The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015711	Corallococcus macrosporus, complete sequence	9003593	4261635	4272558	9003593	tRNA	Bacillus_thuringiensis_phage(14.29%)	10	NA	NA
WP_013938647.1|4261635_4264569_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	3.1e-07
WP_013938648.1|4264618_4265614_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	46.0	1.1e-73
WP_013938649.1|4265627_4266482_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	E4ZFQ0	Streptococcus_phage	33.1	2.2e-14
WP_043710562.1|4266485_4266764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013938651.1|4266974_4267619_+	deoxynucleoside kinase	NA	A0A288TXV5	Enterococcus_phage	33.5	4.4e-15
WP_013938652.1|4267783_4268701_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.0	6.2e-47
WP_013938653.1|4268703_4269582_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_043710564.1|4269578_4270067_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.9	5.6e-31
WP_013938655.1|4270100_4270622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043710565.1|4270629_4272558_-	protein kinase	NA	A0A1D6Y713	Golden_Marseillevirus	26.0	1.6e-12
>prophage 2
NC_015711	Corallococcus macrosporus, complete sequence	9003593	6075002	6148693	9003593	tRNA,transposase,bacteriocin	Shigella_phage(20.0%)	54	NA	NA
WP_013940145.1|6075002_6075746_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013940146.1|6075864_6076248_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013940147.1|6076329_6078231_+	chromosome partitioning protein Smc	NA	NA	NA	NA	NA
WP_013940148.1|6078281_6078662_+	YraN family protein	NA	NA	NA	NA	NA
WP_013940149.1|6078674_6079505_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	41.0	3.1e-45
WP_013940150.1|6079542_6080826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043711195.1|6080925_6082092_-	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	40.9	3.1e-11
WP_013940152.1|6082039_6083464_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013940153.1|6083486_6084350_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_013940154.1|6084394_6084871_-	ferritin	NA	NA	NA	NA	NA
WP_013940155.1|6084976_6086674_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_043711197.1|6086910_6088884_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043713290.1|6089558_6090494_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_043711199.1|6091115_6096578_+	myxosortase-dependent M36 family metallopeptidase	NA	NA	NA	NA	NA
WP_013940159.1|6096868_6098548_+	amidase	NA	NA	NA	NA	NA
WP_013940160.1|6098549_6098927_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_013940161.1|6098954_6099680_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_013940162.1|6099847_6100828_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_013940163.1|6100850_6101960_-	DNA topoisomerase IB	NA	A0A0G2Y4T8	Acanthamoeba_polyphaga_mimivirus	30.9	5.4e-37
WP_013940164.1|6102138_6102981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013940165.1|6103096_6105259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013940166.1|6105402_6110961_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_013940167.1|6110969_6111659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013940168.1|6111751_6113545_-	von Willebrand factor type A domain-containing protein	NA	NA	NA	NA	NA
WP_013940169.1|6113689_6114178_+	VOC family protein	NA	NA	NA	NA	NA
WP_013940170.1|6114179_6115301_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_013940171.1|6115321_6116773_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_193364502.1|6116886_6117801_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_123784141.1|6118238_6118517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013940175.1|6118741_6119326_-	DUF3105 domain-containing protein	NA	NA	NA	NA	NA
WP_123784142.1|6119325_6120492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013940177.1|6120737_6122624_+	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_011553608.1|6122739_6122943_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	68.2	2.7e-19
WP_043711208.1|6123031_6125188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193364411.1|6125188_6125908_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_013940180.1|6126118_6126457_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_043711211.1|6126469_6127393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043711212.1|6127415_6127778_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_193364503.1|6128040_6129186_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_013940184.1|6129182_6129890_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_013940185.1|6130114_6132043_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	39.4	2.0e-132
WP_013940186.1|6132211_6132418_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013940187.1|6132516_6132864_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_043711213.1|6133024_6134074_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	32.7	3.1e-26
WP_013940189.1|6134135_6136550_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002639669.1|6136640_6137030_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	47.2	1.3e-17
WP_013940190.1|6137498_6138431_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_086007114.1|6138695_6140106_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.6	9.9e-12
WP_013940193.1|6141028_6142534_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	33.0	4.6e-31
WP_013940194.1|6142530_6143292_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_123784012.1|6144395_6144779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013935611.1|6145209_6146628_-|transposase	ISKra4-like element ISMfu2 family transposase	transposase	NA	NA	NA	NA
WP_013940196.1|6147047_6147446_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013940197.1|6147445_6148693_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.6	4.4e-11
>prophage 3
NC_015711	Corallococcus macrosporus, complete sequence	9003593	7844347	7932534	9003593	protease,transposase,plate,integrase	Agrobacterium_phage(27.27%)	61	7920019:7920035	7945144:7945160
WP_158426458.1|7844347_7845637_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013941359.1|7845772_7845910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043711748.1|7846084_7847305_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_043711749.1|7847706_7852887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043711751.1|7852914_7854762_-	OmpA family protein	NA	NA	NA	NA	NA
WP_013941364.1|7854973_7857238_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.4	6.9e-39
WP_013938713.1|7857417_7858002_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_013941365.1|7857998_7859366_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013941366.1|7859381_7860098_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_043711753.1|7860094_7863790_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_043711755.1|7863791_7864724_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_043711757.1|7864738_7866715_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_013941370.1|7866797_7867292_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013941371.1|7867317_7868802_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013941372.1|7868921_7869413_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013941373.1|7869495_7869891_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_013941374.1|7869927_7871679_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_193364423.1|7871642_7872686_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_043711759.1|7872726_7875384_+	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	34.8	9.1e-99
WP_013941377.1|7875392_7876427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941378.1|7876577_7876943_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_013941379.1|7877006_7877558_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_043711761.1|7877580_7878945_-	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_013941381.1|7879040_7880108_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	2.3e-24
WP_043713548.1|7880104_7880953_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_043711763.1|7880958_7881801_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_013941384.1|7881813_7882824_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013941385.1|7883151_7885746_+	LamG domain-containing protein	NA	NA	NA	NA	NA
WP_043711765.1|7885811_7889249_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	30.0	3.9e-54
WP_013941387.1|7889253_7892667_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	29.3	7.1e-64
WP_013941388.1|7892668_7894963_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	28.0	2.7e-51
WP_013941389.1|7895017_7895599_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	47.3	5.1e-47
WP_043711767.1|7895632_7896124_-	flavin reductase	NA	NA	NA	NA	NA
WP_013941391.1|7896297_7898559_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_043713551.1|7898569_7899031_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_043711769.1|7899027_7899711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941394.1|7899757_7902412_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.9	1.4e-131
WP_013941395.1|7902601_7903036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941396.1|7903109_7903688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043711771.1|7903870_7905334_+	MFS transporter	NA	NA	NA	NA	NA
WP_013941398.1|7905359_7906832_-	glycoside hydrolase family 6 protein	NA	NA	NA	NA	NA
WP_013941399.1|7906961_7908635_-	amidase	NA	NA	NA	NA	NA
WP_123784254.1|7908698_7909766_-	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_043713554.1|7909899_7910784_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043713557.1|7910831_7912787_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	44.5	1.5e-61
WP_013941403.1|7912793_7913750_-	pirin family protein	NA	NA	NA	NA	NA
WP_013941405.1|7915022_7915550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193364514.1|7915960_7917472_+	helicase	NA	NA	NA	NA	NA
WP_013941407.1|7918156_7918687_+	hypothetical protein	NA	NA	NA	NA	NA
7920019:7920035	attL	AGCTACGACGAGCTGCT	NA	NA	NA	NA
WP_013941409.1|7920321_7920963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013941410.1|7920981_7921140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013940198.1|7921986_7923492_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.6	3.9e-30
WP_013941411.1|7924141_7925134_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158426466.1|7925218_7925551_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_123784170.1|7925568_7925943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043711784.1|7926735_7926918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941416.1|7926917_7927478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941417.1|7927480_7927696_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013941418.1|7927692_7928913_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	30.3	3.8e-20
WP_013941419.1|7929326_7930973_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_013941420.1|7931322_7932534_-|transposase	ISAzo13-like element ISMfu1 family transposase	transposase	NA	NA	NA	NA
7945144:7945160	attR	AGCAGCTCGTCGTAGCT	NA	NA	NA	NA
>prophage 4
NC_015711	Corallococcus macrosporus, complete sequence	9003593	8381539	8449859	9003593	transposase,protease	Bacillus_phage(50.0%)	46	NA	NA
WP_013941774.1|8381539_8382448_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013941775.1|8382488_8383394_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_123784180.1|8383407_8384394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941777.1|8384390_8386850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941778.1|8387605_8389024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941779.1|8389141_8389912_+|protease	protease	protease	NA	NA	NA	NA
WP_013941780.1|8389983_8390574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043711960.1|8390570_8391536_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_043713655.1|8391996_8392833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123784181.1|8393957_8395316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043711962.1|8395618_8398348_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013941785.1|8398412_8398862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043711964.1|8398964_8400284_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_158426458.1|8400498_8401788_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_043711966.1|8402032_8403673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941788.1|8403928_8406097_-	serine hydrolase	NA	NA	NA	NA	NA
WP_082207274.1|8406102_8406528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941790.1|8406620_8408069_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_013941791.1|8408214_8408706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941792.1|8408783_8409572_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148281362.1|8409872_8410244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123784182.1|8410396_8410873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123784183.1|8410967_8412842_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_013941420.1|8412907_8414119_+|transposase	ISAzo13-like element ISMfu1 family transposase	transposase	NA	NA	NA	NA
WP_013941617.1|8414162_8414546_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_013941615.1|8414845_8416279_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	38.4	1.0e-27
WP_013941795.1|8416570_8417014_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_043711968.1|8417069_8417684_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043711970.1|8417804_8418191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941798.1|8418359_8418836_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_013941799.1|8418832_8419204_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013941800.1|8419353_8420598_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	28.9	2.0e-40
WP_123784258.1|8420602_8421784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013941802.1|8422426_8424028_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_043711972.1|8424143_8426285_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_043711975.1|8426426_8427908_-	DUF3943 domain-containing protein	NA	NA	NA	NA	NA
WP_013941805.1|8428271_8429159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123784184.1|8429564_8430473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013941807.1|8430487_8431642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082207277.1|8432341_8433793_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_013941810.1|8434556_8435261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082207279.1|8435271_8436177_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_123784026.1|8437889_8444279_-	protein kinase	NA	NA	NA	NA	NA
WP_013941817.1|8446632_8447799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013940207.1|8448744_8449281_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082207356.1|8449322_8449859_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_015711	Corallococcus macrosporus, complete sequence	9003593	8938264	9000341	9003593	portal,tRNA,integrase,terminase,transposase	Acidithiobacillus_phage(15.38%)	46	8952727:8952786	9001182:9001273
WP_013942231.1|8938264_8938885_+|tRNA	tRNA (guanine-N(7)-)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013942232.1|8938992_8940036_+	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	35.4	4.2e-15
WP_043712174.1|8940092_8940509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043712177.1|8940552_8941734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013942235.1|8941781_8942192_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_013942236.1|8942249_8945216_+	exonuclease	NA	X2KQX9	Campylobacter_phage	31.4	3.4e-14
WP_013942237.1|8945228_8945966_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_013942238.1|8945962_8946712_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_123784261.1|8947267_8947870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193364521.1|8948490_8950131_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.9	5.0e-39
WP_013935609.1|8950317_8951100_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	40.2	9.3e-44
WP_013935610.1|8951154_8952726_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
8952727:8952786	attL	CTCCACTCTCCGGTTACTCACGCCACTTCCCTTTCCTTGGGAAGCCAGCGTGGCCTGTCG	NA	NA	NA	NA
WP_013942242.1|8953003_8954551_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	44.7	6.9e-75
WP_013942243.1|8954547_8954742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013942244.1|8954738_8955296_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	32.5	8.7e-12
WP_013942245.1|8955387_8955582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050989266.1|8955574_8958733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082207301.1|8958739_8960263_-	DEAD/DEAH box helicase	NA	A7WKH8	Acidianus_filamentous_virus	28.1	3.1e-27
WP_013942248.1|8960342_8961071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123784189.1|8961076_8961367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013942250.1|8961507_8962278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013942251.1|8963679_8964279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013942252.1|8964409_8965585_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_013942253.1|8965584_8966244_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	28.6	1.7e-06
WP_013942254.1|8966240_8966579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043712180.1|8966554_8967385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158426468.1|8968556_8969114_-	SUKH-3 domain-containing protein	NA	NA	NA	NA	NA
WP_013942257.1|8969280_8969907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013942258.1|8971084_8971699_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_043712182.1|8972650_8973214_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_013942261.1|8974284_8975343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043712187.1|8976183_8978208_+|portal	phage portal protein	portal	A0A0U3E050	Pseudomonas_phage	30.9	9.1e-51
WP_013942265.1|8978204_8978486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013942266.1|8978466_8979549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082207304.1|8979603_8979783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013942267.1|8979775_8981128_+	DNA adenine methylase	NA	L7TJ93	Halovirus	31.3	4.4e-17
WP_013942268.1|8981124_8981817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013940201.1|8984737_8985277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063747621.1|8986405_8987449_+	P63C domain-containing protein	NA	I6NRL3	Burkholderia_virus	52.9	4.1e-95
WP_013942272.1|8988064_8991583_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013942273.1|8991579_8993856_+	gpcr, rhodopsin-like family protein	NA	NA	NA	NA	NA
WP_013942274.1|8994199_8994376_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_193364522.1|8995480_8996416_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	48.8	1.4e-70
WP_043710634.1|8996920_8997949_+	pirin family protein	NA	NA	NA	NA	NA
WP_013938816.1|8998085_8998883_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_013942279.1|8999483_9000341_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	25.6	6.0e-12
9001182:9001273	attR	CGACAGGCCACGCTGGCTTCCCAAGGAAAGGGAAGTGGCGTGAGTAACCGGAGAGTGGAGATGGACCGGCTGCAGGAATTGGTGCGGTTGCA	NA	NA	NA	NA
