001048075.1|2732647_2733343_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133159.1|2733345_2733642_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	2.9e-46
WP_000852421.1|2733638_2735318_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	6.2e-303
WP_000335899.1|2735332_2735539_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
2736247:2736263	attL	ATTACCTTAAAGGTATA	NA	NA	NA	NA
WP_000787771.1|2736266_2737115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132532.1|2737118_2738588_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	98.2	6.2e-291
WP_001090120.1|2738584_2739259_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_001129692.1|2739299_2739638_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	5.4e-57
WP_000002118.1|2739630_2739912_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	98.9	2.6e-49
WP_000210407.1|2739904_2740456_-	DUF551 domain-containing protein	NA	G3CFH2	Escherichia_phage	59.9	2.6e-53
WP_000215168.1|2740457_2740757_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	4.0e-56
WP_000117573.1|2740753_2741299_-	hypothetical protein	NA	J9Q748	Salmonella_phage	84.4	4.4e-85
WP_000445459.1|2741295_2741823_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	77.8	1.5e-50
WP_001231252.1|2741884_2742229_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	4.8e-61
WP_001341618.1|2742346_2743132_-	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.9	1.8e-151
WP_000086417.1|2743128_2743944_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_001282459.1|2744310_2744541_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2744695_2745280_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001375986.1|2745588_2745888_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	96.0	1.4e-45
WP_000802261.1|2745884_2746706_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.9	5.2e-162
WP_000063815.1|2746702_2747584_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.3	7.5e-159
WP_000675390.1|2747633_2747882_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001341620.1|2748039_2748291_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000163467.1|2748283_2748934_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	98.6	5.6e-127
WP_001077940.1|2748930_2749125_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	100.0	3.3e-27
WP_000954555.1|2749128_2750379_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	3.0e-238
WP_000138279.1|2750571_2752149_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2750421:2750437	attR	TATACCTTTAAGGTAAT	NA	NA	NA	NA
WP_001296289.1|2752217_2753684_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 8
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	2831459	2897129	4987957	lysis,head,terminase,portal,plate,tail,integrase,capsid,tRNA	Escherichia_phage(24.44%)	71	2827923:2827939	2900908:2900924
2827923:2827939	attL	CATTGCCGCGCTGTACC	NA	NA	NA	NA
WP_001295363.1|2831459_2832197_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|2832328_2833663_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001375999.1|2833695_2834577_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189223.1|2834679_2835267_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2835321_2835705_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|2836009_2836699_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_000997403.1|2836746_2837784_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2837990_2838410_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001376000.1|2838478_2839177_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082985.1|2839208_2841869_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949256.1|2841982_2843338_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001221084.1|2843381_2843705_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841107.1|2843701_2845000_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	1.6e-45
WP_001366559.1|2850827_2853401_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040135.1|2853530_2854262_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079108.1|2854258_2855239_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2855373_2856111_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2856381_2856723_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2856826_2856874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200094.1|2856972_2858133_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225228.1|2858175_2859297_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2859307_2860378_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|2860587_2860953_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2861102_2861621_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969021.1|2861610_2862837_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001408077.1|2863537_2864467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111946.1|2864456_2865494_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	76.5	4.8e-157
WP_021529281.1|2865498_2866077_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	49.5	2.5e-46
WP_000188833.1|2866202_2866427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000459330.1|2866462_2866972_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	94.1	2.4e-85
WP_000916540.1|2866979_2867207_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	89.3	2.5e-34
WP_000085637.1|2867193_2867394_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	95.5	3.3e-30
WP_001246240.1|2867463_2867691_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	96.0	3.8e-30
WP_000786065.1|2867690_2867912_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	79.5	2.2e-27
WP_001366581.1|2867913_2870061_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	88.2	0.0e+00
WP_000232871.1|2870250_2870433_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	83.3	3.9e-22
WP_000235290.1|2870804_2871788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609549.1|2871784_2872471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042186.1|2872527_2873556_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.5	1.2e-163
WP_000214162.1|2873555_2875325_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	80.8	8.5e-287
WP_001085420.1|2875489_2876353_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	63.1	1.5e-98
WP_001224498.1|2876384_2877590_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	62.0	1.4e-126
WP_000224817.1|2877593_2878352_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.4	6.6e-79
WP_000177981.1|2878449_2878950_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
WP_001019825.1|2878949_2879153_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	79.1	6.1e-24
WP_000524754.1|2879143_2879365_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_000534553.1|2879348_2879858_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.1	2.1e-76
WP_000849742.1|2879854_2880268_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	60.6	7.6e-37
WP_000277801.1|2880375_2880843_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	9.7e-57
WP_000997681.1|2880835_2881303_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.4	8.3e-48
WP_001366609.1|2881340_2882684_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_001097317.1|2882760_2883402_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.6	2.3e-96
WP_000213440.1|2883398_2883746_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	70.4	2.8e-40
WP_001273711.1|2883750_2884659_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	82.1	4.6e-135
WP_000066790.1|2884651_2885263_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.5e-94
WP_000208951.1|2885259_2886219_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	50.8	6.4e-87
WP_001106837.1|2886240_2886681_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.3	1.6e-53
WP_001030515.1|2886652_2887255_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.7	4.9e-93
WP_000982368.1|2887254_2887755_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.5	4.0e-56
WP_001195984.1|2887781_2888360_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.8	3.5e-80
WP_001286665.1|2888424_2889612_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.0e-190
WP_001207671.1|2889624_2890143_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	80.2	3.0e-75
WP_000361834.1|2890205_2890478_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	78.8	1.3e-29
WP_000763326.1|2890519_2890639_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_000069481.1|2890631_2893061_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	79.5	6.2e-280
WP_000978925.1|2893072_2893537_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	78.4	4.5e-62
WP_000884169.1|2893539_2894712_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.3	9.0e-168
WP_000972008.1|2894788_2895007_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	81.9	8.6e-32
WP_000948616.1|2895044_2895767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065253.1|2895972_2896320_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2896361_2897129_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
2900908:2900924	attR	CATTGCCGCGCTGTACC	NA	NA	NA	NA
>prophage 9
NZ_CP006632	Escherichia coli PCN033 chromosome, complete genome	4987957	4318297	4395265	4987957	lysis,head,transposase,terminase,plate,tail,integrase,protease,capsid,holin,tRNA	Escherichia_phage(34.88%)	83	4345633:4345679	4379322:4379368
WP_000560983.1|4318297_4318735_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4318779_4319721_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_122986704.1|4321036_4321951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295676.1|4322644_4322863_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001309881.1|4323081_4323324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|4323505_4324435_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4324431_4325067_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331382.1|4325063_4325966_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4325978_4329029_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4329222_4330056_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749923.1|4331187_4332582_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619503.1|4332622_4332937_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179713.1|4332946_4333771_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001366753.1|4334012_4335272_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144115.1|4335268_4336738_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217128.1|4337025_4337862_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001297062.1|4337845_4338784_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063513.1|4338780_4339815_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4340099_4340720_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|4340979_4341963_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270247.1|4342111_4342786_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4342890_4344264_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4344260_4344959_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4345108_4345609_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4345633:4345679	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985249.1|4345794_4346775_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
WP_001017512.1|4346844_4347138_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000453532.1|4347273_4347546_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217670.1|4347715_4348216_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4348279_4348504_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277907.1|4348503_4348803_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	1.4e-45
WP_001113277.1|4348805_4349030_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
WP_000027673.1|4349026_4349302_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_000268588.1|4349291_4351565_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.6	0.0e+00
WP_000598783.1|4351676_4352726_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	56.2	7.4e-105
WP_001279022.1|4352766_4354725_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000156861.1|4356174_4357947_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085967.1|4358120_4358975_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.4	1.3e-131
WP_001248587.1|4359029_4360103_+|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	3.3e-201
WP_000203448.1|4360106_4360850_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.0	2.5e-123
WP_000988633.1|4360949_4361459_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4361458_4361662_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|4361665_4361947_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4361946_4362444_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736614.1|4362458_4362884_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.4	6.1e-58
WP_001376121.1|4362871_4363297_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	4.7e-66
WP_001440152.1|4363268_4363442_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917151.1|4363404_4363872_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001788.1|4363864_4364317_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	6.9e-76
WP_000255496.1|4364388_4365174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094920.1|4365257_4365893_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.3e-112
WP_000127163.1|4365889_4366237_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121456.1|4366241_4367150_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	98.3	7.0e-160
WP_001285317.1|4367142_4367673_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	1.1e-101
WP_001164151.1|4369395_4369923_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
WP_000711880.1|4370343_4371186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001591842.1|4371292_4371877_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	2.3e-07
WP_000836023.1|4371899_4372277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286716.1|4372607_4373798_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251418.1|4373810_4374329_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	98.3	3.6e-92
WP_001031312.1|4374385_4374661_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4374693_4374813_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069911.1|4374805_4377253_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.1	0.0e+00
WP_000978889.1|4377267_4377747_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882944.1|4377746_4378910_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.1e-205
WP_000468308.1|4378991_4379210_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076737.1|4379446_4380349_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4379322:4379368	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4380529_4381492_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4381811_4382801_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001366736.1|4382907_4383663_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4383717_4384485_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|4384592_4385192_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155251.1|4385292_4385733_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4385944_4386244_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4386270_4386699_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796316.1|4386703_4387450_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4387546_4388557_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4388691_4390200_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4390222_4391068_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4391492_4391738_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4391822_4392308_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4392400_4393327_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4393393_4394725_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4394734_4395265_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NZ_CP006635	Escherichia coli PCN033 plasmid p3PCN033, complete sequence	161511	84436	134574	161511	integrase,protease,transposase	Acinetobacter_phage(15.38%)	32	70661:70675	103206:103220
70661:70675	attL	AAAACCTGCTCATAC	NA	NA	NA	NA
WP_001066954.1|84436_85177_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|85297_85486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175736.1|85859_86768_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|86830_87940_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|88372_89326_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001324039.1|90598_90757_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000928804.1|93593_94781_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|94777_96718_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|96721_98092_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|98888_99830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|102090_103284_-	hypothetical protein	NA	NA	NA	NA	NA
103206:103220	attR	GTATGAGCAGGTTTT	NA	NA	NA	NA
WP_047938482.1|105315_105615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015918726.1|105611_106478_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
WP_000738422.1|107639_107933_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|111078_112194_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_015918732.1|112207_115993_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.7e-45
WP_000933678.1|116096_117326_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271274.1|117410_118367_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|118411_120589_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001190234.1|121454_122489_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000377483.1|123048_123357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|123455_123638_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|123634_123832_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_001324221.1|124546_125788_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183604.1|125762_127877_+	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|128046_128358_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|128335_128572_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|129511_129781_+	membrane protein	NA	NA	NA	NA	NA
WP_001017346.1|129777_130758_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001171523.1|130833_131214_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|131210_131558_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001067858.1|133869_134574_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP006635	Escherichia coli PCN033 plasmid p3PCN033, complete sequence	161511	142226	151616	161511	integrase,transposase	Escherichia_phage(25.0%)	10	133806:133865	150553:151373
133806:133865	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067858.1|142226_142931_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|143004_143478_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|143635_144649_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|144851_145202_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|145327_145888_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|145890_148857_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|148923_149301_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001333194.1|149501_149792_-	chloramphenicol acetyltransferase CAT	NA	A0A1I9LJQ7	Stx_converting_phage	99.0	5.3e-53
WP_001067858.1|149843_150548_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|150755_151616_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
150553:151373	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGGTAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTTCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATA	NA	NA	NA	NA
