The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017221	Bifidobacterium longum subsp. longum KACC 91563, complete sequence	2385301	701621	764238	2385301	transposase,protease,integrase,tRNA	Flavobacterium_phage(16.67%)	46	760929:760988	764315:764410
WP_014485488.1|701621_703367_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_014485489.1|703587_704469_+|protease	Lon protease	protease	NA	NA	NA	NA
WP_010081281.1|704575_705001_+	DUF3052 domain-containing protein	NA	NA	NA	NA	NA
WP_007053293.1|705469_707173_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_007053294.1|707169_708360_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_007054049.1|708356_709580_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_014485490.1|709634_711413_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007054051.1|711461_712181_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_007055433.1|712183_712972_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.4	1.3e-16
WP_014485491.1|713240_714488_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_014485492.1|714611_715682_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007053301.1|715942_716725_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_007054055.1|716920_718477_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_012471771.1|718487_719825_-	MFS transporter	NA	NA	NA	NA	NA
WP_007054057.1|720038_721079_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014485493.1|721122_722556_-	serpin family protein	NA	NA	NA	NA	NA
WP_007053306.1|722577_722988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007058690.1|723616_724996_-	MFS transporter	NA	NA	NA	NA	NA
WP_007053312.1|725501_725879_-	thiamine-binding protein	NA	NA	NA	NA	NA
WP_007055440.1|725929_726739_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_007054063.1|726942_727209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014485495.1|727245_729999_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_014485496.1|730081_731026_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_007053317.1|731461_732934_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	25.9	1.0e-43
WP_007053318.1|733078_734323_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_007054067.1|734434_735646_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_007053320.1|735658_736138_+	cell division protein SepF	NA	NA	NA	NA	NA
WP_007054068.1|736259_736562_+	YggT family protein	NA	NA	NA	NA	NA
WP_013410602.1|736701_738081_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_014485497.1|738102_738651_+	signal peptidase II	NA	NA	NA	NA	NA
WP_007054072.1|738650_739613_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_007053326.1|739922_740402_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_014485498.1|740672_741473_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_007057559.1|741500_742547_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014485501.1|745404_748698_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_014485502.1|748694_752810_+	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	24.9	3.8e-19
WP_041473699.1|752954_753383_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_014485504.1|753425_754724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014485505.1|754970_755312_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041473700.1|755492_756995_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_007053140.1|757074_757776_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.2	6.0e-34
WP_080561655.1|757834_758140_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014485507.1|758270_759728_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014485508.1|759724_760486_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.5	4.2e-33
760929:760988	attL	GATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCCGTG	NA	NA	NA	NA
WP_041473701.1|761020_762076_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH95	Gordonia_phage	30.8	1.4e-05
WP_007053137.1|763035_764238_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
764315:764410	attR	CACGGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCCGAGTGGATGATCGGCGTCTCGCCGGGCTTGAGCGT	NA	NA	NA	NA
>prophage 2
NC_017221	Bifidobacterium longum subsp. longum KACC 91563, complete sequence	2385301	914247	994880	2385301	transposase,integrase,tRNA	Mycobacterium_phage(13.33%)	60	959836:959853	998518:998535
WP_007052635.1|914247_915702_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_007052636.1|915712_916699_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_007056215.1|916732_917482_-	Fic family protein	NA	NA	NA	NA	NA
WP_007052638.1|917704_920614_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	50.9	1.6e-101
WP_007057209.1|920791_921427_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014485558.1|921438_921972_+	CinA family protein	NA	NA	NA	NA	NA
WP_014485559.1|922031_922547_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029679486.1|922658_922892_+	DUF3046 domain-containing protein	NA	NA	NA	NA	NA
WP_013140879.1|923192_924386_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	70.1	1.2e-127
WP_013140878.1|924388_924982_+	RecX family transcriptional regulator	NA	NA	NA	NA	NA
WP_007052648.1|925859_926522_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_007052649.1|926683_929578_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_010080769.1|929888_930242_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014485563.1|930831_931878_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.7	3.2e-39
WP_007054484.1|931924_932113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007054485.1|932266_932962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014485564.1|933022_933724_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_041473705.1|933766_936040_-	serine/threonine-protein kinase	NA	A0A2P1EMR8	Moumouvirus	26.6	2.2e-16
WP_007054488.1|936183_937266_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_007055157.1|937470_938133_+	DUF4192 family protein	NA	NA	NA	NA	NA
WP_007055162.1|938335_939760_+	RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	39.4	3.5e-41
WP_010080760.1|939817_942094_+	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	36.9	2.4e-108
WP_007056778.1|942260_943487_+	MFS transporter	NA	NA	NA	NA	NA
WP_014485566.1|943530_944523_+	ribokinase	NA	NA	NA	NA	NA
WP_014485567.1|944538_949272_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_007054494.1|949282_950071_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_007052666.1|950215_952945_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.6	2.7e-82
WP_014485568.1|953195_954464_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_007056777.1|954473_955565_-	DUF3071 domain-containing protein	NA	NA	NA	NA	NA
WP_007052669.1|955723_956017_+	DUF4193 domain-containing protein	NA	NA	NA	NA	NA
WP_007055963.1|956016_956493_+	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	57.7	1.5e-33
WP_014485569.1|956626_958951_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	36.8	8.4e-08
WP_007053137.1|959517_960720_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
959836:959853	attL	GTTCCGGGTTTGGCCGTG	NA	NA	NA	NA
WP_014485572.1|963871_964108_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_041473707.1|964769_965285_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_008783376.1|965381_965921_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.3	6.9e-22
WP_173362156.1|966918_968412_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_007054865.1|968408_969170_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.3	2.4e-36
WP_014485575.1|969674_969971_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_014485576.1|969963_970323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014485578.1|971158_972694_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_014485579.1|972741_973464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014485580.1|973560_974466_+	hypothetical protein	NA	A5VW94	Enterobacteria_phage	21.5	9.5e-08
WP_007052675.1|974818_975787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014485582.1|976170_977106_-	DMT family transporter	NA	NA	NA	NA	NA
WP_007052678.1|977384_977789_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_007054373.1|977816_979112_-	DNA methyltransferase	NA	NA	NA	NA	NA
WP_007052680.1|979180_980026_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_007054371.1|980140_981091_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_007054370.1|981186_982032_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011068058.1|982074_985038_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.0	8.6e-199
WP_007054369.1|985480_985978_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041473708.1|985974_987729_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_014485584.1|987868_989215_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_007054366.1|989281_990253_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_007052688.1|990273_990840_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_007054365.1|990901_991783_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_041473709.1|991799_992354_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_007054363.1|992350_993394_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.3	7.8e-54
WP_014485586.1|993944_994880_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	33.0	2.4e-30
998518:998535	attR	GTTCCGGGTTTGGCCGTG	NA	NA	NA	NA
