The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	443049	450416	4972148		Bacillus_phage(50.0%)	8	NA	NA
WP_013782872.1|443049_444501_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	1.7e-19
WP_013782873.1|444494_445178_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	8.4e-33
WP_013782874.1|445245_446976_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_013782875.1|447228_447615_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	9.3e-05
WP_013782876.1|447742_448756_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_013782877.1|448819_449539_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.1	1.7e-92
WP_013782878.1|449538_450009_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	45.8	4.1e-31
WP_013782879.1|450062_450416_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.0	3.4e-22
>prophage 2
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	1897514	1907409	4972148	tRNA	uncultured_Caudovirales_phage(50.0%)	11	NA	NA
WP_013784150.1|1897514_1898180_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.2	1.4e-35
WP_013784151.1|1898306_1898696_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	34.2	1.6e-12
WP_013784152.1|1898695_1899058_+	DsrE family protein	NA	NA	NA	NA	NA
WP_013784153.1|1899057_1899441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013784154.1|1899496_1899844_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_013784155.1|1899916_1900735_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013784156.1|1900917_1902210_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	5.0e-95
WP_041452527.1|1902220_1902604_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	32.6	5.4e-05
WP_013784158.1|1902609_1903944_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.6	1.2e-72
WP_013784159.1|1903954_1904710_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013784160.1|1904715_1907409_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	51.2	7.3e-88
>prophage 3
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	3147841	3156749	4972148		Staphylococcus_phage(16.67%)	6	NA	NA
WP_013785239.1|3147841_3148642_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.2e-25
WP_013785240.1|3148856_3149894_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.1	1.8e-119
WP_013785241.1|3150157_3150646_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	45.5	1.1e-26
WP_013785242.1|3150952_3153586_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.2	1.2e-31
WP_013785243.1|3153764_3155396_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	3.4e-149
WP_013785244.1|3155456_3156749_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.5	1.6e-133
>prophage 4
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	3387290	3397218	4972148	tRNA	Turkeypox_virus(16.67%)	7	NA	NA
WP_148259112.1|3387290_3388637_-	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	32.7	1.9e-44
WP_013785434.1|3388710_3389724_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.9	4.1e-108
WP_012517258.1|3390260_3390476_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013785435.1|3390826_3391273_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	42.5	6.1e-24
WP_013785436.1|3391414_3393196_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.7	4.6e-46
WP_013785437.1|3393520_3395347_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.0	1.3e-35
WP_013785438.1|3395598_3397218_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.2	2.3e-36
>prophage 5
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	3771896	3838585	4972148	protease,integrase	Erysipelothrix_phage(23.08%)	56	3837590:3837609	3842010:3842029
WP_013785767.1|3771896_3772781_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_013785768.1|3772798_3773479_+	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_013785769.1|3773510_3773774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785770.1|3774185_3775232_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_013785771.1|3775203_3775836_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_013785772.1|3775850_3776681_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_013785773.1|3776684_3779225_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_013785774.1|3779276_3779780_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_013785775.1|3779776_3781885_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_013785776.1|3781921_3782287_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	41.9	1.8e-13
WP_083820162.1|3782346_3783600_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.8	4.8e-10
WP_013785778.1|3783812_3784550_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_013785779.1|3784724_3785414_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	5.3e-27
WP_013785780.1|3785410_3786805_+	sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.0	4.0e-05
WP_013785781.1|3786850_3788122_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_041452599.1|3788140_3790195_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013785783.1|3790314_3790488_-	DUF2986 domain-containing protein	NA	NA	NA	NA	NA
WP_013785784.1|3791341_3792619_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013785785.1|3792633_3793365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785786.1|3793416_3795066_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013785787.1|3795463_3796042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785788.1|3796508_3797594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785790.1|3799615_3800992_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013785791.1|3801513_3802092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785792.1|3802088_3802781_-	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_013785793.1|3802900_3803302_+	DNA polymerase V	NA	A0A1L5C2A3	Pseudoalteromonas_phage	50.0	1.0e-17
WP_013785794.1|3803301_3804558_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.4	2.1e-82
WP_013785795.1|3804692_3804884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148259119.1|3805037_3806078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785797.1|3806634_3807297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785798.1|3807618_3808536_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_013785799.1|3808528_3810556_+	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	31.6	2.1e-10
WP_013785800.1|3810571_3811033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785801.1|3811080_3811545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785802.1|3811646_3812060_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_013785803.1|3812124_3812439_+	viroplasmin family protein	NA	NA	NA	NA	NA
WP_013785805.1|3813107_3814049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785806.1|3814050_3815163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785807.1|3815451_3816798_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.0	1.3e-21
WP_013785809.1|3817151_3817520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148259120.1|3818441_3819308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785811.1|3819355_3819586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785812.1|3819691_3819952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785813.1|3820330_3820948_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_013785814.1|3821325_3824439_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	32.3	1.9e-127
WP_148259193.1|3824449_3826321_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.9	3.6e-118
WP_013785816.1|3826359_3827073_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_013785817.1|3827129_3830411_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	43.6	7.4e-244
WP_013785818.1|3830663_3831056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785819.1|3831094_3831418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785820.1|3831525_3831852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785821.1|3831992_3833744_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041453080.1|3833953_3835015_+|integrase	site-specific integrase	integrase	G8C7K6	Escherichia_phage	31.1	1.3e-35
WP_041453081.1|3835894_3836659_+	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	42.5	3.1e-36
WP_013785824.1|3836672_3837473_+	hypothetical protein	NA	NA	NA	NA	NA
3837590:3837609	attL	ACCTTCCCCTCTTTTCGCTT	NA	NA	NA	NA
WP_013785825.1|3837643_3838585_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_013785825.1|3837643_3838585_-|integrase	integrase	integrase	NA	NA	NA	NA
3842010:3842029	attR	AAGCGAAAAGAGGGGAAGGT	NA	NA	NA	NA
>prophage 6
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	3964319	4001969	4972148	transposase	Leptospira_phage(60.0%)	45	NA	NA
WP_013785938.1|3964319_3965375_-|transposase	transposase	transposase	I4AZM3	Saccharomonospora_phage	35.3	1.1e-20
WP_013785939.1|3965666_3966194_+	hypothetical protein	NA	A0A291LAD4	Escherichia_phage	34.6	8.5e-09
WP_013785940.1|3966385_3966637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785941.1|3966648_3966951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785942.1|3967192_3967630_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_013785943.1|3967626_3968091_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_013785944.1|3968318_3968507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785945.1|3968693_3970091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013785947.1|3970416_3970659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031214864.1|3970674_3971448_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_013785949.1|3971450_3971822_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_013785950.1|3971911_3972580_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158306776.1|3972624_3973650_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013785952.1|3973646_3976688_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	19.8	3.3e-20
WP_013785953.1|3976772_3977387_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_013785954.1|3977598_3977832_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_013784042.1|3978055_3979360_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_148259196.1|3979990_3981169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013785956.1|3981239_3981728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785957.1|3981870_3982071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785959.1|3982308_3982713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785960.1|3982869_3983019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785961.1|3983029_3983179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785963.1|3983718_3984408_+	TrhE protein	NA	NA	NA	NA	NA
WP_013785964.1|3984397_3985477_+	TrhK protein	NA	NA	NA	NA	NA
WP_013785965.1|3985476_3986856_+	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_013785966.1|3986858_3987347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041452604.1|3987612_3987885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785969.1|3988088_3988355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785971.1|3988509_3989568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785972.1|3989900_3990323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785973.1|3990377_3990704_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_148259122.1|3990743_3991178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785975.1|3991216_3991468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785976.1|3991490_3991658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785977.1|3992044_3992419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148259123.1|3992677_3993064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013785979.1|3993069_3993468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785980.1|3996647_3997163_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013785981.1|3997363_3997972_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_013785982.1|3998172_3999018_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_013785983.1|3999555_3999720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013785984.1|3999745_4000036_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_013785985.1|4000032_4000377_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.2	5.9e-19
WP_013785986.1|4000466_4001969_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.4	1.1e-77
>prophage 7
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	4232412	4240413	4972148		Enterobacteria_phage(42.86%)	7	NA	NA
WP_013786177.1|4232412_4233819_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	M1I5E1	Acanthocystis_turfacea_Chlorella_virus	40.3	7.1e-18
WP_013786178.1|4233905_4235072_-	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.0	2.2e-110
WP_041452622.1|4235135_4236878_-	glycosyltransferase	NA	A0A1V0S9B9	Catovirus	23.2	7.7e-06
WP_013786180.1|4236960_4238040_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.1e-95
WP_013786181.1|4238058_4238919_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	1.7e-35
WP_013786182.1|4238928_4239474_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.5	1.9e-51
WP_013786183.1|4239534_4240413_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.9	3.7e-97
>prophage 8
NC_015554	Alteromonas naphthalenivorans, complete sequence	4972148	4706274	4770756	4972148	integrase,tRNA,transposase	Shigella_phage(27.27%)	55	4724068:4724082	4744495:4744509
WP_041452637.1|4706274_4707141_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_013786595.1|4708691_4709114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786596.1|4709172_4711017_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_013786597.1|4711079_4711367_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_041453189.1|4711359_4711713_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	41.7	3.8e-05
WP_013786599.1|4711897_4713127_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	38.0	7.0e-62
WP_013786600.1|4713354_4714995_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.4	8.1e-183
WP_013786601.1|4715035_4715326_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	4.5e-12
WP_013786602.1|4715545_4716076_-	FxsA family protein	NA	NA	NA	NA	NA
WP_013786603.1|4716277_4718176_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_148259205.1|4718234_4719056_+	M23 family metallopeptidase	NA	A0A1W6JQH9	Corynebacterium_phage	39.5	5.2e-13
WP_013786605.1|4719342_4719783_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_013786606.1|4719797_4720262_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_013786607.1|4720276_4721620_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_013786608.1|4722083_4723022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786609.1|4723272_4723665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786610.1|4723731_4724160_-	TIGR03643 family protein	NA	NA	NA	NA	NA
4724068:4724082	attL	TTTTGAAGAATGCTC	NA	NA	NA	NA
WP_013786611.1|4724244_4726377_-	VRR-NUC domain-containing protein	NA	A0A0A7RWA3	Clostridium_phage	32.1	2.0e-19
WP_041452638.1|4726580_4726772_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_013786613.1|4726764_4727448_+	flavin reductase	NA	NA	NA	NA	NA
WP_013786614.1|4727694_4727988_+	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_013786615.1|4728072_4729722_-	amidase	NA	NA	NA	NA	NA
WP_013786616.1|4730476_4731769_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013786617.1|4731755_4733507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786618.1|4733506_4735501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786619.1|4735484_4735877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786620.1|4736133_4736274_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_007105030.1|4736675_4737782_-	FUSC family protein	NA	NA	NA	NA	NA
WP_034821493.1|4737912_4738434_-	cytochrome b	NA	NA	NA	NA	NA
WP_007105033.1|4738530_4739481_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_013786623.1|4739544_4740339_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007105035.1|4740384_4741206_-	dioxygenase	NA	NA	NA	NA	NA
WP_007105036.1|4741324_4742236_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013782552.1|4742368_4743133_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.3	1.7e-58
WP_013786626.1|4745570_4746338_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
4744495:4744509	attR	TTTTGAAGAATGCTC	NA	NA	NA	NA
WP_013786627.1|4746614_4747496_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_013786628.1|4747731_4748730_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_012520109.1|4748760_4749054_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_013786629.1|4749135_4750734_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	1.9e-75
WP_013786630.1|4751552_4752368_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013786631.1|4752409_4753723_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_013786632.1|4753842_4754589_-	CBM9 family sugar-binding protein	NA	NA	NA	NA	NA
WP_013786633.1|4754679_4755636_+	ion transporter	NA	NA	NA	NA	NA
WP_013786634.1|4755742_4756648_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_013786635.1|4757068_4757302_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.4	3.5e-15
WP_013786636.1|4757334_4757622_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.4	3.9e-16
WP_013786637.1|4757767_4760884_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_148259138.1|4760880_4761957_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013786639.1|4762128_4762701_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013786640.1|4762693_4763545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013786641.1|4764699_4765983_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013786642.1|4765957_4766653_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013786643.1|4766676_4767900_-	pyridoxal-dependent decarboxylase, exosortase A system-associated	NA	NA	NA	NA	NA
WP_041453197.1|4767910_4769533_-	acyl-CoA ligase (AMP-forming), exosortase A system-associated	NA	A0A1V0SBX8	Catovirus	20.4	6.9e-09
WP_013782999.1|4769634_4770756_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
