The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015703	Runella slithyformis DSM 19594, complete sequence	6568739	3842143	3913996	6568739	integrase,transposase,tRNA,terminase	Trichoplusia_ni_ascovirus(33.33%)	60	3907833:3907881	3914157:3914205
WP_013928967.1|3842143_3842602_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_013928968.1|3842629_3843199_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041340853.1|3843883_3844825_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_013928971.1|3844940_3845531_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_013928972.1|3845947_3847288_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013928974.1|3848282_3849794_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_169704745.1|3849833_3850367_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013928978.1|3850766_3852041_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013928979.1|3852153_3853335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013928980.1|3853684_3854557_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_013928982.1|3854988_3856467_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_013928984.1|3857682_3858843_+	acyltransferase	NA	NA	NA	NA	NA
WP_013928985.1|3858854_3859208_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_013928986.1|3859252_3860608_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_013928987.1|3860867_3861758_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013928988.1|3861893_3862625_+	DUF1080 domain-containing protein	NA	NA	NA	NA	NA
WP_013928989.1|3862621_3864004_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_013928990.1|3864021_3864912_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013928991.1|3865157_3865946_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_013928992.1|3866037_3866850_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_013928993.1|3867245_3868010_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	5.5e-17
WP_041340863.1|3868210_3868486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013928994.1|3868488_3869634_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_013928995.1|3869654_3870971_+	idonate transporter	NA	NA	NA	NA	NA
WP_013928996.1|3871044_3871632_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013928997.1|3871731_3872838_+	FecR family protein	NA	NA	NA	NA	NA
WP_013928998.1|3873025_3876451_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_013928999.1|3876480_3877935_+	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_013929000.1|3877999_3879433_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013929001.1|3879462_3880818_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013929002.1|3880902_3882192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929003.1|3882381_3883809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929004.1|3883944_3885186_+	MFS transporter	NA	NA	NA	NA	NA
WP_013929005.1|3885247_3886114_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_169705133.1|3886278_3886530_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_169704747.1|3886604_3886820_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081469267.1|3888240_3888600_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.3	4.4e-09
WP_013929007.1|3888613_3888835_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013929008.1|3888821_3889154_+	HipA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013929009.1|3889150_3890095_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_081469268.1|3890293_3890707_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_013929010.1|3890642_3892367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929011.1|3892363_3893086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169704749.1|3893218_3893356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041340880.1|3893449_3893728_-	specificity determinant HsdS	NA	NA	NA	NA	NA
WP_013929014.1|3893804_3900041_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_013929015.1|3900361_3901222_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_013929016.1|3901288_3902668_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013929017.1|3902667_3904128_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	26.4	3.6e-25
WP_013929018.1|3904132_3907372_-	type I restriction-modification system endonuclease	NA	NA	NA	NA	NA
3907833:3907881	attL	GTCGGGATAGCGGGATTTGAACCCACGACCCCTTGCCCCCCAGACAAGT	NA	NA	NA	NA
WP_013929019.1|3908061_3909429_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013929020.1|3909527_3910418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929021.1|3910567_3910846_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013929022.1|3910832_3911258_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_169704751.1|3911824_3912277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929025.1|3912470_3912758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929026.1|3912754_3913000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929027.1|3912992_3913190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169704753.1|3913224_3913428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929029.1|3913534_3913996_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
3914157:3914205	attR	GTCGGGATAGCGGGATTTGAACCCACGACCCCTTGCCCCCCAGACAAGT	NA	NA	NA	NA
>prophage 2
NC_015703	Runella slithyformis DSM 19594, complete sequence	6568739	4876977	4956982	6568739	protease,transposase	Methanothermobacter_phage(20.0%)	50	NA	NA
WP_013929869.1|4876977_4877532_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013929870.1|4878730_4879591_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_041343689.1|4879752_4881330_+	serine dehydratase	NA	NA	NA	NA	NA
WP_013929872.1|4881391_4882951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929873.1|4882963_4883800_+	ceramidase domain-containing protein	NA	NA	NA	NA	NA
WP_013929874.1|4883904_4887117_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_013929875.1|4887175_4888714_+	arylsulfatase	NA	NA	NA	NA	NA
WP_013929876.1|4888760_4890080_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_169705163.1|4890126_4890555_-	cytochrome c	NA	NA	NA	NA	NA
WP_013929878.1|4890635_4891274_-	SCO family protein	NA	NA	NA	NA	NA
WP_013929879.1|4891302_4891734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929880.1|4891772_4893464_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_013929881.1|4893538_4893766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929882.1|4893779_4894709_-	DUF4835 family protein	NA	NA	NA	NA	NA
WP_013929883.1|4894742_4895954_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-28
WP_013929884.1|4896035_4896344_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_013929885.1|4896373_4897282_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_013929886.1|4897377_4898004_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_013929888.1|4900532_4901477_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013929889.1|4901674_4903198_+	carboxylesterase family protein	NA	A0A0G2Y6W1	Acanthamoeba_polyphaga_mimivirus	43.0	1.4e-35
WP_169704829.1|4903217_4904510_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_013929891.1|4904600_4905101_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013929892.1|4905097_4906399_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_041341296.1|4906554_4906932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169705165.1|4907255_4909817_+	glycoside hydrolase family 95 protein	NA	NA	NA	NA	NA
WP_013929895.1|4909813_4911970_+	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_013929896.1|4912562_4914770_-	carbohydrate binding family 9 domain-containing protein	NA	NA	NA	NA	NA
WP_041343698.1|4915093_4917073_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_013929898.1|4917382_4917562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929899.1|4917605_4920242_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_013929900.1|4920284_4921154_+	cyanophycinase	NA	NA	NA	NA	NA
WP_013929901.1|4921150_4922083_+	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_013929902.1|4922397_4924425_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_013929903.1|4924434_4926948_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_013929904.1|4926951_4928316_-	putative DNA binding domain-containing protein	NA	A0A088F7M4	Mycobacterium_phage	24.2	6.4e-24
WP_013929905.1|4928312_4929260_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_013929906.1|4929256_4929592_-	HipA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013929907.1|4929578_4929800_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013929908.1|4929911_4933271_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_013929909.1|4933429_4936951_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_013929910.1|4936955_4937549_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_013929911.1|4937551_4938169_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_013929912.1|4938765_4940112_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041341303.1|4942151_4942733_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_013929913.1|4943815_4945027_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	63.1	4.8e-63
WP_013929914.1|4945136_4946852_-	AAA family ATPase	NA	A0A1L3KIW1	Beihai_Nido-like_virus	24.4	6.9e-07
WP_169705167.1|4947260_4947365_+	CRISPR-associated DxTHG motif protein	NA	NA	NA	NA	NA
WP_013929916.1|4951747_4955032_-	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_041341309.1|4955046_4955400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013926237.1|4955635_4956982_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_015703	Runella slithyformis DSM 19594, complete sequence	6568739	4975068	5035054	6568739	integrase,transposase,tRNA	Bacillus_phage(22.22%)	59	4969170:4969186	5028118:5028134
4969170:4969186	attL	ATCCCAGTTTTTTTAGG	NA	NA	NA	NA
WP_013929926.1|4975068_4976310_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013929927.1|4976856_4977957_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013929928.1|4977999_4978731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929929.1|4978849_4980547_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_013929930.1|4980640_4980805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929931.1|4981022_4981778_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	24.4	9.4e-09
WP_013929932.1|4981885_4982362_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_013929933.1|4982408_4983185_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_013929934.1|4983232_4983724_-	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	34.6	1.7e-19
WP_013929935.1|4984038_4986369_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_013929936.1|4986514_4987834_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	22.6	5.3e-07
WP_013929937.1|4987930_4988926_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_013929938.1|4988991_4992738_-	ThuA domain-containing protein	NA	NA	NA	NA	NA
WP_041341320.1|4992892_4993621_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013929940.1|4993788_4995546_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	1.6e-38
WP_013929941.1|4995549_4995999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929942.1|4996270_4996726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929943.1|4996929_4998234_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_013929944.1|4998380_4998506_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_169704833.1|4998822_4999344_+	LemA family protein	NA	NA	NA	NA	NA
WP_013929946.1|4999462_4999948_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013929947.1|4999951_5000584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929948.1|5000633_5001134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929949.1|5001155_5002004_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_013929950.1|5002256_5003075_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_013929951.1|5003118_5003778_-	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_041343712.1|5003884_5005159_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_013929953.1|5005544_5005928_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013929954.1|5006029_5006929_-	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	34.8	9.8e-05
WP_013929955.1|5007078_5007885_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_013929956.1|5008183_5009302_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SL56	Klosneuvirus	26.9	1.7e-19
WP_013929957.1|5009605_5010487_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_013929959.1|5010858_5012046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929960.1|5012150_5012345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929961.1|5012355_5013618_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_013929962.1|5013614_5014883_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	37.7	5.0e-23
WP_041341328.1|5014974_5015235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929964.1|5015337_5015847_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041341332.1|5016018_5016234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929965.1|5017172_5017547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929966.1|5017628_5018204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169704835.1|5018414_5018609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929968.1|5018957_5019749_+|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_041341337.1|5019917_5020418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041341340.1|5021023_5021491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169704837.1|5021798_5022008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081469290.1|5021980_5022244_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_169704839.1|5022637_5023207_+	ATP-binding domain-containing protein	NA	A0A0S0N5C8	Pseudomonas_phage	38.1	4.1e-09
WP_169704841.1|5023430_5024102_+	CRISPR-associated endonuclease Cas6	NA	NA	NA	NA	NA
WP_013929971.1|5024112_5025708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013929972.1|5025711_5026290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041341346.1|5026293_5026833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169704843.1|5027283_5027520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041341355.1|5028613_5029102_+	DUF1887 family protein	NA	NA	NA	NA	NA
5028118:5028134	attR	ATCCCAGTTTTTTTAGG	NA	NA	NA	NA
WP_013929973.1|5029136_5030201_+	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_013928579.1|5030181_5031198_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	42.2	1.9e-65
WP_013929974.1|5031347_5031551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013929976.1|5031915_5033052_-	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013929977.1|5033815_5035054_-|transposase	ISLre2-like element ISRsl1 family transposase	transposase	NA	NA	NA	NA
