The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	4370	58926	2026239	holin,integrase,portal,protease,head,tRNA,capsid,terminase,tail	Streptococcus_phage(92.0%)	59	23623:23643	57724:57744
WP_000163932.1|4370_4940_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000258091.1|4940_8450_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001234978.1|8507_8774_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_000041909.1|8766_9135_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001224760.1|9254_10523_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001208986.1|10519_11797_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000892185.1|11800_12343_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.2	4.4e-08
WP_000744554.1|12358_14317_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	45.8	3.2e-109
WP_000588866.1|14438_14918_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000939546.1|21774_22011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205044.1|22241_23528_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.1	2.7e-72
23623:23643	attL	CTTTTTCATAATAATCTCCCT	NA	NA	NA	NA
WP_000876732.1|23769_24918_-|integrase	site-specific integrase	integrase	A0A1S5SEH2	Streptococcus_phage	100.0	1.6e-217
WP_000122591.1|25103_26027_-	3'-5' exoribonuclease	NA	A0A1S5SEW3	Streptococcus_phage	100.0	3.5e-175
WP_000136459.1|26039_26423_-	hypothetical protein	NA	A0A1S5SEU6	Streptococcus_phage	100.0	1.9e-66
WP_000492031.1|26435_26801_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SEP7	Streptococcus_phage	100.0	3.2e-63
WP_000041097.1|27177_27399_-	hypothetical protein	NA	A0A1S5SEP1	Streptococcus_phage	100.0	2.1e-30
WP_000389576.1|27517_27664_+	hypothetical protein	NA	A0A1S5SEU4	Streptococcus_phage	100.0	3.6e-18
WP_000032097.1|27675_27879_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SEI7	Streptococcus_phage	100.0	7.7e-27
WP_001057654.1|27895_28093_+	hypothetical protein	NA	A0A1S5SEL5	Streptococcus_phage	100.0	3.6e-29
WP_001002946.1|28103_28265_+	hypothetical protein	NA	A0A1S5SEJ3	Streptococcus_phage	100.0	1.3e-21
WP_000386249.1|28259_28685_-	hypothetical protein	NA	A0A1S5SEI2	Streptococcus_phage	100.0	4.4e-40
WP_001002359.1|28738_29449_+	ORF6C domain-containing protein	NA	A0A1S5SEX2	Streptococcus_phage	100.0	1.1e-133
WP_000370959.1|29462_29720_+	hypothetical protein	NA	A0A1S5SEV6	Streptococcus_phage	100.0	1.2e-43
WP_000462824.1|29805_30126_+	hypothetical protein	NA	A0A1S5SEQ7	Streptococcus_phage	100.0	4.3e-48
WP_000391805.1|30141_30438_+	hypothetical protein	NA	A0A1S5SEL7	Streptococcus_phage	100.0	5.2e-48
WP_001289771.1|30430_31237_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SEQ1	Streptococcus_phage	100.0	6.5e-125
WP_000228219.1|31376_32147_+	ATP-binding protein	NA	A0A1S5SEJ8	Streptococcus_phage	100.0	6.8e-140
WP_000470307.1|32161_32356_+	hypothetical protein	NA	A0A1S5SEM5	Streptococcus_phage	100.0	1.8e-28
WP_000891962.1|32355_32574_+	hypothetical protein	NA	A0A1S5SEK3	Streptococcus_phage	100.0	1.6e-38
WP_000233203.1|33067_33235_+	hypothetical protein	NA	A0A1S5SEY3	Streptococcus_phage	100.0	5.0e-24
WP_000872740.1|33221_33431_+	hypothetical protein	NA	A0A1S5SEW2	Streptococcus_phage	100.0	3.2e-28
WP_000969665.1|33402_33720_+	hypothetical protein	NA	A0A1S5SER7	Streptococcus_phage	100.0	3.5e-58
WP_000736390.1|33972_34374_+	transcriptional activator	NA	A0A1S5SER4	Streptococcus_phage	100.0	4.7e-68
WP_000397549.1|34561_35104_+|integrase	site-specific integrase	integrase	A0A1S5SEW4	Streptococcus_phage	100.0	1.4e-99
WP_000282427.1|35480_35801_+	HNH endonuclease	NA	A0A141E0N9	Streptococcus_phage	100.0	2.7e-58
WP_001118283.1|35937_36330_+|terminase	P27 family phage terminase small subunit	terminase	A0A1S5SEN5	Streptococcus_phage	100.0	1.6e-65
WP_000527299.1|36322_38053_+|terminase	terminase large subunit	terminase	A0A1S5SEL3	Streptococcus_phage	100.0	0.0e+00
WP_001002923.1|38060_38279_+	hypothetical protein	NA	A0A1S5SEK2	Streptococcus_phage	100.0	1.3e-32
WP_000510803.1|38296_39499_+|portal	phage portal protein	portal	A0A1S5SF08	Streptococcus_phage	100.0	5.2e-227
WP_001172115.1|39482_40058_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1S5SEX0	Streptococcus_phage	100.0	2.2e-103
WP_001030357.1|40054_41221_+|capsid	phage major capsid protein	capsid	A0A1S5SES9	Streptococcus_phage	100.0	6.0e-188
WP_000262606.1|41232_41502_+	hypothetical protein	NA	A0A1S5SEN8	Streptococcus_phage	100.0	2.7e-43
WP_000370976.1|41504_41786_+	hypothetical protein	NA	A0A1S5SES4	Streptococcus_phage	100.0	2.5e-44
WP_000267055.1|41772_42072_+|head	phage head closure protein	head	A0A1S5SEX5	Streptococcus_phage	100.0	3.7e-49
WP_000063886.1|42068_42416_+	HK97 gp10 family phage protein	NA	A0A1S5SEL8	Streptococcus_phage	100.0	8.8e-47
WP_000777003.1|42412_42736_+	hypothetical protein	NA	A0A1S5SEP5	Streptococcus_phage	100.0	3.5e-53
WP_000191279.1|42747_43326_+	hypothetical protein	NA	A0A1S5SEM2	Streptococcus_phage	100.0	2.6e-107
WP_001227146.1|43337_43757_+	hypothetical protein	NA	A0A1S5SEL1	Streptococcus_phage	100.0	1.1e-72
WP_000918318.1|44034_47130_+	hypothetical protein	NA	A0A1S5SF15	Streptococcus_phage	100.0	0.0e+00
WP_000589856.1|47126_47849_+	hypothetical protein	NA	A0A1S5SEY1	Streptococcus_phage	100.0	1.1e-134
WP_000966215.1|47849_54482_+|tail	tail fiber domain-containing protein	tail	A0A1S5SEN7	Streptococcus_phage	100.0	0.0e+00
WP_001091113.1|54575_54779_+	hypothetical protein	NA	A0A1S5SET3	Streptococcus_phage	100.0	5.0e-26
WP_000852241.1|54781_55132_+	hypothetical protein	NA	A0A1S5SEY6	Streptococcus_phage	100.0	2.8e-64
WP_001165344.1|55140_55557_+|holin	phage holin family protein	holin	A0A1S5SCE8	Streptococcus_phage	100.0	1.9e-67
WP_001186219.1|55560_55893_+|holin	phage holin	holin	A0A1S5SEQ5	Streptococcus_phage	100.0	7.7e-40
WP_000350505.1|55896_56853_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1S5SEN2	Streptococcus_phage	100.0	6.7e-145
WP_000109850.1|57073_57262_-	hypothetical protein	NA	A0A0A0YQQ9	Streptococcus_phage	83.9	8.2e-23
WP_000291870.1|57829_58297_+	nucleoside deaminase	NA	NA	NA	NA	NA
57724:57744	attR	CTTTTTCATAATAATCTCCCT	NA	NA	NA	NA
WP_000701992.1|58482_58926_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	47.3	2.1e-29
>prophage 2
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	74456	85912	2026239		Cyanophage(33.33%)	7	NA	NA
WP_000668304.1|74456_76610_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	4.0e-44
WP_000801618.1|76622_77972_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043304.1|78141_78849_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	40.1	2.7e-42
WP_000361178.1|79050_82776_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.7	1.6e-37
WP_000220633.1|82868_84311_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.7e-55
WP_000182558.1|84347_85370_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	7.3e-65
WP_000717506.1|85366_85912_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	7.4e-24
>prophage 3
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	327771	374784	2026239	integrase,transposase,protease,holin	Streptococcus_phage(27.27%)	37	372642:372655	376223:376236
WP_001063431.1|327771_329877_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.4	1.7e-116
WP_000032550.1|330172_330655_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743630.1|330749_332234_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_001156820.1|332385_333993_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022221.1|334151_334325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664175.1|336970_337663_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.8	3.2e-64
WP_000684066.1|339231_340416_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	52.2	2.1e-103
WP_000287927.1|340431_341685_+	glycosyltransferase	NA	Q84419	Paramecium_bursaria_Chlorella_virus	25.6	6.1e-13
WP_000756065.1|341982_342903_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.2	5.9e-74
WP_001808869.1|342899_344117_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	86.2	1.5e-194
WP_024266168.1|344043_344601_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	45.4	2.4e-38
WP_001032501.1|345989_351293_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001040010.1|351458_353618_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_000248781.1|353614_354211_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	37.2	9.6e-25
WP_000179549.1|354276_354804_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000146522.1|354873_355203_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000711393.1|355688_356846_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000039274.1|356858_358253_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158781.1|358328_359753_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	1.6e-41
WP_000518011.1|359764_360454_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.1	2.2e-12
WP_000771086.1|360552_361575_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
WP_000771140.1|361593_362715_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_000765691.1|362832_364065_-	MFS transporter	NA	NA	NA	NA	NA
WP_074017684.1|364107_365070_-	lanthionine synthetase	NA	NA	NA	NA	NA
WP_000197317.1|365593_365923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000163328.1|366044_366923_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_000373456.1|366904_367858_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_000562427.1|367844_368852_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_000210616.1|368835_369846_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001224637.1|369923_370622_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000743662.1|370618_371614_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000698438.1|371627_372260_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001808881.1|372260_372503_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_075588398.1|372427_372739_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
372642:372655	attL	AAATAATCTTAATA	NA	NA	NA	NA
WP_000754501.1|373179_373419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074186952.1|373463_374093_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000378125.1|374391_374784_+|integrase	tyrosine-type recombinase/integrase	integrase	C9E2L6	Enterococcus_phage	41.4	3.6e-20
376223:376236	attR	AAATAATCTTAATA	NA	NA	NA	NA
>prophage 5
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	788136	848028	2026239	holin,integrase,protease,transposase,tRNA,bacteriocin	Streptococcus_phage(42.86%)	54	792484:792528	843648:843692
WP_001200080.1|788136_789351_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001076714.1|789487_790312_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000546755.1|790333_791029_+	esterase family protein	NA	NA	NA	NA	NA
WP_001809081.1|791086_791494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074017630.1|791511_792231_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
792484:792528	attL	ATACTCAATGAAAATCAAAGAGCAAACTAGGAAGCTAGCCGCAGG	NA	NA	NA	NA
WP_000627748.1|792738_794232_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.7	4.0e-35
WP_000756149.1|794244_794646_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000260605.1|794705_794942_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000158366.1|794938_795352_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.5	3.1e-14
WP_000444455.1|795469_796435_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.4e-33
WP_000756121.1|796468_797575_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000693053.1|801226_801427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001042995.1|801520_801991_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212037.1|802007_804281_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561512.1|804627_807729_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.4	2.9e-112
WP_000820839.1|807811_808819_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|808877_810383_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001167984.1|810646_810895_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S8R9	Streptococcus_phage	52.1	1.7e-12
WP_000749599.1|812134_813007_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000759775.1|813955_814672_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617843.1|814801_815617_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123607.1|815613_816519_-	permease	NA	NA	NA	NA	NA
WP_000359141.1|817020_819150_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778589.1|819136_819586_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|819644_819917_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680760.1|820275_820467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173358.1|820896_821655_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_000489400.1|821656_823645_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164848155.1|823686_824331_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_001153887.1|824302_825352_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	36.0	6.6e-37
WP_000661000.1|826058_827534_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_074189415.1|827499_828090_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001270407.1|828300_828438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366707.1|828468_829329_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.6	6.0e-12
WP_000088774.1|829325_830585_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764379.1|830584_831712_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969449.1|831708_832794_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	2.0e-89
WP_001246755.1|832803_833679_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593608.1|833859_834669_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602451.1|834940_835162_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745371.1|835215_835887_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001025710.1|836128_837037_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|837033_837495_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403195.1|837484_838372_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	1.3e-09
WP_000728261.1|838374_840270_+|holin	phosphorylcholine esterase CbpE	holin	I2E8W4	Clostridium_phage	24.8	1.6e-12
WP_074186894.1|840349_841480_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.5e-114
WP_000254695.1|841489_842752_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.5	3.8e-140
WP_000689706.1|842755_843553_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.2	8.0e-59
WP_000033362.1|843772_844411_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	68.1	9.8e-76
843648:843692	attR	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTAT	NA	NA	NA	NA
WP_000806714.1|844407_845298_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.7	4.9e-73
WP_000358228.1|845337_845655_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166894.1|845657_846527_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.4	2.5e-114
WP_001261453.1|846753_847272_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345254.1|847380_848028_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
>prophage 6
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	1103994	1116891	2026239		Bacillus_phage(22.22%)	12	NA	NA
WP_001152997.1|1103994_1106463_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	1.2e-105
WP_000204733.1|1106656_1107643_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000731127.1|1107991_1108687_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	47.7	4.7e-23
WP_001812387.1|1108733_1108988_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	51.2	7.0e-17
WP_000208080.1|1108989_1109232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289493.1|1109322_1110132_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	39.0	1.8e-34
WP_000886210.1|1110133_1111483_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.6	1.8e-34
WP_000722076.1|1111475_1112180_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	2.8e-39
WP_000886147.1|1112234_1113410_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	8.8e-22
WP_000845287.1|1113738_1115409_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_000699489.1|1115638_1116328_+	phosphopantothenate--cysteine ligase	NA	Q9HH70	Methanothermobacter_phage	31.6	2.9e-17
WP_001284130.1|1116339_1116891_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	36.1	5.2e-25
>prophage 7
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	1256019	1310400	2026239	transposase,tRNA,holin	Bacillus_virus(17.65%)	56	NA	NA
WP_001090165.1|1256019_1257048_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_074017658.1|1257708_1258836_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_000835659.1|1259550_1260102_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000058033.1|1260451_1261276_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.5	1.8e-74
WP_000283157.1|1261272_1262733_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.5	3.0e-104
WP_000797184.1|1262848_1263337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107505.1|1263326_1263536_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000640911.1|1263920_1264373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000773444.1|1264436_1264649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001809119.1|1266513_1266825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169080.1|1266839_1268126_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	1.6e-40
WP_001262531.1|1268749_1268932_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078131890.1|1268941_1269295_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000217307.1|1269302_1270493_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	37.4	7.0e-43
WP_000122904.1|1271007_1272000_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000708373.1|1272159_1273914_+	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	32.6	1.3e-24
WP_000657836.1|1273897_1275619_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	6.4e-29
WP_000368971.1|1275629_1276214_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_001141942.1|1276213_1276909_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000229369.1|1276896_1278261_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	35.5	3.3e-20
WP_001809122.1|1278715_1278874_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001809123.1|1279466_1279679_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000484475.1|1279687_1279993_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_000691853.1|1279979_1280174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014632422.1|1280370_1280694_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001136125.1|1280599_1280860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065723.1|1281163_1282726_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936189.1|1282867_1283566_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071669.1|1283608_1284505_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1284513_1285449_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102214.1|1285445_1286171_-	proteinase	NA	NA	NA	NA	NA
WP_000290648.1|1286254_1286890_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.2	4.3e-07
WP_000972925.1|1286891_1287719_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001272961.1|1289318_1289930_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855734.1|1289974_1290703_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272311.1|1290740_1291652_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.5	2.9e-89
WP_000926599.1|1291717_1291942_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590985.1|1292019_1292763_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	1.6e-29
WP_001103449.1|1292762_1293563_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1293720_1294077_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170344.1|1294070_1294601_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405832.1|1294600_1295095_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
WP_000858730.1|1295229_1295676_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097984.1|1295672_1296320_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689948.1|1296340_1296922_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1296922_1297798_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036789.1|1297949_1299329_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175417.1|1299622_1300546_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915924.1|1300605_1301211_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	7.7e-54
WP_000371287.1|1302696_1302954_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164753.1|1302995_1305032_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038744.1|1305291_1306209_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000429564.1|1306403_1307165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099678.1|1307437_1308280_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.3e-51
WP_042672207.1|1308393_1309785_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001809132.1|1310019_1310400_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_021026	Streptococcus pneumoniae SPN994038, complete genome	2026239	2004082	2012836	2026239		Streptococcus_phage(33.33%)	9	NA	NA
WP_000510408.1|2004082_2004922_-	energy-coupling factor transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.8	3.0e-16
WP_000835715.1|2004906_2005734_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.8e-22
WP_000712141.1|2005730_2006276_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2006286_2007108_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170216.1|2007149_2008433_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	30.5	1.2e-16
WP_000424281.1|2008429_2009680_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.5	9.2e-94
WP_000455903.1|2009838_2010207_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2010209_2011307_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073423.1|2011357_2012836_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
