The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017223	Bordetella pertussis CS, complete sequence	4124236	27282	70036	4124236	tRNA,transposase	Synechococcus_phage(50.0%)	41	NA	NA
WP_010929577.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010929584.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003814410.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_010929588.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929591.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929592.1|53622_54357_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54362_54953_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54977_55667_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55663_56425_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56504_57404_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57497_58448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59248_60475_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60474_60888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62442_63417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63473_64055_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64067_64370_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64488_65547_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65581_66853_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67482_68664_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929584.1|69085_70036_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_017223	Bordetella pertussis CS, complete sequence	4124236	77634	136108	4124236	tRNA,transposase	Planktothrix_phage(22.22%)	54	NA	NA
WP_005012067.1|77634_78585_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166334.1|78659_79604_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|79600_81475_-	O-antigen biosynthesis protein WlbL	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|82822_83527_-	O-antigen biosynthesis protein WlbI	NA	NA	NA	NA	NA
WP_010929609.1|83523_84696_-	O-antigen biosynthesis protein WlbH	NA	NA	NA	NA	NA
WP_010929610.1|84891_85485_-	O-antigen biosynthesis protein WlbG	NA	NA	NA	NA	NA
WP_010929611.1|85481_86714_-	O-antigen biosynthesis protein WlbF	NA	NA	NA	NA	NA
WP_010929612.1|86731_87991_-	O-antigen biosynthesis protein WlbE	NA	NA	NA	NA	NA
WP_010929613.1|88014_89103_-	O-antigen biosynthesis protein WlbD	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|89110_90211_-	O-antigen biosynthesis protein WlbC	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|90214_90790_-	O-antigen biosynthesis protein WlbB	NA	NA	NA	NA	NA
WP_003807115.1|90793_91846_-	O-antigen biosynthesis protein WlbA	NA	NA	NA	NA	NA
WP_010929615.1|91976_92984_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|92985_94272_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003807124.1|94288_94444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929617.1|94468_95272_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|95268_96135_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|96209_97340_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|97339_98179_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010929620.1|99111_99714_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010929621.1|99743_100397_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|100529_101786_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_010929622.1|101833_102733_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|102808_103084_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|103091_103754_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|103815_104817_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|104831_105380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|105437_106334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|106330_107392_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|107427_108378_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|109277_110471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|110552_111182_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|111243_111927_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|111936_113619_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|113906_114254_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|114344_114662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929632.1|114944_115961_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|116036_116837_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|116833_117709_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010929633.1|117719_119012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|119054_120095_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|120200_121022_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|121122_122073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|122171_123077_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|123073_123907_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|124743_125754_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|125750_126140_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929638.1|127033_128287_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|128377_130078_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|130504_131152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853393.1|131150_132590_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003815905.1|132682_132985_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_010929512.1|133012_133891_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|135157_136108_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_017223	Bordetella pertussis CS, complete sequence	4124236	356083	415552	4124236	tRNA,transposase	Streptococcus_phage(50.0%)	56	NA	NA
WP_005012067.1|356083_357034_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929759.1|357145_357868_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815420.1|357966_358710_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010929760.1|358940_360449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815418.1|360568_361300_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_010929761.1|361344_362805_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929762.1|362829_363309_+	heme-binding protein	NA	NA	NA	NA	NA
WP_003817846.1|363327_364338_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929763.1|364552_365293_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929764.1|365499_366474_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_010929765.1|366470_367421_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929766.1|368469_369108_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_010929767.1|369144_370488_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_010929768.1|370910_371699_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
WP_010929769.1|371836_372511_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010929770.1|372624_374079_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_010929771.1|374081_375620_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010929772.1|375622_375931_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003815204.1|376161_377205_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010929773.1|377293_378178_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003815202.1|378164_378728_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003815201.1|378741_380694_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003815198.1|380690_381827_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_010929775.1|381852_382908_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_010929776.1|382918_384412_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010927138.1|384624_385200_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_010929777.1|385249_385996_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_010929778.1|385995_386898_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010929779.1|387159_387948_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003815191.1|388088_388580_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003815190.1|388576_389320_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_033446211.1|389316_389910_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	5.6e-17
WP_100208326.1|389918_390395_-	YraN family protein	NA	NA	NA	NA	NA
WP_010929780.1|390519_391458_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_010929781.1|391454_392027_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
WP_005012067.1|392023_392974_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927231.1|393110_394028_+	reductase	NA	NA	NA	NA	NA
WP_003815842.1|394024_394273_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_003815840.1|394269_395475_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|395547_396543_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486046.1|396565_397786_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486047.1|397782_398427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929483.1|400157_400967_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|401295_402246_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486048.1|402320_403274_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_014486049.1|403372_404356_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486050.1|404282_404984_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486051.1|405032_405803_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247259.1|405799_406978_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486052.1|407145_408852_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_014486053.1|408848_409745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486054.1|409785_411375_-	rhodanese homology domain-containing protein	NA	NA	NA	NA	NA
WP_003807867.1|411424_412417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|412485_413085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486055.1|413545_414526_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929577.1|414601_415552_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_017223	Bordetella pertussis CS, complete sequence	4124236	467069	545589	4124236	integrase,transposase	Staphylococcus_phage(13.33%)	62	456241:456260	552188:552207
456241:456260	attL	CCTGCAGCTGCGCGGCCGAC	NA	NA	NA	NA
WP_005013747.1|467069_468020_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003821340.1|468016_468679_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_010929831.1|468686_469646_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_010929830.1|469802_470474_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023853155.1|470476_471442_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010929828.1|471949_475078_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_010929827.1|475153_476221_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|476337_477288_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929826.1|477596_478289_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|478662_479163_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_023853391.1|479269_480190_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|480206_480683_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929822.1|480776_482627_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|482682_483441_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|483468_484902_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|484975_485755_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|485767_486601_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|486609_487380_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|487379_488444_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|488595_491223_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|491286_493908_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|494835_495294_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|495572_497816_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|498012_500037_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_010929813.1|500160_501123_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|501334_502474_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|502496_503462_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|503657_504848_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|504861_505107_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|505135_507157_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|507203_508811_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|508911_510081_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|512962_513913_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929807.1|513936_514995_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003818201.1|515069_515444_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|515998_516949_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929833.1|518505_519351_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929834.1|519438_520602_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010929835.1|521020_521992_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929836.1|522030_523458_-	amidase	NA	NA	NA	NA	NA
WP_023853625.1|523577_524369_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929838.1|524487_526941_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
WP_010929839.1|527035_528145_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
WP_010929554.1|528147_529557_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003816025.1|529962_530097_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003816026.1|530192_530564_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003816027.1|530560_530833_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
WP_010927254.1|530881_532573_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_005012067.1|532803_533754_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929840.1|534211_535135_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814626.1|535143_535542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929841.1|535783_537754_+	type III secretion system effector BopC	NA	NA	NA	NA	NA
WP_010929843.1|539240_540230_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|540226_540427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|540539_540881_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_041166319.1|540891_542076_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|542112_542640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|542697_543345_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929849.1|543341_544328_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010926410.1|544331_544514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|544510_544888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|545121_545589_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
552188:552207	attR	CCTGCAGCTGCGCGGCCGAC	NA	NA	NA	NA
>prophage 6
NC_017223	Bordetella pertussis CS, complete sequence	4124236	715067	771161	4124236	tRNA,transposase	Pseudomonas_phage(10.0%)	48	NA	NA
WP_010929956.1|715067_716018_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929957.1|716740_718015_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003807618.1|718101_719184_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_010929958.1|719194_720007_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010929959.1|720043_720370_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_003807624.1|720374_720935_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_003819054.1|721175_722168_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929960.1|722186_723182_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023853194.1|723197_724574_+	FAD binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	37.3	2.4e-18
WP_010929962.1|724566_726948_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_019247263.1|726964_727354_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_020699695.1|727480_727711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|727815_728766_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929963.1|728864_729815_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_003815183.1|729811_730684_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929964.1|731614_732901_+	cytochrome c	NA	NA	NA	NA	NA
WP_010929965.1|732954_733881_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929966.1|733899_734355_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003815177.1|735206_735998_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_003815175.1|736029_736650_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010929967.1|736646_737276_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815172.1|737288_737897_-	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_003815171.1|737893_738883_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_010929968.1|738988_740203_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_010929969.1|742154_743105_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929970.1|744538_745825_+	putative Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_010929971.1|745990_746299_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003807035.1|746299_746965_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	6.7e-11
WP_003807038.1|747005_748796_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_010929972.1|748908_749769_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_010929973.1|749765_750971_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929974.1|750967_751852_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033446233.1|753368_753803_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_014905478.1|753765_754764_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814441.1|754923_755796_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003814443.1|756136_756355_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_010929975.1|756394_757774_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010929976.1|757815_759213_-	amidase family protein	NA	NA	NA	NA	NA
WP_010927038.1|759252_760905_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929977.1|760908_761793_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929978.1|761792_762734_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929979.1|762812_764432_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929980.1|764598_765414_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814459.1|765481_766051_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|766051_767002_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814461.1|767656_768754_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_003814462.1|768787_770053_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005012067.1|770210_771161_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_017223	Bordetella pertussis CS, complete sequence	4124236	832675	886806	4124236	holin,transposase	Ostreococcus_lucimarinus_virus(25.0%)	41	NA	NA
WP_005012067.1|832675_833626_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|834789_836505_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_003814006.1|836515_837007_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010930015.1|837079_838096_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|838263_839043_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003814003.1|839061_839589_-	lipoprotein	NA	NA	NA	NA	NA
WP_003814002.1|839882_840152_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003821234.1|840242_842402_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814000.1|842522_843242_+	lipoprotein	NA	NA	NA	NA	NA
WP_005013747.1|843238_844189_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486060.1|844329_845547_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_010930016.1|845540_846152_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813997.1|846785_847763_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003813996.1|847906_848653_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_010930017.1|848674_849121_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014486061.1|849908_852140_+|holin	choline BCCT transporter BetT	holin	NA	NA	NA	NA
WP_003813993.1|852162_852963_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813992.1|853244_854477_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003813991.1|854587_855577_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930019.1|855607_856996_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003813988.1|858594_859578_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929632.1|859774_860791_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003813987.1|860987_861812_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076879542.1|861889_862813_-	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_010930021.1|862983_864135_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010930022.1|864138_865170_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_010930023.1|865298_866270_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|866294_868379_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003813981.1|868445_869438_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930024.1|869546_870881_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010930025.1|870906_872919_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_023853163.1|872915_874964_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930027.1|875067_875715_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003813974.1|875855_876350_+	azurin	NA	NA	NA	NA	NA
WP_010926969.1|876393_877065_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930029.1|877079_878573_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930030.1|878569_881683_-	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
WP_010930031.1|881695_882802_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930032.1|882925_883594_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|883814_884765_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813960.1|884847_886806_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
>prophage 8
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1040385	1110660	4124236	tRNA,transposase	Enterococcus_phage(14.29%)	60	NA	NA
WP_010929632.1|1040385_1041402_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010926548.1|1042910_1043483_-	chorismate lyase	NA	NA	NA	NA	NA
WP_010930119.1|1043542_1044274_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_029443805.1|1044325_1045243_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930121.1|1046050_1049230_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014486063.1|1049226_1050609_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930123.1|1050678_1050930_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010930124.1|1051075_1051690_-	SCO family protein	NA	NA	NA	NA	NA
WP_019248379.1|1051876_1053991_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_003811948.1|1054066_1054918_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_010930126.1|1054914_1055541_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003817147.1|1055537_1057292_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930127.1|1057584_1060290_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_010930128.1|1060302_1061964_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930129.1|1061976_1063767_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_003817151.1|1063988_1065164_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_005012808.1|1065206_1066157_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930130.1|1066255_1066996_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010930131.1|1067190_1069227_+	transketolase	NA	NA	NA	NA	NA
WP_010930132.1|1069244_1070255_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930133.1|1070372_1071566_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930134.1|1071595_1072369_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930135.1|1072365_1073556_-	acetate kinase	NA	NA	NA	NA	NA
WP_003809454.1|1073581_1074520_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930136.1|1074516_1076865_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_010930137.1|1077019_1077661_-	glutathione transferase	NA	NA	NA	NA	NA
WP_023853531.1|1077764_1078898_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994624.1|1078990_1079143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930138.1|1079174_1079723_-	DinB family protein	NA	NA	NA	NA	NA
WP_003819814.1|1079741_1080227_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930139.1|1080404_1081343_+	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003809467.1|1081345_1081663_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247197.1|1081708_1082653_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010930140.1|1082673_1084149_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_010930141.1|1084333_1084984_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_003809479.1|1085037_1085373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|1085369_1086230_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003819817.1|1086246_1086528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003809486.1|1086601_1086865_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005012067.1|1087108_1088059_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811933.1|1088357_1089095_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_010930143.1|1089530_1089854_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811929.1|1089888_1090449_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003811927.1|1090569_1091445_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003817154.1|1091457_1092405_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_019247393.1|1092506_1092800_+	response regulator	NA	NA	NA	NA	NA
WP_010930144.1|1092826_1094884_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003811919.1|1094898_1095399_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930145.1|1095472_1097179_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_010930146.1|1098042_1099095_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003811911.1|1099147_1099537_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_003817162.1|1099545_1100178_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010930525.1|1100277_1101294_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930148.1|1102082_1103132_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014486064.1|1103128_1104772_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930149.1|1104768_1105656_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003809396.1|1105796_1106270_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930151.1|1106259_1107282_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_015041211.1|1107278_1108706_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930153.1|1109643_1110660_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1114412	1176473	4124236	holin,tRNA,transposase,protease	Catovirus(20.0%)	52	NA	NA
WP_005012808.1|1114412_1115363_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930155.1|1115461_1116598_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|1116594_1117668_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|1117825_1119262_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|1119352_1119994_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010930158.1|1120329_1121346_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930159.1|1121678_1124411_+	pertactin autotransporter	NA	NA	NA	NA	NA
WP_010930160.1|1124477_1125899_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003809431.1|1126162_1126879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809432.1|1126963_1127281_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003819794.1|1127321_1127735_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010930161.1|1127736_1128096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853525.1|1128138_1129683_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930163.1|1129766_1130597_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010930164.1|1130631_1131786_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930165.1|1131828_1132701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486065.1|1132817_1135106_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003809441.1|1136312_1136777_+	barstar family protein	NA	NA	NA	NA	NA
WP_005013747.1|1136803_1137754_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930167.1|1138121_1138898_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_003809638.1|1138942_1139800_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930169.1|1139821_1140838_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014486066.1|1140972_1142013_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930171.1|1142207_1144289_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_010930172.1|1144524_1146018_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003809629.1|1146248_1147043_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003819875.1|1147263_1148622_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010930173.1|1148618_1149461_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_010930174.1|1149479_1151366_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_162096758.1|1151307_1151559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930175.1|1151603_1152236_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003809618.1|1152254_1152857_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|1153008_1153959_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633091.1|1154539_1155247_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003812707.1|1155605_1156592_-	homoserine kinase	NA	NA	NA	NA	NA
WP_010930178.1|1156731_1157745_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005012067.1|1157741_1158692_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812703.1|1158804_1159263_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|1159299_1160613_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_010930180.1|1160630_1161002_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_010930181.1|1160998_1162462_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
WP_010930182.1|1162602_1163331_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010930183.1|1163312_1166162_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1166374_1167325_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930184.1|1167492_1168317_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_010930185.1|1168316_1169195_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930186.1|1170099_1171215_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699602.1|1171243_1172038_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930188.1|1172034_1173900_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_003812436.1|1173978_1174611_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930189.1|1174607_1174910_-	membrane protein	NA	NA	NA	NA	NA
WP_010930190.1|1174952_1176473_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
>prophage 10
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1188181	1248020	4124236	tRNA,transposase	Erysipelothrix_phage(50.0%)	42	NA	NA
WP_005012067.1|1188181_1189132_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930196.1|1189266_1193193_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_023995083.1|1196025_1196889_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_019248398.1|1196888_1197857_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816844.1|1197926_1198772_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003812405.1|1198839_1199394_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_010930198.1|1199440_1200391_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248935.1|1200489_1201113_-	serotype 2 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930200.1|1201292_1203575_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930201.1|1203729_1206426_-	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930202.1|1206551_1207040_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813631.1|1209450_1212321_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930204.1|1212366_1213581_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813626.1|1213810_1215238_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_023853245.1|1215335_1216427_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_010930206.1|1216439_1217198_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003813621.1|1217285_1218188_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1218184_1219135_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930207.1|1219264_1220248_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813618.1|1220302_1221025_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930208.1|1221492_1222443_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930209.1|1223164_1223698_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003813612.1|1223690_1224653_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003813609.1|1224746_1227224_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003813607.1|1227340_1227649_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_010930210.1|1229293_1229620_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1229768_1230719_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930211.1|1230728_1232084_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930212.1|1232164_1234540_-	RNA-binding transcriptional accessory protein Tex	NA	NA	NA	NA	NA
WP_010930213.1|1234704_1236780_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_003813594.1|1236841_1237642_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930214.1|1237743_1238706_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_019247742.1|1238693_1239449_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930216.1|1239556_1241194_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_003813586.1|1241261_1241999_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_003813585.1|1242101_1242677_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_010930217.1|1242849_1243386_+	iron transporter	NA	NA	NA	NA	NA
WP_003813580.1|1243388_1243733_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930218.1|1243748_1244594_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_003821443.1|1244632_1246012_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003813574.1|1246089_1246971_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_005013747.1|1247069_1248020_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1366994	1435481	4124236	transposase	Planktothrix_phage(33.33%)	58	NA	NA
WP_005012808.1|1366994_1367945_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930283.1|1368713_1369352_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019247793.1|1370241_1370688_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_010930284.1|1370769_1371471_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	1.3e-17
WP_003811277.1|1371471_1372239_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_010930285.1|1372235_1373474_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811272.1|1373473_1374400_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930286.1|1374502_1375618_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015810.1|1375633_1376584_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930287.1|1376937_1377519_-	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_003811267.1|1377515_1378349_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930288.1|1378559_1379873_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811262.1|1380049_1380931_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_003811259.1|1380950_1381802_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_010930289.1|1381854_1382943_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_010930290.1|1383053_1384181_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811244.1|1384415_1385027_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010929584.1|1385125_1386076_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811293.1|1386297_1386675_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003811295.1|1386822_1387320_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_010930291.1|1387316_1387844_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811298.1|1387977_1388793_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930292.1|1388805_1389987_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811301.1|1390034_1390928_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930293.1|1391054_1391525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930294.1|1391650_1392478_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_003811306.1|1392506_1393283_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_023852802.1|1393279_1393555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930295.1|1393569_1394034_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930296.1|1394045_1394747_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003811310.1|1394856_1395357_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930297.1|1395439_1396618_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811313.1|1398245_1398581_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930298.1|1398768_1400217_+	CoA transferase	NA	NA	NA	NA	NA
WP_023852799.1|1400274_1400619_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_003811316.1|1400725_1401265_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012067.1|1401357_1402308_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852768.1|1402406_1402814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247530.1|1403046_1403478_-	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_010930300.1|1403659_1404064_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010930301.1|1405300_1405624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926674.1|1405626_1406514_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003811322.1|1406546_1406972_-	universal stress protein	NA	NA	NA	NA	NA
WP_019247534.1|1407043_1407397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811324.1|1407636_1408143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930302.1|1408181_1409513_-	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_003811326.1|1409572_1410388_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010930303.1|1410384_1411239_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_010930304.1|1414301_1416845_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_010930305.1|1418211_1419966_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_010930306.1|1419962_1422083_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_010930307.1|1422087_1424283_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_010930308.1|1424279_1427621_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_010930208.1|1430423_1431374_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811361.1|1431439_1431619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247449.1|1431735_1432491_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010930310.1|1432477_1433623_-	DUF3182 family protein	NA	NA	NA	NA	NA
WP_010930208.1|1434530_1435481_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1639270	1707355	4124236	tRNA,transposase	Streptococcus_virus(11.11%)	59	NA	NA
WP_010930416.1|1639270_1639759_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010930417.1|1639876_1640455_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1640560_1640929_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929591.1|1641027_1641978_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994932.1|1641984_1643097_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1643783_1644986_+	MFS transporter	NA	NA	NA	NA	NA
WP_004568212.1|1645021_1645168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930420.1|1645189_1647850_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_010930421.1|1647862_1651267_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1651934_1654160_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1654206_1654533_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1654583_1655192_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005013747.1|1655290_1656241_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1656310_1657075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930426.1|1657071_1657671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1657774_1658626_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1658685_1659312_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005012067.1|1659308_1660259_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249265.1|1660357_1661470_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_019248041.1|1661459_1662461_-	imelysin family protein	NA	NA	NA	NA	NA
WP_019247498.1|1662566_1664078_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023853587.1|1664074_1665379_-	imelysin	NA	NA	NA	NA	NA
WP_010930431.1|1665490_1666051_-	membrane protein	NA	NA	NA	NA	NA
WP_010930432.1|1666318_1666873_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930433.1|1667328_1667544_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|1667798_1670396_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930435.1|1670392_1671580_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010930436.1|1672237_1672852_+	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930437.1|1672940_1674068_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_003809954.1|1674079_1674985_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005012067.1|1675877_1676828_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930439.1|1677009_1677762_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003811112.1|1677830_1678490_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003811113.1|1678486_1679215_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
WP_010930440.1|1679227_1681507_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
WP_010930441.1|1681531_1681735_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010930442.1|1681776_1682409_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
WP_010930443.1|1682544_1683462_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010930444.1|1683458_1684172_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_003811135.1|1684409_1685180_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003811137.1|1685184_1685784_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
WP_003811138.1|1686028_1687519_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_010926696.1|1687577_1687862_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930445.1|1687999_1688155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811148.1|1688427_1689354_-	YicC family protein	NA	NA	NA	NA	NA
WP_003811149.1|1689490_1690231_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_010930446.1|1690397_1691774_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003811152.1|1691955_1692861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930448.1|1694512_1696315_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930449.1|1696441_1697083_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_010929584.1|1697181_1698132_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930450.1|1698153_1699374_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_003811164.1|1699559_1700972_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003811167.1|1701035_1702103_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
WP_010930451.1|1702102_1703590_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_010930452.1|1703599_1704544_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811176.1|1704703_1705402_+	pirin family protein	NA	NA	NA	NA	NA
WP_010930453.1|1705479_1706385_+	pirin family protein	NA	NA	NA	NA	NA
WP_005012067.1|1706404_1707355_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1743304	1798895	4124236	transposase	Tetraselmis_virus(25.0%)	47	NA	NA
WP_005012067.1|1743304_1744255_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852967.1|1744807_1746433_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_010930475.1|1746482_1747517_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_010930476.1|1747519_1748866_-	BatD family protein	NA	NA	NA	NA	NA
WP_010930477.1|1748862_1750377_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1750367_1751378_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930479.1|1751851_1752793_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930480.1|1752801_1753770_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930481.1|1755309_1756278_+	transporter	NA	NA	NA	NA	NA
WP_010930482.1|1756455_1757445_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010926609.1|1757491_1758250_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930483.1|1758439_1759177_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_005012808.1|1759275_1760226_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816696.1|1760410_1761193_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_003810743.1|1761186_1761888_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003810741.1|1762127_1762730_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|1764056_1765007_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486074.1|1765003_1766560_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_010930486.1|1766552_1767326_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013747.1|1767384_1768335_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1768439_1769387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1769440_1771255_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1771247_1771922_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041166323.1|1772051_1775126_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_010930491.1|1775139_1775439_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1775753_1776377_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010930493.1|1776620_1777490_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1777467_1778412_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1778497_1779424_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1779536_1780316_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1780306_1781503_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|1781533_1782484_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1782705_1783395_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1783459_1784215_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1784266_1785259_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1785268_1786222_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1786337_1787300_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1788701_1789130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1789126_1790077_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_170954298.1|1790370_1791108_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1791531_1792719_-	MFS transporter	NA	NA	NA	NA	NA
WP_019249653.1|1792722_1793103_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1794822_1795794_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1795807_1796521_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1796525_1797443_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1797549_1797846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|1797944_1798895_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_017223	Bordetella pertussis CS, complete sequence	4124236	1806191	1869157	4124236	tRNA,transposase	Klosneuvirus(12.5%)	55	NA	NA
WP_005013747.1|1806191_1807142_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247780.1|1807185_1807728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930513.1|1807825_1808674_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_004568494.1|1808666_1809173_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	38.4	3.4e-07
WP_010930515.1|1809169_1810171_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_010930516.1|1810183_1810978_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930517.1|1811026_1812928_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003810992.1|1812924_1813548_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_003816541.1|1813674_1814799_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930518.1|1815179_1816784_+	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
WP_010930519.1|1816939_1817716_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
WP_010930520.1|1817800_1818799_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930521.1|1818795_1819569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930522.1|1820553_1821504_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930523.1|1821541_1822129_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
WP_003811007.1|1822146_1822530_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_003811011.1|1823889_1825182_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_010930524.1|1825316_1826357_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
WP_010930525.1|1826454_1827471_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003811015.1|1827738_1828386_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010930526.1|1828511_1829270_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
WP_019247478.1|1829254_1830034_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_003811022.1|1830051_1830936_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_004568488.1|1830932_1831712_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_010930528.1|1831816_1832416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930529.1|1832704_1833457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003816525.1|1833575_1834976_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
WP_003816523.1|1834999_1835398_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003811035.1|1835573_1835774_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_010930530.1|1835912_1836641_+	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
WP_003816520.1|1836774_1838190_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_003816518.1|1838193_1839057_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004568486.1|1839069_1839819_-	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
WP_019247881.1|1840001_1842017_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019247882.1|1841998_1842667_-	arylesterase	NA	NA	NA	NA	NA
WP_005012067.1|1843441_1844392_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813572.1|1844540_1844879_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003813570.1|1844936_1845098_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_003813568.1|1845129_1845330_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010930533.1|1845595_1848169_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_019247811.1|1848239_1850789_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_010930535.1|1853339_1853828_+	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_029443743.1|1853919_1855071_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004566336.1|1855124_1855946_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_010930537.1|1855984_1857214_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004566334.1|1857342_1857783_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1857893_1858844_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930538.1|1858840_1859314_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446178.1|1859475_1860414_+	membrane protein	NA	NA	NA	NA	NA
WP_010930540.1|1860415_1861624_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_010930541.1|1861728_1862235_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930542.1|1862237_1865099_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930543.1|1865088_1866054_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_076879626.1|1866113_1868108_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_010930179.1|1868206_1869157_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NC_017223	Bordetella pertussis CS, complete sequence	4124236	2233861	2286052	4124236	transposase	Erysipelothrix_phage(33.33%)	45	NA	NA
WP_010930730.1|2233861_2234812_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930731.1|2235682_2236555_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930732.1|2236632_2237772_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930733.1|2238130_2239387_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_003816691.1|2239392_2239920_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_003816690.1|2239924_2240743_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816687.1|2240742_2241465_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930735.1|2241486_2241801_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930736.1|2241818_2242967_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930737.1|2242997_2243873_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816680.1|2243869_2245189_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_014486081.1|2245261_2246458_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_010930739.1|2246468_2247956_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_010930740.1|2250550_2251450_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852887.1|2251587_2252553_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930800.1|2252651_2253602_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|2253823_2254774_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812024.1|2254770_2255073_-	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_003812026.1|2255232_2255637_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_010930743.1|2255629_2256856_+	NnrS family protein	NA	NA	NA	NA	NA
WP_003812030.1|2256852_2257299_+	membrane protein	NA	NA	NA	NA	NA
WP_003812032.1|2257368_2258151_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_010930744.1|2258192_2259698_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247851.1|2259983_2260817_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930745.1|2262254_2263076_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930746.1|2263094_2263949_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_003812044.1|2263952_2264924_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247855.1|2265608_2265785_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003812172.1|2267309_2267606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930747.1|2267780_2269133_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	8.5e-45
WP_010930153.1|2269275_2270292_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930748.1|2272271_2273285_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010930749.1|2273371_2274277_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812179.1|2274433_2274778_+	exported protein	NA	NA	NA	NA	NA
WP_010930750.1|2274935_2275394_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930751.1|2275407_2277624_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003812183.1|2277620_2278682_+	XdhC family protein	NA	NA	NA	NA	NA
WP_010930752.1|2278710_2279685_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930753.1|2279636_2280455_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
WP_003812191.1|2280467_2281076_-	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930754.1|2281250_2281646_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930755.1|2281664_2283104_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
WP_003812199.1|2283132_2283480_+	GFA family protein	NA	NA	NA	NA	NA
WP_005012067.1|2283498_2284449_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2285101_2286052_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NC_017223	Bordetella pertussis CS, complete sequence	4124236	2312617	2363371	4124236	tRNA,transposase,protease	Staphylococcus_phage(11.11%)	46	NA	NA
WP_005012067.1|2312617_2313568_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930774.1|2313734_2314709_+	membrane protein	NA	NA	NA	NA	NA
WP_003810379.1|2314705_2314849_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_003810383.1|2316470_2317133_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003818560.1|2317135_2317312_+	cytochrome oxidase	NA	NA	NA	NA	NA
WP_010930775.1|2317308_2318247_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_010930776.1|2318338_2319829_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_010930777.1|2319914_2320067_+	lipoprotein	NA	NA	NA	NA	NA
WP_010930778.1|2320080_2320320_+	membrane protein	NA	NA	NA	NA	NA
WP_010930779.1|2320415_2321159_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010930780.1|2321191_2321692_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_170954295.1|2321754_2322714_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.7e-23
WP_003810400.1|2322710_2323472_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930782.1|2323487_2324573_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005013747.1|2324772_2325723_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122784.1|2325682_2326096_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
WP_003816708.1|2326380_2326680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930783.1|2327089_2329372_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
WP_124740709.1|2329837_2330032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930784.1|2330057_2332088_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
WP_006218592.1|2332107_2332320_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003810720.1|2332597_2333137_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023852902.1|2333250_2334546_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
WP_010930786.1|2334622_2335780_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010930787.1|2335963_2336863_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010930788.1|2336881_2338186_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930789.1|2338151_2339258_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003810707.1|2339345_2339582_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930790.1|2339720_2340791_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810703.1|2340794_2342150_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003810701.1|2342176_2343337_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_010930791.1|2343339_2343978_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023995843.1|2343979_2345266_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930793.1|2345324_2346620_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003810693.1|2346626_2347133_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004568542.1|2347129_2348278_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810689.1|2348305_2348731_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_010930794.1|2349053_2351936_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_023852900.1|2352028_2352784_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930796.1|2353549_2354899_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_010929577.1|2354997_2355948_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930797.1|2358688_2359978_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_010930798.1|2360096_2360534_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930799.1|2360577_2361786_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003810867.1|2361932_2362397_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	32.4	3.9e-05
WP_014905945.1|2362420_2363371_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NC_017223	Bordetella pertussis CS, complete sequence	4124236	2745205	2785148	4124236	tRNA,transposase	Salmonella_phage(33.33%)	42	NA	NA
WP_023994583.1|2745205_2745532_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_004567479.1|2745540_2745723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931004.1|2745822_2746419_-	lipoprotein	NA	NA	NA	NA	NA
WP_010931005.1|2746602_2747694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003812822.1|2748193_2748604_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931006.1|2748662_2749004_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.8e-13
WP_010931007.1|2749009_2751427_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010926359.1|2751439_2752462_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_003812832.1|2752536_2752896_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003812834.1|2752911_2753109_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010929584.1|2753444_2754395_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|2754589_2755039_+	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_010929584.1|2755035_2755986_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931008.1|2756096_2757545_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931009.1|2757659_2757941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931070.1|2758044_2758995_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820420.1|2759239_2759953_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019247724.1|2760075_2760303_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003816758.1|2760597_2761236_-	DedA family protein	NA	NA	NA	NA	NA
WP_010931011.1|2761344_2762379_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_010929591.1|2762375_2763326_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931012.1|2763741_2764266_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_004567322.1|2764269_2764539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931013.1|2764737_2765799_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010931014.1|2765882_2767517_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931015.1|2767518_2768322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931016.1|2768350_2769310_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931017.1|2769313_2770828_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248147.1|2770864_2771869_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931018.1|2772300_2772771_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_010931019.1|2772806_2773418_-	LysE family translocator	NA	NA	NA	NA	NA
WP_010931020.1|2773448_2774072_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931021.1|2774152_2775685_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931022.1|2775719_2776961_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931023.1|2777004_2778036_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_010931024.1|2778032_2779202_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931025.1|2779195_2779876_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931026.1|2780037_2780880_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931027.1|2781042_2782014_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931028.1|2782185_2783064_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931029.1|2783086_2784157_-	FUSC family protein	NA	NA	NA	NA	NA
WP_077070120.1|2784197_2785148_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NC_017223	Bordetella pertussis CS, complete sequence	4124236	2839564	2915496	4124236	tRNA,transposase	Moraxella_phage(14.29%)	60	NA	NA
WP_003810909.1|2839564_2839981_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931061.1|2840091_2840724_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_010931062.1|2840752_2841196_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003810897.1|2841217_2842309_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_010931063.1|2842363_2843164_-	aldolase	NA	NA	NA	NA	NA
WP_010931064.1|2843299_2843920_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931065.1|2844059_2844533_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2845672_2846623_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931066.1|2846619_2854281_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
WP_010931067.1|2854521_2858568_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
WP_003816847.1|2858880_2859462_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010931068.1|2859458_2860757_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010931069.1|2860836_2861865_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_005013747.1|2862125_2863076_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931071.1|2863302_2863908_+	fimbrial major subunit FimX	NA	NA	NA	NA	NA
WP_010931072.1|2863961_2865275_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_003813284.1|2865349_2865820_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_010931073.1|2865819_2866608_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_010931074.1|2866618_2868271_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_010929591.1|2868358_2869309_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931075.1|2870470_2870977_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_003813293.1|2870973_2871738_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010931076.1|2871753_2872038_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_003813298.1|2872102_2873092_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_010931077.1|2873263_2874193_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_003813302.1|2874164_2874851_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003813303.1|2874884_2875430_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
WP_003813306.1|2875474_2876740_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003813309.1|2876736_2877639_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_019247679.1|2878820_2879765_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931079.1|2879859_2881377_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931080.1|2881418_2883047_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003811986.1|2883154_2884036_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931081.1|2887148_2887523_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
WP_003812004.1|2887547_2887886_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931082.1|2887929_2889564_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
WP_010931083.1|2889602_2890949_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003812010.1|2891056_2892478_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010931084.1|2892547_2893132_-	nitroreductase	NA	NA	NA	NA	NA
WP_010929591.1|2893234_2894185_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931085.1|2894319_2895426_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931086.1|2895436_2896534_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931087.1|2896678_2897884_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931088.1|2897890_2898412_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010931089.1|2898408_2898900_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003819740.1|2898896_2899148_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003819741.1|2899128_2899614_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010931090.1|2899749_2903211_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_010931091.1|2903228_2904113_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931092.1|2904122_2904554_-	lipoprotein	NA	NA	NA	NA	NA
WP_003809348.1|2904805_2905309_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931094.1|2905386_2906787_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931095.1|2906861_2907737_-	membrane protein	NA	NA	NA	NA	NA
WP_023853546.1|2907733_2908741_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931097.1|2909208_2909514_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003819753.1|2909604_2910195_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930525.1|2910385_2911402_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010931098.1|2911593_2913930_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_003812014.1|2914012_2914447_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010929956.1|2914545_2915496_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NC_017223	Bordetella pertussis CS, complete sequence	4124236	2923521	2980307	4124236	transposase,protease	uncultured_Mediterranean_phage(28.57%)	40	NA	NA
WP_005012067.1|2923521_2924472_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931105.1|2926178_2926445_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003812839.1|2927152_2927491_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931107.1|2932044_2932647_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931108.1|2932743_2934033_+	MFS transporter	NA	NA	NA	NA	NA
WP_003812846.1|2934090_2934822_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931109.1|2934818_2935622_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812851.1|2935618_2936707_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|2936703_2937633_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812857.1|2937781_2938927_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015810.1|2938948_2939899_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931110.1|2940229_2944051_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010931111.1|2944207_2944876_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010931112.1|2944880_2946554_-	MCE family protein	NA	NA	NA	NA	NA
WP_003820402.1|2946572_2947892_-	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_010931114.1|2947896_2950212_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_010931115.1|2950267_2952436_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931116.1|2952432_2957622_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_003820400.1|2957711_2958026_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_003812875.1|2958253_2958499_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820399.1|2958593_2959112_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_010931117.1|2959211_2960417_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_019247560.1|2960532_2961930_-	chloride channel protein	NA	NA	NA	NA	NA
WP_010931119.1|2962046_2962625_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_010931120.1|2962697_2964089_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_010929591.1|2964256_2965207_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812889.1|2965487_2966108_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010931122.1|2966104_2966518_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010931123.1|2966514_2967558_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003812895.1|2967613_2967802_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931124.1|2967811_2968576_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010931125.1|2968666_2969323_+	adenylate kinase	NA	NA	NA	NA	NA
WP_010931126.1|2969414_2970173_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931127.1|2970198_2971800_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931128.1|2972000_2973005_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003812908.1|2973105_2973369_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931129.1|2973486_2974263_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012067.1|2974853_2975804_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931130.1|2978187_2979300_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_041166338.1|2979356_2980307_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NC_017223	Bordetella pertussis CS, complete sequence	4124236	3010693	3053335	4124236	transposase	Planktothrix_phage(33.33%)	38	NA	NA
WP_005012067.1|3010693_3011644_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852715.1|3011764_3012661_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003814547.1|3014938_3017164_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003814544.1|3017328_3018417_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_019247918.1|3018373_3019027_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931144.1|3019074_3019872_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930176.1|3020403_3021354_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931145.1|3021428_3022583_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|3022639_3023590_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814535.1|3023688_3023994_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003820797.1|3024022_3024457_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_010931147.1|3024458_3025703_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820799.1|3025699_3026410_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446288.1|3026424_3027336_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931149.1|3027698_3028103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247890.1|3028099_3028558_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_019247891.1|3028564_3029473_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010931150.1|3029469_3030336_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003814524.1|3030322_3031150_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003820806.1|3031160_3032288_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_023852748.1|3033365_3034604_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931152.1|3034645_3035908_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014486088.1|3035914_3036667_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_019248355.1|3036718_3036904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003820813.1|3037179_3037644_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003820814.1|3037675_3038335_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010931154.1|3038479_3040588_+	AsmA family protein	NA	NA	NA	NA	NA
WP_010931155.1|3040589_3041210_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931156.1|3041301_3042054_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019248356.1|3043188_3044313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247402.1|3044358_3044727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929591.1|3044968_3045919_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|3046954_3047497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930176.1|3047882_3048833_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997028.1|3048829_3049795_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815281.1|3049864_3050701_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931158.1|3051213_3052323_+	porin	NA	NA	NA	NA	NA
WP_005012067.1|3052384_3053335_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NC_017223	Bordetella pertussis CS, complete sequence	4124236	3417728	3472518	4124236	transposase	Staphylococcus_phage(33.33%)	49	NA	NA
WP_010929956.1|3417728_3418679_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931336.1|3419083_3419728_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_019247677.1|3419752_3420337_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_014905506.1|3420437_3421055_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_010931337.1|3421057_3422773_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_010931338.1|3422769_3423078_-	urease subunit beta	NA	NA	NA	NA	NA
WP_003814828.1|3423094_3423712_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_010931340.1|3423756_3424059_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_003814832.1|3424159_3425014_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_124740609.1|3425201_3425426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929281.1|3425595_3425868_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929282.1|3426285_3426693_-	GFA family protein	NA	NA	NA	NA	NA
WP_010931341.1|3427062_3427857_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010927102.1|3427957_3429193_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003814852.1|3429261_3430278_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931342.1|3430289_3431666_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003814856.1|3431662_3432859_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814858.1|3432855_3434394_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_010931343.1|3434390_3435650_-	YeaH/YhbH family protein	NA	NA	NA	NA	NA
WP_005012067.1|3437590_3438541_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3438639_3439590_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931344.1|3440356_3441451_-	CoA transferase	NA	NA	NA	NA	NA
WP_010931345.1|3441443_3442778_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003808193.1|3442731_3443415_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808195.1|3443440_3444604_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004566224.1|3444600_3445602_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931346.1|3445601_3446474_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931347.1|3446470_3447220_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931348.1|3447216_3448008_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931349.1|3448004_3449144_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047122778.1|3449419_3450205_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486103.1|3450238_3451021_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010931351.1|3451024_3451414_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_010931352.1|3452553_3453417_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931353.1|3453452_3454541_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_005013747.1|3454537_3455488_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247959.1|3455841_3458820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818344.1|3459746_3460625_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013747.1|3462573_3463524_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931354.1|3463520_3463988_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_010931355.1|3464030_3464801_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010927090.1|3464821_3465622_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931356.1|3465632_3467042_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003814739.1|3467136_3467922_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930525.1|3468161_3469178_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814742.1|3469285_3469678_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931357.1|3469815_3470496_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023994844.1|3470500_3471472_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_077070462.1|3471567_3472518_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NC_017223	Bordetella pertussis CS, complete sequence	4124236	3478672	3537969	4124236	tRNA,transposase	Acinetobacter_phage(27.27%)	48	NA	NA
WP_003820957.1|3478672_3480436_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931362.1|3480547_3481426_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003814250.1|3481538_3482354_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003814252.1|3482357_3482609_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_010931363.1|3482693_3483710_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814254.1|3484040_3484262_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019247693.1|3486622_3487540_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019247692.1|3488037_3489246_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931365.1|3489325_3490897_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814275.1|3491014_3491950_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003814277.1|3492138_3493083_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814283.1|3493650_3499368_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_010931367.1|3499373_3500501_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814287.1|3500556_3501183_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010929632.1|3501454_3502471_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010927020.1|3502566_3503277_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931368.1|3503273_3504263_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931369.1|3504358_3505990_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931370.1|3505992_3506730_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247745.1|3506885_3507758_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_003814298.1|3508026_3509247_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814300.1|3509243_3509903_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814302.1|3509974_3510607_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010931372.1|3510636_3511155_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010931373.1|3511165_3512275_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814312.1|3512321_3513176_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931374.1|3513177_3514080_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3515302_3516253_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905441.1|3518006_3518996_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247413.1|3518992_3519151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931375.1|3519171_3519960_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_003817833.1|3519956_3520988_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_003815390.1|3521006_3521570_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_010931376.1|3521625_3523146_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_010931377.1|3523409_3524114_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003815384.1|3524121_3524859_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003815381.1|3524964_3525339_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_014486104.1|3525381_3526671_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_010931378.1|3526667_3527837_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_010931379.1|3527833_3528673_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931380.1|3528732_3529668_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_005012067.1|3529680_3530631_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931381.1|3530729_3531692_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_003817821.1|3531723_3532083_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931382.1|3532207_3533110_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_010931383.1|3533111_3534884_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815367.1|3534918_3535695_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_014905645.1|3537018_3537969_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NC_017223	Bordetella pertussis CS, complete sequence	4124236	3552907	3611643	4124236	tRNA,transposase	Planktothrix_phage(50.0%)	49	NA	NA
WP_005012808.1|3552907_3553858_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931392.1|3553986_3555120_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931393.1|3555163_3556069_-	hydrolase	NA	NA	NA	NA	NA
WP_023852622.1|3556071_3557772_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931394.1|3557768_3558689_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003817805.1|3558696_3559674_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931395.1|3559732_3560767_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_003815317.1|3562741_3562978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931396.1|3563104_3563968_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815315.1|3564056_3564878_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815313.1|3564957_3565695_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931397.1|3565691_3566684_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003817794.1|3566797_3567460_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931399.1|3567504_3568653_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010931400.1|3570976_3571927_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486105.1|3572267_3573218_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3573316_3574267_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443756.1|3574563_3575061_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_010931403.1|3575103_3576879_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_010931404.1|3576886_3577753_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_019249391.1|3577759_3578494_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931406.1|3579663_3580458_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815296.1|3580747_3581338_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_010931407.1|3581371_3582700_-	amidase	NA	NA	NA	NA	NA
WP_010931408.1|3582774_3583920_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|3584031_3584982_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814437.1|3585713_3586091_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_003814436.1|3586075_3586777_-	membrane protein	NA	NA	NA	NA	NA
WP_010931409.1|3586920_3587613_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_010931410.1|3587612_3588716_-	phosphotransferase	NA	NA	NA	NA	NA
WP_010931411.1|3588825_3591198_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931412.1|3591194_3592754_+	chaperone SurA	NA	NA	NA	NA	NA
WP_010931413.1|3592778_3593576_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931414.1|3593607_3594753_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_003814419.1|3594857_3596300_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_010929184.1|3596302_3597532_-	spore maturation protein	NA	NA	NA	NA	NA
WP_005012808.1|3599669_3600620_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247922.1|3601749_3602307_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247923.1|3602282_3602633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814657.1|3602801_3603596_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_010931416.1|3603592_3604642_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814652.1|3604641_3605331_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003814650.1|3605417_3605915_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_010931417.1|3605946_3607263_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010931418.1|3607279_3608254_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003814643.1|3608290_3608749_-	protein TolR	NA	NA	NA	NA	NA
WP_003814641.1|3608748_3609429_-	protein TolQ	NA	NA	NA	NA	NA
WP_010931419.1|3609431_3609860_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814636.1|3609912_3611643_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
>prophage 25
NC_017223	Bordetella pertussis CS, complete sequence	4124236	3617809	3662814	4124236	transposase,tail,tRNA,terminase,protease	uncultured_Caudovirales_phage(21.05%)	48	NA	NA
WP_010931429.1|3617809_3621766_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931430.1|3621758_3622148_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931431.1|3622144_3622678_-	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931432.1|3622745_3623105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931433.1|3623114_3625727_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931434.1|3625752_3626043_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_003813412.1|3626060_3626390_-|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931435.1|3626399_3626918_-|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_010931436.1|3627172_3627673_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931437.1|3627680_3628103_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931438.1|3628099_3628498_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931439.1|3628494_3628890_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931440.1|3628889_3629090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|3629091_3629574_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931442.1|3629636_3629888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931443.1|3631941_3632544_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_010931444.1|3632666_3632909_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931445.1|3632914_3633970_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931446.1|3633998_3635417_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931447.1|3635419_3636697_-|terminase	terminase large subunit	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_019247942.1|3636683_3637169_-|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_005012067.1|3637808_3638759_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633094.1|3639015_3639705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853179.1|3639697_3639949_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931451.1|3640503_3641115_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_019247378.1|3641186_3641393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3641644_3642595_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931453.1|3642693_3643494_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_003814185.1|3643555_3643939_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931454.1|3643950_3645384_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-52
WP_003814188.1|3645590_3645920_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_010931455.1|3645922_3646672_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010931456.1|3646854_3647775_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003814195.1|3647821_3648034_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931457.1|3648056_3648479_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_010931458.1|3648495_3649596_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931459.1|3649692_3651210_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003814203.1|3651285_3652125_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_003814205.1|3652146_3653028_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814206.1|3653109_3654204_-	porin	NA	NA	NA	NA	NA
WP_010929851.1|3654497_3655448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166340.1|3655522_3656464_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814209.1|3656547_3656907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931461.1|3657288_3658326_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_010931462.1|3658642_3659983_+	aminopeptidase P N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931463.1|3659992_3660445_-	membrane protein	NA	NA	NA	NA	NA
WP_003814217.1|3660541_3661723_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_023995141.1|3661788_3662814_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
