The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015578	Treponema primitia ZAS-2, complete sequence	4059867	226880	287352	4059867	protease,transposase,integrase	Catovirus(22.22%)	47	230743:230759	285106:285122
WP_015706407.1|226880_228842_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	46.6	1.9e-109
WP_015706409.1|229041_231918_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
230743:230759	attL	GACAGGGGATACCGGTT	NA	NA	NA	NA
WP_148257205.1|231925_234967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706411.1|234968_238925_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	31.4	2.4e-15
WP_015706412.1|238937_239774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041611338.1|239854_241756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706414.1|241758_243375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174269880.1|243465_244494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706416.1|244554_245904_+	galactokinase	NA	NA	NA	NA	NA
WP_015706417.1|245957_247148_+	DNA polymerase IV	NA	I6RSM4	Salmonella_phage	26.7	8.6e-17
WP_015706418.1|247265_248966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706419.1|248978_250403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041611340.1|250816_251935_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_015706421.1|251927_252545_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_015706422.1|252587_253334_+	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_015706424.1|253909_254401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706425.1|254524_255451_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_148257383.1|255599_255803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706427.1|256791_258108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706428.1|258380_259094_+	hypothetical protein	NA	A0A1V0S9B9	Catovirus	44.2	3.9e-41
WP_015706429.1|259141_259918_+	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	24.5	4.6e-11
WP_015706430.1|259941_260937_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.7	2.0e-14
WP_015706431.1|260933_261893_+	UbiA prenyltransferase family protein	NA	NA	NA	NA	NA
WP_015706432.1|261889_262258_+	EamA family transporter	NA	NA	NA	NA	NA
WP_015706433.1|262263_262938_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_041610964.1|262990_263563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706436.1|263559_264981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706437.1|264980_266288_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_015706438.1|266357_267467_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_148257384.1|267652_268276_+	methyltransferase	NA	NA	NA	NA	NA
WP_015706440.1|268297_269365_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015706441.1|269678_270644_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015706442.1|270686_271607_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_015706443.1|271603_272269_+	sugar transferase	NA	NA	NA	NA	NA
WP_015706444.1|272285_273476_+	UDP-N-acetylglucosamine 4,6-dehydratase	NA	NA	NA	NA	NA
WP_015706445.1|273487_274492_+	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_015706446.1|274488_275949_+	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_015706447.1|275984_277424_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	43.3	7.8e-89
WP_148257206.1|277501_278572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706449.1|278653_279871_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	24.2	7.0e-06
WP_015706450.1|279936_280194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169313397.1|280501_281728_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_169313398.1|281909_283148_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_015706455.1|283285_284350_+	acyltransferase	NA	A9YX16	Burkholderia_phage	24.6	1.5e-15
WP_052299683.1|284521_285469_-|transposase	transposase	transposase	NA	NA	NA	NA
285106:285122	attR	AACCGGTATCCCCTGTC	NA	NA	NA	NA
WP_052299684.1|285432_286065_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015706456.1|286260_287352_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_015578	Treponema primitia ZAS-2, complete sequence	4059867	1585323	1623665	4059867	protease,integrase	Bacillus_virus(12.5%)	31	1589043:1589102	1597005:1597077
WP_015707621.1|1585323_1586577_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.9	6.1e-122
WP_015707622.1|1586560_1587175_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.1	2.5e-52
WP_015707623.1|1587187_1588549_-	trigger factor	NA	NA	NA	NA	NA
1589043:1589102	attL	AGCGGGAAACGGGAGTCGGACCCGCGACATCGACCTTGGCAAGGTCGCGCTCTACCACTG	NA	NA	NA	NA
WP_041611065.1|1589572_1590019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015707624.1|1590343_1592476_+	AAA family ATPase	NA	G9E4I7	Emiliania_huxleyi_virus	32.4	1.6e-05
WP_015707625.1|1592673_1592817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015707626.1|1592931_1593168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015707627.1|1593160_1593586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015707628.1|1593848_1594610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015707629.1|1594623_1596099_-|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
WP_015707630.1|1597813_1598227_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
1597005:1597077	attR	AGCGGGAAACGGGAGTCGGACCCGCGACATCGACCTTGGCAAGGTCGCGCTCTACCACTGAGCTATTCCCGCA	NA	NA	NA	NA
WP_015707632.1|1598550_1601478_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	1.6e-311
WP_052299706.1|1601474_1604993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015707633.1|1605224_1607132_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_015707634.1|1607188_1607392_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_052299707.1|1607422_1608097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015707636.1|1608283_1608748_+	MraZ family transcriptional regulator	NA	NA	NA	NA	NA
WP_015707637.1|1608755_1609706_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_015707638.1|1609702_1609996_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_015707639.1|1610141_1611221_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_041611068.1|1611217_1612354_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_015707641.1|1612346_1613168_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_015707642.1|1613160_1614429_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_041611069.1|1614496_1615741_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_041611070.1|1615741_1616656_+	tyrosine recombinase	NA	G1JX48	Mycobacterium_phage	29.1	3.6e-15
WP_015707645.1|1616663_1617410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015707646.1|1617402_1618383_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_015707647.1|1618389_1620558_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.0	4.3e-91
WP_015707648.1|1620547_1621516_+	tyrosine recombinase	NA	A0A0K2CP59	Brevibacillus_phage	28.1	4.4e-27
WP_015707649.1|1621512_1622085_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_015707650.1|1622084_1623665_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	27.9	3.4e-37
>prophage 3
NC_015578	Treponema primitia ZAS-2, complete sequence	4059867	1833067	1844398	4059867	transposase	Enterobacteria_phage(27.27%)	12	NA	NA
WP_015707812.1|1833067_1834282_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.0	1.8e-49
WP_015707813.1|1834293_1835361_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.9	8.9e-13
WP_015707814.1|1835373_1836393_-	hypothetical protein	NA	E3SJ78	Synechococcus_phage	33.2	5.0e-21
WP_015707815.1|1836404_1837325_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_041611084.1|1837330_1838290_-	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	54.4	3.2e-94
WP_015707817.1|1838282_1839368_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.5	1.3e-133
WP_015707818.1|1839384_1840347_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	49.8	3.8e-87
WP_041611085.1|1840374_1841463_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.8	1.7e-75
WP_015707820.1|1841450_1842338_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	6.9e-35
WP_015707821.1|1842334_1842868_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.0	1.1e-48
WP_015707822.1|1842867_1843743_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.3	2.5e-98
WP_081468708.1|1843750_1844398_-	CatB-related O-acetyltransferase	NA	A0A285PXQ2	Cedratvirus	47.1	4.3e-10
>prophage 4
NC_015578	Treponema primitia ZAS-2, complete sequence	4059867	2125574	2182868	4059867	protease,terminase,portal,capsid,transposase,integrase,head	Hokovirus(28.57%)	19	2122428:2122451	2186528:2186551
2122428:2122451	attL	GGACACGCTCAATGTTTCGCGTGC	NA	NA	NA	NA
WP_015708082.1|2125574_2126795_+|terminase	terminase	terminase	S5VY04	Leptospira_phage	33.6	2.5e-43
WP_015708083.1|2126791_2128021_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_015708084.1|2128024_2128726_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015708085.1|2128719_2129388_+|head,protease	HK97 family phage prohead protease	head,protease	H9YSG6	environmental_Halophage	27.9	3.9e-06
WP_015708086.1|2129456_2130758_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_015708087.1|2130882_2132121_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	21.2	4.6e-05
WP_015708088.1|2132375_2150243_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_015708089.1|2150351_2152667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015708091.1|2152838_2153969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015708092.1|2154053_2169251_-	lipoprotein	NA	NA	NA	NA	NA
WP_015708093.1|2169491_2170757_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015708094.1|2170753_2171158_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_015708095.1|2171347_2171605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015708097.1|2171965_2176516_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.9	4.6e-42
WP_015708098.1|2176505_2179028_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	1.4e-40
WP_015708099.1|2179031_2180321_+	response regulator	NA	A0A2H4N7Z5	Lake_Baikal_phage	38.4	7.4e-38
WP_148257279.1|2180560_2181121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041611118.1|2181117_2181528_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_015707812.1|2181653_2182868_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.0	1.8e-49
2186528:2186551	attR	GCACGCGAAACATTGAGCGTGTCC	NA	NA	NA	NA
>prophage 5
NC_015578	Treponema primitia ZAS-2, complete sequence	4059867	2217486	2301294	4059867	protease,terminase,portal,capsid,transposase,tRNA,integrase,head	Bacillus_virus(27.27%)	48	2219948:2219963	2231553:2231568
WP_015708140.1|2217486_2218791_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_015708141.1|2218859_2219555_-|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_015708142.1|2219535_2220258_-	response regulator transcription factor	NA	NA	NA	NA	NA
2219948:2219963	attL	AAGTACCCCGCCGCCC	NA	NA	NA	NA
WP_041611127.1|2220247_2221498_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_015708144.1|2221494_2222730_-|terminase	terminase	terminase	S5VY04	Leptospira_phage	31.5	1.4e-38
WP_015708145.1|2222732_2223269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015708146.1|2223252_2223579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148257284.1|2223708_2225148_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	24.3	4.0e-08
WP_015708148.1|2225886_2244411_+	hypothetical protein	NA	NA	NA	NA	NA
2231553:2231568	attR	AAGTACCCCGCCGCCC	NA	NA	NA	NA
WP_015708149.1|2244492_2245524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015708150.1|2245501_2249899_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015708151.1|2249917_2251879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015708152.1|2251875_2253201_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_015708153.1|2253206_2253875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015708154.1|2253876_2255142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174269883.1|2255151_2256075_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_169313444.1|2256409_2256856_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.8	1.6e-11
WP_015708157.1|2256887_2257595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041611128.1|2257729_2258962_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_148257285.1|2259057_2260056_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_081468655.1|2260024_2262274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015708162.1|2262384_2262966_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_015708164.1|2263639_2267203_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_015708165.1|2267514_2269047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015708166.1|2269056_2270355_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041611595.1|2270424_2271033_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_015708168.1|2271057_2273616_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.4	1.2e-42
WP_052299714.1|2273677_2277232_+	response regulator	NA	A0A1V0SGX0	Hokovirus	26.8	1.3e-39
WP_015708170.1|2277253_2277958_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015708171.1|2278309_2279359_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_148257448.1|2279521_2281234_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015708173.1|2281226_2282366_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	7.7e-31
WP_015708174.1|2282652_2283735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015708175.1|2283731_2284499_+	HAD family hydrolase	NA	M1HXP3	Paramecium_bursaria_Chlorella_virus	25.3	3.7e-05
WP_015708176.1|2284491_2285262_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_015708177.1|2285308_2287174_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_015708178.1|2287238_2288360_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.6e-28
WP_015708179.1|2288381_2289578_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015708181.1|2290210_2291275_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015708182.1|2291258_2292152_+	ribokinase	NA	NA	NA	NA	NA
WP_015708183.1|2292179_2292881_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.5	4.4e-21
WP_041611604.1|2292942_2293788_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_015708185.1|2293810_2294785_-	hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	30.6	7.6e-19
WP_015708186.1|2294800_2295424_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_015708187.1|2295495_2297352_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_015708188.1|2297352_2299005_+	putative manganese-dependent inorganic diphosphatase	NA	NA	NA	NA	NA
WP_015708189.1|2299263_2300076_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015708190.1|2300238_2301294_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	65.1	1.1e-132
>prophage 6
NC_015578	Treponema primitia ZAS-2, complete sequence	4059867	3433879	3440428	4059867		uncultured_Mediterranean_phage(28.57%)	11	NA	NA
WP_041611237.1|3433879_3434833_+	DUF932 domain-containing protein	NA	A0A1B1INH0	uncultured_Mediterranean_phage	34.3	6.9e-33
WP_041611238.1|3434920_3435469_+	hypothetical protein	NA	A0MN47	Thermus_phage	40.4	1.5e-27
WP_015709155.1|3435541_3435766_+	hypothetical protein	NA	A0A2I7S8R6	Vibrio_phage	47.1	1.5e-07
WP_015709156.1|3435755_3436004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015709157.1|3436005_3436485_+	hypothetical protein	NA	A0A1L7N1D2	Ralstonia_phage	42.9	2.5e-07
WP_015709158.1|3436484_3437363_+	PD-(D/E)XK nuclease family protein	NA	A0A1B1ITH1	uncultured_Mediterranean_phage	29.7	1.2e-28
WP_015709159.1|3437377_3437587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015709160.1|3437586_3437784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015709161.1|3438063_3439125_+	ATP-binding protein	NA	A0A2P1CHM4	Mycobacterium_phage	41.6	4.3e-44
WP_015709162.1|3439197_3439968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015709163.1|3440032_3440428_+	single-stranded DNA-binding protein	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	30.3	6.4e-09
