The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015519	Tepidanaerobacter acetatoxydans Re1, complete sequence	2759867	937059	989680	2759867	protease,tRNA,transposase	Erysipelothrix_phage(18.18%)	54	NA	NA
WP_015295119.1|937059_937542_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_013777964.1|937610_939659_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.0	5.3e-14
WP_013777965.1|940019_940166_+	TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_013777966.1|940313_942023_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013777967.1|942178_943561_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.2	3.4e-105
WP_013777968.1|944038_944344_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013777969.1|944340_945075_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.4	2.2e-23
WP_013777970.1|945071_945809_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013777971.1|945932_946730_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013777972.1|946817_947897_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013777973.1|948064_948343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777974.1|948521_949289_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013777975.1|949725_950121_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_013777976.1|950090_950411_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013777978.1|951493_952741_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_013777979.1|952744_953401_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_013777980.1|953415_954537_+	SAVED domain-containing protein	NA	Q858S3	Enterobacteria_phage	31.4	1.0e-06
WP_013777982.1|955702_955984_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013777983.1|956990_959996_+	DEAD/DEAH box helicase family protein	NA	U6E9C9	Streptococcus_phage	23.1	4.7e-11
WP_013777984.1|960403_961540_+	Abi family protein	NA	NA	NA	NA	NA
WP_013777985.1|961572_962328_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013777986.1|962302_963277_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	9.8e-27
WP_013777987.1|963279_963735_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_013777988.1|963738_964602_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.0	4.5e-23
WP_015295135.1|964862_965375_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048894704.1|965476_966238_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048894705.1|966336_966618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295138.1|966569_967712_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_144312818.1|967672_967819_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_013777991.1|969830_970478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777992.1|970481_970793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777993.1|970997_971795_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013777994.1|971987_972662_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	2.6e-34
WP_013777995.1|972649_973834_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_013777996.1|973893_974769_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	1.4e-19
WP_013777997.1|974771_975851_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013777998.1|975847_976519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013777999.1|977417_978914_+	ABC-F type ribosomal protection protein Lsa(E)	NA	A0A2H4UUX5	Bodo_saltans_virus	26.8	1.7e-25
WP_013778000.1|978907_979402_+	nucleotidyltransferase family protein	NA	A0A2K5B286	Erysipelothrix_phage	84.8	7.8e-81
WP_015295145.1|979876_980410_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013778002.1|980590_981142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778003.1|981250_981424_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_015295146.1|981708_982476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778004.1|982794_983379_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_023211414.1|983398_983863_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015295148.1|983859_984678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013778005.1|984693_985398_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013778006.1|985667_985811_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_013778007.1|985870_986527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778008.1|986844_987231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778009.1|987297_987429_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_013778010.1|987544_988363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778011.1|988428_988653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013778012.1|988729_989680_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_015519	Tepidanaerobacter acetatoxydans Re1, complete sequence	2759867	1080515	1110461	2759867	capsid,portal,terminase,head,transposase,integrase,tail	Paenibacillus_phage(10.71%)	48	1083770:1083829	1110552:1110638
WP_013778088.1|1080515_1081220_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.0	6.1e-10
WP_015295215.1|1081532_1083653_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.0	1.4e-73
1083770:1083829	attL	TTTGGTAGCCATAGGGGGATTCGAACCCCCGTTACCGCCGTGAGAGGGCGGCGTCCTGAA	NA	NA	NA	NA
WP_013778090.1|1083921_1084320_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	43.8	9.3e-16
WP_144312819.1|1084636_1085521_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	43.4	3.1e-56
WP_013778092.1|1085668_1086064_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	34.3	3.1e-11
WP_013778093.1|1086248_1086506_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013778094.1|1086606_1086813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778095.1|1086804_1086978_-	hypothetical protein	NA	A0A090DBW4	Clostridium_phage	44.6	8.4e-06
WP_013778096.1|1087077_1087311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778097.1|1087303_1087459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778098.1|1087524_1088181_+	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	40.2	1.1e-32
WP_013778099.1|1088257_1088617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778100.1|1088617_1088995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778101.1|1089094_1089895_+	phage replisome organizer N-terminal domain-containing protein	NA	D2JGK4	Staphylococcus_phage	60.8	3.9e-37
WP_023211444.1|1089888_1091190_+	AAA family ATPase	NA	A0A097BYG3	Leuconostoc_phage	31.0	2.7e-40
WP_013778103.1|1091234_1091459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778104.1|1091496_1091682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778105.1|1091711_1091885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778106.1|1091884_1092130_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_013778107.1|1092122_1092512_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	64.0	6.7e-35
WP_154646181.1|1092513_1092663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778109.1|1092790_1093147_+	hypothetical protein	NA	E5DV93	Deep-sea_thermophilic_phage	42.1	1.2e-09
WP_013778110.1|1093253_1093442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778111.1|1093438_1093618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778112.1|1093810_1094224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778113.1|1094329_1094734_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AN56	Paenibacillus_phage	47.8	2.2e-25
WP_013778114.1|1094770_1094950_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_013778115.1|1095138_1095468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778116.1|1095542_1096265_+	hypothetical protein	NA	A0A0A8WFS6	Clostridium_phage	53.9	5.7e-56
WP_013778117.1|1096254_1097508_+|terminase	PBSX family phage terminase large subunit	terminase	S6AVV7	Thermus_phage	47.4	4.9e-103
WP_013778118.1|1097521_1098964_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	47.2	1.5e-116
WP_013778119.1|1098995_1100537_+|capsid	minor capsid protein	capsid	A0A1X9I626	Streptococcus_phage	33.0	1.8e-70
WP_013778120.1|1100523_1100736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778121.1|1100799_1101534_+	hypothetical protein	NA	Q9AYX4	Lactococcus_phage	30.7	5.7e-19
WP_013778122.1|1101661_1101949_+	hypothetical protein	NA	A0A1J1JCG1	Escherichia_phage	45.4	1.8e-13
WP_013778123.1|1102060_1102627_+	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	42.0	9.1e-25
WP_013778124.1|1102646_1103591_+	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	56.9	5.5e-91
WP_013778126.1|1103765_1104068_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD74	uncultured_Caudovirales_phage	35.8	4.3e-05
WP_013778127.1|1104072_1104405_+	hypothetical protein	NA	A0A2H4J6Q5	uncultured_Caudovirales_phage	37.6	5.2e-12
WP_013778128.1|1104401_1104929_+	HK97 gp10 family phage protein	NA	A0A059NT55	Lactococcus_phage	36.0	6.1e-23
WP_013778129.1|1104928_1105282_+	hypothetical protein	NA	M1NSH7	Streptococcus_phage	39.5	7.4e-17
WP_013778130.1|1105299_1105725_+|tail	tail protein	tail	Q6SE73	Lactobacillus_prophage	31.2	4.2e-06
WP_013778131.1|1106144_1106633_+	hypothetical protein	NA	A0A290GDU0	Caldibacillus_phage	45.8	9.9e-20
WP_173391429.1|1106660_1107569_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.5	8.6e-33
WP_013778132.1|1107577_1107862_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144312820.1|1107955_1108129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778133.1|1108160_1109054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013778134.1|1109567_1110461_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	31.9	4.1e-19
1110552:1110638	attR	TTTGGTAGCCATAGGGGGATTCGAACCCCCGTTACCGCCGTGAGAGGGCGGCGTCCTGAACCCCTAGACGATATGGCCGTGGCTGCG	NA	NA	NA	NA
>prophage 3
NC_015519	Tepidanaerobacter acetatoxydans Re1, complete sequence	2759867	2466061	2556135	2759867	capsid,portal,bacteriocin,protease,terminase,head,holin,tRNA,transposase,integrase,tail	Erysipelothrix_phage(20.45%)	94	2493995:2494018	2526494:2526517
WP_013779391.1|2466061_2466850_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_013779392.1|2466866_2467208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779393.1|2467729_2468188_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_015295892.1|2468999_2469965_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013779395.1|2469998_2470847_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013779396.1|2470871_2472050_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	2.2e-28
WP_013779397.1|2472467_2473766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779398.1|2474088_2474685_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_013779399.1|2475080_2476418_-	amino acid permease	NA	NA	NA	NA	NA
WP_013779400.1|2476501_2477692_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_013779401.1|2477803_2478004_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	41.7	6.3e-05
WP_013779402.1|2478199_2478511_+	helix-turn-helix transcriptional regulator	NA	S5MTZ5	Brevibacillus_phage	40.7	9.8e-13
WP_023211625.1|2479108_2480419_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	68.3	9.9e-06
WP_023211628.1|2481979_2482561_-	PDC sensor domain-containing protein	NA	NA	NA	NA	NA
WP_081460128.1|2483171_2484941_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_015295905.1|2484943_2485501_-	Regulatory sensor-transducer, BlaR1/MecR1 family	NA	NA	NA	NA	NA
WP_013779404.1|2485516_2485918_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_013779405.1|2486877_2487105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779407.1|2487225_2487501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295909.1|2487603_2487912_-|head,tail	phage gp6-like head-tail connector protein	head,tail	M1PSE8	Streptococcus_phage	45.8	2.9e-09
WP_013779409.1|2488425_2488758_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013779410.1|2488747_2489059_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013779411.1|2489727_2491305_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023211631.1|2491573_2491822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779412.1|2492562_2492931_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013779413.1|2492933_2493224_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013779414.1|2493487_2493766_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013779415.1|2493858_2494239_-	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	46.1	6.1e-25
2493995:2494018	attL	ATATGGTCCACCACTGTTGCCGGG	NA	NA	NA	NA
WP_013779416.1|2497044_2497602_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013779417.1|2497766_2497949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023211634.1|2498060_2498324_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_013779418.1|2498434_2498665_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_013779419.1|2498670_2498985_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_013779420.1|2499302_2501171_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013779421.1|2501532_2502585_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_013779422.1|2502661_2503405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779423.1|2503416_2504274_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	25.0	5.8e-15
WP_013779424.1|2504413_2505076_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	43.0	3.0e-27
WP_013779425.1|2505068_2505479_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	58.5	5.2e-38
WP_013779426.1|2505512_2506610_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	42.6	4.1e-82
WP_013779427.1|2506626_2506758_-	XkdX family protein	NA	NA	NA	NA	NA
WP_013779428.1|2506759_2507137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779429.1|2507151_2508228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779430.1|2508227_2509175_-	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	56.3	4.1e-62
WP_013779431.1|2509189_2510041_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	45.7	1.8e-64
WP_013779432.1|2510051_2512364_-|tail	phage tail tape measure protein	tail	A0A1J0MFP9	Staphylococcus_phage	53.6	1.3e-40
WP_013779433.1|2512544_2513504_-	DUF2726 domain-containing protein	NA	Q4Z8X8	Staphylococcus_phage	35.4	1.8e-49
WP_013779434.1|2513582_2514599_-|tail	phage tail tape measure protein	tail	A0A2H4J669	uncultured_Caudovirales_phage	46.1	2.0e-54
WP_013779435.1|2514646_2514802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779436.1|2514813_2515113_-	hypothetical protein	NA	H0USX2	Bacillus_phage	32.6	6.3e-09
WP_013779437.1|2515130_2515703_-|tail	tail protein	tail	E2ELJ1	Clostridium_phage	44.6	6.4e-34
WP_013779438.1|2515704_2516031_-	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	39.8	1.4e-17
WP_013779439.1|2516027_2516399_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	40.8	4.7e-14
WP_013779440.1|2516391_2516718_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	52.8	2.9e-23
WP_013779441.1|2516714_2517002_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	56.7	1.0e-24
WP_013779442.1|2517045_2518227_-|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	57.2	2.5e-101
WP_013779443.1|2518262_2518952_-|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	51.4	1.9e-56
WP_013779444.1|2518941_2520198_-|portal	phage portal protein	portal	Q2I8F9	Bacillus_phage	55.6	4.0e-137
WP_013779445.1|2520209_2521775_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	74.4	1.2e-228
WP_013779446.1|2521774_2522248_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	72.7	8.1e-59
WP_013779447.1|2522287_2522581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015295921.1|2522798_2522987_-	hypothetical protein	NA	A0A127AWS3	Bacillus_phage	60.7	1.6e-10
WP_013779448.1|2522979_2523741_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	32.3	1.9e-17
WP_013779449.1|2523827_2524127_-	hypothetical protein	NA	A0A2K5B282	Erysipelothrix_phage	59.4	3.3e-26
WP_041591602.1|2524236_2525469_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	60.6	2.8e-143
WP_013779451.1|2525771_2526050_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013779452.1|2526046_2526322_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_013779453.1|2526351_2526738_-	HNH endonuclease	NA	Q38456	Bacillus_phage	51.7	1.6e-25
2526494:2526517	attR	ATATGGTCCACCACTGTTGCCGGG	NA	NA	NA	NA
WP_013779454.1|2526700_2526937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779455.1|2527182_2527614_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_013779456.1|2527603_2527819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779457.1|2527821_2529177_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	60.8	1.7e-162
WP_013779458.1|2529173_2529452_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	61.1	2.5e-23
WP_013779459.1|2529736_2532142_-	virulence-associated E family protein	NA	A0A1S7FZ15	Listeria_phage	51.2	1.7e-237
WP_013779460.1|2532125_2532680_-	DUF3310 domain-containing protein	NA	A0A2K9V2W4	Faecalibacterium_phage	52.5	1.9e-22
WP_013779461.1|2532695_2533364_-	Rha family transcriptional regulator	NA	A0A2K5B268	Erysipelothrix_phage	71.4	8.1e-89
WP_013779462.1|2533363_2533558_-	hypothetical protein	NA	A0A2K5B269	Erysipelothrix_phage	59.3	3.8e-15
WP_013779463.1|2533573_2535532_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	63.3	1.6e-238
WP_013779464.1|2535531_2536065_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	67.0	2.1e-63
WP_013779465.1|2536064_2537225_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	58.4	1.3e-126
WP_013779466.1|2537225_2537507_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	46.1	4.4e-12
WP_013779467.1|2537521_2537773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779468.1|2537791_2538115_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_013779469.1|2538568_2539291_-	ImmA/IrrE family metallo-endopeptidase	NA	E4ZFJ9	Streptococcus_phage	35.3	7.3e-27
WP_013779470.1|2539305_2539674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013779471.1|2539677_2540064_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013779472.1|2540078_2540870_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013779473.1|2541105_2543364_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_013779474.1|2543447_2546447_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_013779475.1|2549293_2550376_-	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_013779476.1|2550506_2551763_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.1	1.0e-12
WP_013779477.1|2551826_2553434_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	8.3e-156
WP_013779478.1|2553633_2554272_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_013779479.1|2554425_2556135_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
