The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015726	Cupriavidus necator N-1 chromosome 1, complete sequence	3872936	233860	281815	3872936	tRNA,holin,transposase	Salmonella_phage(15.38%)	47	NA	NA
WP_013955325.1|233860_234211_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013955326.1|234272_235103_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_013955327.1|235111_235471_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_013955328.1|235522_236281_+	Mut7-C ubiquitin/RNAse domain-containing protein	NA	NA	NA	NA	NA
WP_013955329.1|236440_237025_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013955330.1|237131_239084_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	37.7	1.2e-10
WP_013955331.1|239190_240213_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_013955332.1|240398_241097_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_013955333.1|241153_242389_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	45.6	1.1e-78
WP_013955334.1|242385_242823_-	universal stress protein	NA	NA	NA	NA	NA
WP_013955335.1|242864_243698_-	ABC transporter ATP-binding protein	NA	M1IC18	Acanthocystis_turfacea_Chlorella_virus	30.9	1.4e-08
WP_013955336.1|243694_244441_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	5.1e-15
WP_148271556.1|244437_245460_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013955338.1|245456_246353_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_041228274.1|246378_247614_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013955340.1|247855_249247_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013955341.1|249260_250289_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	2.4e-23
WP_049800586.1|250300_251233_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013955343.1|251234_252089_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013955344.1|252098_252293_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013955345.1|252309_253497_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080569529.1|253512_254367_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011614433.1|254453_254855_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_013955347.1|254964_255909_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	70.9	3.3e-104
WP_041227695.1|255981_256809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013955349.1|257099_258464_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	34.6	5.4e-31
WP_013955350.1|258581_260420_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	45.3	4.9e-144
WP_013955351.1|261150_261780_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_013955352.1|261801_262575_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041227697.1|262639_262912_+	pentapeptide MXKDX repeat protein	NA	NA	NA	NA	NA
WP_013955354.1|263158_263596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013955356.1|264314_264950_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049800573.1|266497_267658_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	60.3	4.9e-134
WP_049800541.1|267712_268012_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	69.8	3.5e-36
WP_013955359.1|268082_269504_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	37.5	6.4e-83
WP_013955360.1|269685_270627_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013955361.1|270745_271738_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_013955362.1|272032_272500_+	bacterioferritin	NA	NA	NA	NA	NA
WP_013955363.1|272980_273424_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013955364.1|273448_274438_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_013955365.1|274817_276278_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_013955366.1|276607_277939_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_013955367.1|278048_279566_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013955368.1|279645_279996_+	VOC family protein	NA	NA	NA	NA	NA
WP_013955369.1|280002_280167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049800588.1|280300_281461_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	60.3	3.8e-134
WP_049800541.1|281515_281815_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	69.8	3.5e-36
>prophage 2
NC_015726	Cupriavidus necator N-1 chromosome 1, complete sequence	3872936	838353	847156	3872936		Bacillus_phage(16.67%)	8	NA	NA
WP_013955853.1|838353_839736_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.7	3.5e-70
WP_013955854.1|839816_840764_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	5.5e-14
WP_013955855.1|840792_841788_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.4	1.6e-27
WP_080569532.1|841943_842330_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013955857.1|842567_843869_+	nitrate reductase	NA	Q9KX94	Enterobacteria_phage	64.8	1.0e-143
WP_013955858.1|844004_844907_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	41.7	1.7e-52
WP_013955859.1|844976_846083_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_013955860.1|846232_847156_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.0	1.0e-41
>prophage 3
NC_015726	Cupriavidus necator N-1 chromosome 1, complete sequence	3872936	1180918	1273211	3872936	tRNA,terminase,tail,integrase,protease,transposase,head,plate,holin,portal	Burkholderia_phage(16.13%)	102	1189288:1189304	1199081:1199097
WP_013956158.1|1180918_1181584_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013956159.1|1181600_1182173_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013956160.1|1182310_1183195_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_013956161.1|1183243_1184476_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_013956162.1|1184543_1185332_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	31.6	2.6e-25
WP_193351051.1|1185870_1187076_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041227837.1|1187087_1187615_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_013956166.1|1187696_1188746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956167.1|1188742_1191373_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.0	1.0e-25
1189288:1189304	attL	AGGTCGACGTGCCGCGT	NA	NA	NA	NA
WP_013956168.1|1191617_1192898_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.0	5.1e-140
WP_013956169.1|1192905_1193160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080569566.1|1193162_1193636_-	DUF3850 domain-containing protein	NA	A0A191SB19	Nostoc_phage	44.4	2.3e-05
WP_013956171.1|1194021_1194300_-	DUF4031 domain-containing protein	NA	A0A125RNQ7	Pseudomonas_phage	69.8	1.7e-24
WP_013956172.1|1194296_1194578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956173.1|1194570_1194819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956174.1|1194811_1195441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956175.1|1195443_1195914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956176.1|1195910_1196666_-	hypothetical protein	NA	R9TN97	Rhizobium_phage	53.6	8.5e-10
WP_013956177.1|1196687_1198715_-	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	5.6e-32
WP_013956178.1|1198737_1199157_-	hypothetical protein	NA	NA	NA	NA	NA
1199081:1199097	attR	AGGTCGACGTGCCGCGT	NA	NA	NA	NA
WP_013956179.1|1199153_1199513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956180.1|1199523_1199754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158310019.1|1199755_1199893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080569567.1|1199889_1200111_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	68.6	3.1e-21
WP_013956182.1|1200110_1200623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041228332.1|1200909_1201353_-	S24 family peptidase	NA	Q6J1N3	Burkholderia_virus	44.9	1.4e-20
WP_013956185.1|1201729_1201987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271561.1|1202212_1202503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049800548.1|1202536_1202749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956188.1|1202745_1203096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956189.1|1203092_1203506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158310020.1|1203514_1203688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956190.1|1203687_1204755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271610.1|1204766_1205066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956192.1|1205068_1205455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271562.1|1205652_1206096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158310021.1|1206263_1206425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956193.1|1206425_1207016_+	hypothetical protein	NA	A0A0K1Y721	Rhodobacter_phage	37.2	3.9e-34
WP_013956194.1|1207123_1207642_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_013956195.1|1207598_1209647_+|terminase	phage terminase large subunit family protein	terminase	R9TMM4	Vibrio_phage	41.5	7.6e-130
WP_013956196.1|1209659_1209881_+	hypothetical protein	NA	A0A219Y8X9	Aeromonas_phage	54.5	6.9e-05
WP_013956197.1|1209882_1211334_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	40.8	7.9e-81
WP_013956198.1|1211398_1213453_+|head	peptidase U35 phage prohead HK97	head	B7SYD7	Stenotrophomonas_phage	31.1	2.6e-69
WP_013956199.1|1213536_1213869_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013956200.1|1213868_1214171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956201.1|1214167_1214743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956202.1|1214763_1214952_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_013956203.1|1214951_1216433_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	41.1	2.4e-93
WP_013956204.1|1216481_1216847_+|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	9.1e-10
WP_013956205.1|1216846_1217176_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_013956206.1|1217255_1218977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956207.1|1219040_1220204_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	29.9	1.7e-33
WP_013956208.1|1220200_1221400_+|plate	baseplate protein	plate	A0A2P9JZK3	Alteromonadaceae_phage	28.6	9.9e-37
WP_041228340.1|1221420_1221963_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	49.2	6.9e-38
WP_013956210.1|1221962_1222421_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	50.4	3.8e-29
WP_013956211.1|1222422_1223475_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	44.9	1.6e-62
WP_013956212.1|1223465_1224131_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_013956213.1|1224155_1225352_+	hypothetical protein	NA	A0A1D8KLY0	Synechococcus_phage	29.5	3.8e-20
WP_148271611.1|1225666_1226386_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	57.6	4.5e-53
WP_041227841.1|1226643_1227501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956216.1|1227588_1228230_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	56.2	2.1e-57
WP_013956217.1|1228252_1228549_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	51.1	1.6e-17
WP_013956218.1|1228532_1229072_+	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	39.5	1.3e-09
WP_013956219.1|1229091_1229472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956220.1|1229476_1229725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271612.1|1229779_1230364_-	hypothetical protein	NA	A0A291AUV6	Sinorhizobium_phage	46.0	5.3e-28
WP_013956222.1|1230600_1230783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148271564.1|1230843_1231386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041228342.1|1231903_1232338_-	universal stress protein	NA	NA	NA	NA	NA
WP_010808971.1|1232786_1233002_-	YdcH family protein	NA	NA	NA	NA	NA
WP_013956226.1|1233225_1234044_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_013956227.1|1234166_1235066_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_013956228.1|1235371_1236115_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_013956229.1|1236145_1236943_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_013956230.1|1237009_1237510_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	34.0	8.6e-11
WP_013956231.1|1237531_1238116_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_013956232.1|1238187_1238889_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013956233.1|1239172_1240561_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.2	2.0e-41
WP_013956234.1|1240557_1241397_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_010808961.1|1241512_1242484_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_013956235.1|1242581_1243901_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010808959.1|1244024_1245275_+	aspartate kinase	NA	NA	NA	NA	NA
WP_148271565.1|1246011_1249386_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_148271613.1|1249481_1250105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956238.1|1250352_1250532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956239.1|1250732_1254236_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_013956240.1|1254321_1254672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041228345.1|1256794_1258096_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.3	2.1e-56
WP_013956243.1|1258247_1259228_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_013956244.1|1259298_1262865_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_013956245.1|1262956_1263991_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_013956246.1|1263987_1264692_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013956247.1|1264698_1265853_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_013956248.1|1265858_1266149_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_013956249.1|1266366_1266828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956250.1|1266817_1267183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956251.1|1267235_1268207_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_013956252.1|1268240_1269035_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_013956253.1|1269151_1270270_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_013956254.1|1270292_1270643_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_013956255.1|1270639_1272109_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_041228346.1|1272161_1273211_-|transposase	transposase	transposase	Q19ZT4	Mycobacterium_virus	43.3	1.1e-39
>prophage 4
NC_015726	Cupriavidus necator N-1 chromosome 1, complete sequence	3872936	1361981	1371346	3872936	integrase	Burkholderia_virus(42.86%)	12	1354936:1354950	1368973:1368987
1354936:1354950	attL	TTGCCGAAGTGGCGC	NA	NA	NA	NA
WP_013956330.1|1361981_1362392_+	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	40.0	2.9e-12
WP_013956331.1|1362508_1362934_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013956332.1|1363194_1364499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956333.1|1364500_1365619_-|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	46.2	3.2e-82
WP_085959680.1|1365615_1365855_-	DUF4224 domain-containing protein	NA	Q6JIJ7	Burkholderia_virus	51.5	2.0e-10
WP_013956335.1|1365908_1366433_-	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	42.7	2.5e-21
WP_148271566.1|1366443_1366887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013956337.1|1366883_1367516_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	42.9	1.6e-38
WP_148271567.1|1367560_1367800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013956339.1|1367802_1368867_-	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	57.8	3.6e-115
WP_041227854.1|1368902_1369538_+	hypothetical protein	NA	NA	NA	NA	NA
1368973:1368987	attR	GCGCCACTTCGGCAA	NA	NA	NA	NA
WP_013956341.1|1369555_1371346_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	62.7	7.8e-187
>prophage 5
NC_015726	Cupriavidus necator N-1 chromosome 1, complete sequence	3872936	3127944	3137259	3872936	protease	Methanothermobacter_phage(16.67%)	9	NA	NA
WP_013957881.1|3127944_3129147_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.6	9.9e-37
WP_011615967.1|3129218_3129719_+	dUTP diphosphatase	NA	A0A289ZTC1	Serratia_phage	54.2	1.8e-40
WP_013957882.1|3129773_3130622_-	VOC family protein	NA	NA	NA	NA	NA
WP_041228104.1|3130664_3131672_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_013957884.1|3131847_3134142_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.2	3.1e-172
WP_010814998.1|3134138_3134465_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	1.3e-12
WP_010814999.1|3134977_3135184_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.8	1.9e-20
WP_013957885.1|3135397_3135859_-	VOC family protein	NA	NA	NA	NA	NA
WP_013957886.1|3136008_3137259_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	8.8e-12
>prophage 6
NC_015726	Cupriavidus necator N-1 chromosome 1, complete sequence	3872936	3665661	3671722	3872936		uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_013958328.1|3665661_3666249_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.4e-15
WP_013958330.1|3666725_3667634_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.8	1.8e-35
WP_013958331.1|3667721_3668489_-	septal ring lytic transglycosylase RlpA family protein	NA	H2BCY4	Synechococcus_phage	53.2	1.3e-18
WP_013958332.1|3668770_3669421_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013958333.1|3669425_3670082_+	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	40.4	3.9e-35
WP_010812133.1|3670289_3670517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013958334.1|3670600_3670966_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.4	2.4e-18
WP_013958335.1|3671140_3671722_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.8e-20
>prophage 1
NC_015727	Cupriavidus necator N-1 plasmid pBB1, complete sequence	1499175	291536	342405	1499175	integrase,transposase	uncultured_virus(22.22%)	38	305513:305540	325204:325231
WP_080569627.1|291536_292010_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041228990.1|292352_297860_+	AAA family ATPase	NA	Q67624	IC4_retrovirus	27.2	1.3e-06
WP_013958777.1|299759_300440_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013958778.1|300571_301654_+	alkene reductase	NA	NA	NA	NA	NA
WP_013958779.1|301707_302496_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041229179.1|302617_303487_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013958781.1|303492_304494_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
305513:305540	attL	CGTCGTCACACAAATTGCGGAAGACCCA	NA	NA	NA	NA
WP_080569628.1|305831_306107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271735.1|306057_307311_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.0	4.8e-42
WP_013958784.1|307409_307658_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049800699.1|307740_308265_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_013958786.1|308569_309652_-	maleylacetate reductase	NA	NA	NA	NA	NA
WP_013958788.1|309664_310669_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_041228993.1|310829_311768_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148271736.1|312985_313462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013958792.1|313563_314523_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	44.1	4.2e-62
WP_148271737.1|314616_315162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158310033.1|315158_315425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080569629.1|315471_316071_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_013958796.1|316067_317801_+	carbamoyltransferase	NA	A0A1D8KNV1	Synechococcus_phage	30.1	1.8e-31
WP_013958797.1|317775_318642_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_013958798.1|318673_319381_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013958800.1|320742_321897_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013958801.1|322227_322611_-	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	41.7	5.6e-10
WP_013958802.1|322617_322848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013958803.1|323025_324327_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013958804.1|324428_324806_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_013958805.1|324805_325042_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_013958806.1|325274_326453_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	76.2	1.6e-63
325204:325231	attR	CGTCGTCACACAAATTGCGGAAGACCCA	NA	NA	NA	NA
WP_013958809.1|327861_329625_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_041228994.1|329801_331352_+	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
WP_041228995.1|331407_334725_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_013958812.1|334768_337240_+	CoA transferase	NA	NA	NA	NA	NA
WP_013958813.1|337283_338312_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_013958814.1|338499_338850_-	DNA-binding protein	NA	A0A222YXG1	Escherichia_phage	54.7	9.9e-30
WP_013958815.1|338849_339152_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	40.6	4.9e-09
WP_013958816.1|339370_339670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013952233.1|341145_342405_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.7e-39
>prophage 2
NC_015727	Cupriavidus necator N-1 plasmid pBB1, complete sequence	1499175	641603	733417	1499175	integrase,transposase	uncultured_virus(21.43%)	60	641365:641381	660178:660194
641365:641381	attL	TCTTCGAGCGCGACAAC	NA	NA	NA	NA
WP_013959084.1|641603_643235_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q7ZJT6	Amphotropic_murine_leukemia_virus	26.7	1.6e-05
WP_013959085.1|643241_644111_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_013958800.1|644740_645895_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041229029.1|646735_647461_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013959088.1|647571_648552_+	nitrilase	NA	NA	NA	NA	NA
WP_041229030.1|648553_649489_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_041229031.1|650246_651140_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.9	1.1e-05
WP_013959092.1|651294_652911_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.0	3.4e-40
WP_013959093.1|652943_653870_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_099047508.1|654283_655419_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	26.5	4.2e-13
WP_013959098.1|657550_659404_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_041229032.1|659413_659764_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_013959100.1|660023_660947_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
660178:660194	attR	TCTTCGAGCGCGACAAC	NA	NA	NA	NA
WP_148271755.1|661097_662351_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.5	1.8e-41
WP_013959102.1|662755_663649_-	SDR family oxidoreductase	NA	M1HZA6	Acanthocystis_turfacea_Chlorella_virus	23.5	1.0e-09
WP_013959103.1|663753_664587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041229245.1|664780_665470_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_041229033.1|665569_666277_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_013959106.1|666411_667422_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013959107.1|667523_670946_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_013959108.1|671106_672450_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_013959109.1|672632_673343_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_013959110.1|673356_674526_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_158310038.1|674527_674863_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_148271811.1|674904_676773_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_148271756.1|677148_678501_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_013959115.1|678936_679401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959116.1|679435_679792_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_049800717.1|680121_680505_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_041229250.1|680536_680782_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_013959119.1|680973_682206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_041229034.1|682189_682462_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_041229036.1|682730_683846_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_013959122.1|683921_685181_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_148271757.1|685927_686428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013952233.1|686387_687647_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.1	1.7e-39
WP_148271758.1|690078_690678_+	hypothetical protein	NA	Q8LTB7	Lactobacillus_phage	37.4	2.7e-11
WP_013959128.1|691269_692061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959129.1|692087_693929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959130.1|694102_694840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959132.1|696869_697574_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_041229041.1|699856_700891_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_013959138.1|701312_702044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271759.1|702411_703008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041229042.1|704142_704982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080569683.1|705757_706072_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_013959144.1|706147_706906_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_158310039.1|708764_709505_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	31.0	7.3e-06
WP_013959146.1|709510_710065_-	YfbU family protein	NA	NA	NA	NA	NA
WP_080569639.1|711112_711511_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_148271760.1|713184_716349_+	hypothetical protein	NA	Q858S3	Enterobacteria_phage	39.6	1.1e-13
WP_148271761.1|717960_719250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271762.1|720061_722224_+	endonuclease	NA	NA	NA	NA	NA
WP_013959154.1|722869_723595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158310040.1|723756_724308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959157.1|725365_726121_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	24.6	7.9e-08
WP_013959158.1|726253_727735_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.6	2.9e-22
WP_013959160.1|729375_730887_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_049800720.1|731273_731780_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	29.6	3.1e-08
WP_148271735.1|732163_733417_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.0	4.8e-42
>prophage 3
NC_015727	Cupriavidus necator N-1 plasmid pBB1, complete sequence	1499175	740618	786470	1499175	transposase	Acidithiobacillus_phage(25.0%)	37	NA	NA
WP_158310041.1|740618_740789_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_013959172.1|744898_745189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013959173.1|745721_745922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013959174.1|746580_747264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041229260.1|747872_748994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013958589.1|750118_750415_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	40.4	1.3e-11
WP_013959177.1|750411_750999_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.3	2.7e-27
WP_017510466.1|751042_752296_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.0	7.4e-43
WP_041229049.1|753069_753330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041229262.1|753410_755018_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.4	1.2e-66
WP_013954297.1|755073_755427_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013954296.1|755407_755896_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013959180.1|756442_756694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158310042.1|757729_757900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013959184.1|757920_758361_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013959185.1|758388_759672_-	MFS transporter	NA	NA	NA	NA	NA
WP_013959187.1|760158_761580_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013959188.1|761626_762538_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_148271765.1|762673_763465_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013959190.1|763450_763867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959191.1|764026_764308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959193.1|765589_766024_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_013959194.1|766077_767268_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_085959710.1|768067_768649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063712361.1|769112_769763_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_148271766.1|769842_770544_-	helix-turn-helix transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	40.5	2.1e-07
WP_013959201.1|770689_772030_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.9	1.5e-49
WP_013959202.1|772290_772707_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041229052.1|772769_773090_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_012354456.1|773931_774393_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	74.7	9.9e-54
WP_013959204.1|774395_774968_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	65.3	6.7e-68
WP_013959205.1|775312_775681_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_013959206.1|775912_777691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041229053.1|778067_779498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041229054.1|779490_780177_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_013959209.1|780166_783838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041229055.1|784928_786470_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_015727	Cupriavidus necator N-1 plasmid pBB1, complete sequence	1499175	1413924	1438841	1499175	transposase	Wolbachia_phage(40.0%)	23	NA	NA
WP_035827570.1|1413924_1414221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013959773.1|1414469_1414685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959774.1|1414753_1415011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959775.1|1415029_1416325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041229359.1|1416427_1417750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013959777.1|1418008_1418653_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013959778.1|1418655_1419513_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013959779.1|1419681_1420140_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013959780.1|1420057_1420249_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013959781.1|1420815_1422237_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	37.0	5.4e-82
WP_013959782.1|1422276_1423242_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.0	2.7e-08
WP_080569694.1|1424035_1424245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271790.1|1424561_1425344_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_013959784.1|1425349_1426579_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_041228685.1|1426592_1427645_-|transposase	transposase	transposase	A0A0R8V9X2	Thermobifida_phage	35.7	2.1e-30
WP_013959785.1|1427734_1428577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148271791.1|1428748_1430002_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.0	9.7e-43
WP_013959787.1|1430470_1431745_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_148271792.1|1431838_1432087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013959788.1|1435061_1435637_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_013959789.1|1435633_1436167_-	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_013959790.1|1436235_1437657_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	37.7	1.7e-83
WP_013953603.1|1437818_1438841_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
