The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	4370	58926	2037254	terminase,tRNA,integrase,tail,protease,holin,portal,capsid,head	Streptococcus_phage(91.67%)	57	23623:23643	57724:57744
WP_000163932.1|4370_4940_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000258091.1|4940_8450_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001234978.1|8507_8774_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_000041909.1|8766_9135_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001224760.1|9254_10523_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001208986.1|10519_11797_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000892185.1|11800_12343_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.2	4.4e-08
WP_000744554.1|12358_14317_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	45.8	3.2e-109
WP_000588866.1|14438_14918_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000939546.1|21774_22011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205044.1|22241_23528_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.1	2.7e-72
23623:23643	attL	CTTTTTCATAATAATCTCCCT	NA	NA	NA	NA
WP_000876732.1|23769_24918_-|integrase	site-specific integrase	integrase	A0A1S5SEH2	Streptococcus_phage	100.0	1.6e-217
WP_000122591.1|25103_26027_-	3'-5' exoribonuclease	NA	A0A1S5SEW3	Streptococcus_phage	100.0	3.5e-175
WP_000136459.1|26039_26423_-	hypothetical protein	NA	A0A1S5SEU6	Streptococcus_phage	100.0	1.9e-66
WP_000492031.1|26435_26801_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SEP7	Streptococcus_phage	100.0	3.2e-63
WP_000041097.1|27177_27399_-	hypothetical protein	NA	A0A1S5SEP1	Streptococcus_phage	100.0	2.1e-30
WP_000389576.1|27517_27664_+	hypothetical protein	NA	A0A1S5SEU4	Streptococcus_phage	100.0	3.6e-18
WP_000032097.1|27675_27879_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SEI7	Streptococcus_phage	100.0	7.7e-27
WP_001057654.1|27895_28093_+	hypothetical protein	NA	A0A1S5SEL5	Streptococcus_phage	100.0	3.6e-29
WP_001002946.1|28103_28265_+	hypothetical protein	NA	A0A1S5SEJ3	Streptococcus_phage	100.0	1.3e-21
WP_000386249.1|28259_28685_-	hypothetical protein	NA	A0A1S5SEI2	Streptococcus_phage	100.0	4.4e-40
WP_001002359.1|28738_29449_+	ORF6C domain-containing protein	NA	A0A1S5SEX2	Streptococcus_phage	100.0	1.1e-133
WP_000370959.1|29462_29720_+	hypothetical protein	NA	A0A1S5SEV6	Streptococcus_phage	100.0	1.2e-43
WP_000462824.1|29805_30126_+	hypothetical protein	NA	A0A1S5SEQ7	Streptococcus_phage	100.0	4.3e-48
WP_000391805.1|30141_30438_+	hypothetical protein	NA	A0A1S5SEL7	Streptococcus_phage	100.0	5.2e-48
WP_001289771.1|30430_31237_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SEQ1	Streptococcus_phage	100.0	6.5e-125
WP_000228219.1|31376_32147_+	ATP-binding protein	NA	A0A1S5SEJ8	Streptococcus_phage	100.0	6.8e-140
WP_000891962.1|32355_32574_+	hypothetical protein	NA	A0A1S5SEK3	Streptococcus_phage	100.0	1.6e-38
WP_000233203.1|33067_33235_+	hypothetical protein	NA	A0A1S5SEY3	Streptococcus_phage	100.0	5.0e-24
WP_000969665.1|33402_33720_+	hypothetical protein	NA	A0A1S5SER7	Streptococcus_phage	100.0	3.5e-58
WP_000736390.1|33972_34374_+	transcriptional activator	NA	A0A1S5SER4	Streptococcus_phage	100.0	4.7e-68
WP_000397549.1|34561_35104_+|integrase	site-specific integrase	integrase	A0A1S5SEW4	Streptococcus_phage	100.0	1.4e-99
WP_000282427.1|35480_35801_+	HNH endonuclease	NA	A0A141E0N9	Streptococcus_phage	100.0	2.7e-58
WP_001118283.1|35937_36330_+|terminase	P27 family phage terminase small subunit	terminase	A0A1S5SEN5	Streptococcus_phage	100.0	1.6e-65
WP_000527299.1|36322_38053_+|terminase	terminase large subunit	terminase	A0A1S5SEL3	Streptococcus_phage	100.0	0.0e+00
WP_001002923.1|38060_38279_+	hypothetical protein	NA	A0A1S5SEK2	Streptococcus_phage	100.0	1.3e-32
WP_000510803.1|38296_39499_+|portal	phage portal protein	portal	A0A1S5SF08	Streptococcus_phage	100.0	5.2e-227
WP_001172115.1|39482_40058_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1S5SEX0	Streptococcus_phage	100.0	2.2e-103
WP_001030357.1|40054_41221_+|capsid	phage major capsid protein	capsid	A0A1S5SES9	Streptococcus_phage	100.0	6.0e-188
WP_000262606.1|41232_41502_+	hypothetical protein	NA	A0A1S5SEN8	Streptococcus_phage	100.0	2.7e-43
WP_000370976.1|41504_41786_+	hypothetical protein	NA	A0A1S5SES4	Streptococcus_phage	100.0	2.5e-44
WP_000267055.1|41772_42072_+|head	phage head closure protein	head	A0A1S5SEX5	Streptococcus_phage	100.0	3.7e-49
WP_000063886.1|42068_42416_+	HK97 gp10 family phage protein	NA	A0A1S5SEL8	Streptococcus_phage	100.0	8.8e-47
WP_000777003.1|42412_42736_+	hypothetical protein	NA	A0A1S5SEP5	Streptococcus_phage	100.0	3.5e-53
WP_000191279.1|42747_43326_+	hypothetical protein	NA	A0A1S5SEM2	Streptococcus_phage	100.0	2.6e-107
WP_001227146.1|43337_43757_+	hypothetical protein	NA	A0A1S5SEL1	Streptococcus_phage	100.0	1.1e-72
WP_000918318.1|44034_47130_+	hypothetical protein	NA	A0A1S5SF15	Streptococcus_phage	100.0	0.0e+00
WP_000589856.1|47126_47849_+	hypothetical protein	NA	A0A1S5SEY1	Streptococcus_phage	100.0	1.1e-134
WP_000966215.1|47849_54482_+|tail	tail fiber domain-containing protein	tail	A0A1S5SEN7	Streptococcus_phage	100.0	0.0e+00
WP_001091113.1|54575_54779_+	hypothetical protein	NA	A0A1S5SET3	Streptococcus_phage	100.0	5.0e-26
WP_000852241.1|54781_55132_+	hypothetical protein	NA	A0A1S5SEY6	Streptococcus_phage	100.0	2.8e-64
WP_001165344.1|55140_55557_+|holin	phage holin family protein	holin	A0A1S5SCE8	Streptococcus_phage	100.0	1.9e-67
WP_001186219.1|55560_55893_+|holin	phage holin	holin	A0A1S5SEQ5	Streptococcus_phage	100.0	7.7e-40
WP_000350505.1|55896_56853_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1S5SEN2	Streptococcus_phage	100.0	6.7e-145
WP_000109850.1|57073_57262_-	hypothetical protein	NA	A0A0A0YQQ9	Streptococcus_phage	83.9	8.2e-23
WP_000291870.1|57829_58297_+	nucleoside deaminase	NA	NA	NA	NA	NA
57724:57744	attR	CTTTTTCATAATAATCTCCCT	NA	NA	NA	NA
WP_000701992.1|58482_58926_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	47.3	2.1e-29
>prophage 2
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	74410	85866	2037254		Cyanophage(33.33%)	7	NA	NA
WP_000668304.1|74410_76564_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	4.0e-44
WP_000801618.1|76576_77926_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043304.1|78095_78803_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	40.1	2.7e-42
WP_000361178.1|79004_82730_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.7	1.6e-37
WP_000220633.1|82822_84265_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.7e-55
WP_000182558.1|84301_85324_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	7.3e-65
WP_000717506.1|85320_85866_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	7.4e-24
>prophage 3
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	138337	169939	2037254	bacteriocin,tRNA	Streptococcus_phage(40.0%)	28	NA	NA
WP_001230165.1|138337_138625_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000724266.1|138676_140785_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000571038.1|140781_141423_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.1e-23
WP_041178945.1|141629_142436_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_096001214.1|142401_142872_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_001189277.1|144651_144972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424422.1|145730_146111_+|bacteriocin	SP_0115 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_001838391.1|147840_150060_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	2.3e-39
WP_001096141.1|150052_150520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781024.1|150516_151869_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000424429.1|152013_152385_+|bacteriocin	SPH_0218 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000909532.1|152392_152605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201420.1|152978_153206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001808813.1|153362_154421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001838392.1|154736_155714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424406.1|156090_156465_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000619811.1|156672_157575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424445.1|157630_157984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072927.1|157980_158709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770314.1|159452_159692_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	54.1	7.2e-16
WP_001808816.1|159676_159955_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	52.7	6.0e-22
WP_015545692.1|160250_162692_+	pneumococcal surface protein PspA	NA	NA	NA	NA	NA
WP_001282967.1|163092_164214_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193606.1|164354_164810_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000220964.1|164819_166733_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331961.1|167066_168746_-	ribonuclease J	NA	S0A5H7	Cellulophaga_phage	30.6	8.8e-07
WP_000639580.1|168747_168981_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000977347.1|169786_169939_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
>prophage 4
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	338194	385207	2037254	transposase,holin,integrase,protease	Streptococcus_phage(27.27%)	37	383065:383078	386646:386659
WP_001063431.1|338194_340300_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.4	1.7e-116
WP_000032550.1|340595_341078_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000743630.1|341172_342657_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_001156820.1|342808_344416_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_001022221.1|344574_344748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664175.1|347393_348086_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	56.8	3.2e-64
WP_000684066.1|349654_350839_+	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	52.2	2.1e-103
WP_000287927.1|350854_352108_+	glycosyltransferase	NA	Q84419	Paramecium_bursaria_Chlorella_virus	25.6	6.1e-13
WP_000756065.1|352405_353326_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.2	5.9e-74
WP_001808869.1|353322_354540_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	86.2	1.5e-194
WP_024266168.1|354466_355024_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	45.4	2.4e-38
WP_001032501.1|356412_361716_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_001040010.1|361881_364041_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_000248781.1|364037_364634_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	37.2	9.6e-25
WP_000179549.1|364699_365227_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_000146522.1|365296_365626_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_000711393.1|366111_367269_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_000039274.1|367281_368676_+	mid-cell-anchored protein MapZ	NA	NA	NA	NA	NA
WP_000158781.1|368751_370176_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.6	1.6e-41
WP_000518011.1|370187_370877_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	26.1	2.2e-12
WP_000771086.1|370975_371998_+|holin	choline-binding protein CbpC	holin	NA	NA	NA	NA
WP_000771140.1|372016_373138_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_000765691.1|373255_374488_-	MFS transporter	NA	NA	NA	NA	NA
WP_074017684.1|374530_375493_-	lanthionine synthetase	NA	NA	NA	NA	NA
WP_000197317.1|376016_376346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000163328.1|376467_377346_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_000373456.1|377327_378281_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_000562427.1|378267_379275_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_000210616.1|379258_380269_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001224637.1|380346_381045_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_000743662.1|381041_382037_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000698438.1|382050_382683_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001808881.1|382683_382926_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_075588398.1|382850_383162_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
383065:383078	attL	AAATAATCTTAATA	NA	NA	NA	NA
WP_000754501.1|383602_383842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074186952.1|383886_384516_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000378125.1|384814_385207_+|integrase	tyrosine-type recombinase/integrase	integrase	C9E2L6	Enterococcus_phage	41.4	3.6e-20
386646:386659	attR	AAATAATCTTAATA	NA	NA	NA	NA
>prophage 6
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	798616	858549	2037254	tRNA,integrase,protease,bacteriocin,transposase,holin	Streptococcus_phage(42.86%)	54	802964:803008	854169:854213
WP_001200080.1|798616_799831_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_001076714.1|799967_800792_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000546755.1|800813_801509_+	esterase family protein	NA	NA	NA	NA	NA
WP_001809081.1|801566_801974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074017630.1|801991_802711_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
802964:803008	attL	ATACTCAATGAAAATCAAAGAGCAAACTAGGAAGCTAGCCGCAGG	NA	NA	NA	NA
WP_000627748.1|803218_804712_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.7	4.0e-35
WP_000756149.1|804724_805126_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000260605.1|805185_805422_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_000158366.1|805418_805832_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.5	3.1e-14
WP_000444455.1|805949_806915_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.6	1.4e-33
WP_000756121.1|806948_808055_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041178950.1|811706_811907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001042995.1|812000_812471_-	arginine repressor	NA	NA	NA	NA	NA
WP_001212037.1|812487_814761_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_000561512.1|815107_818209_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	32.4	2.9e-112
WP_000820852.1|818291_819299_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001042809.1|819357_820863_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001167984.1|821126_821375_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S8R9	Streptococcus_phage	52.1	1.7e-12
WP_000749599.1|822610_823483_+	DUF4300 family protein	NA	NA	NA	NA	NA
WP_000759775.1|824431_825148_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000617843.1|825277_826093_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000123607.1|826089_826995_-	permease	NA	NA	NA	NA	NA
WP_000359141.1|827541_829671_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000778589.1|829657_830107_+	SprT family protein	NA	NA	NA	NA	NA
WP_001085044.1|830165_830438_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_000680760.1|830796_830988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173358.1|831417_832176_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	7.7e-27
WP_000489400.1|832177_834166_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164848155.1|834207_834852_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_001153887.1|834823_835873_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	36.0	6.6e-37
WP_000661000.1|836579_838055_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_074189415.1|838020_838611_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001270407.1|838821_838959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366707.1|838989_839850_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	30.6	6.0e-12
WP_000088774.1|839846_841106_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000764379.1|841105_842233_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_000969449.1|842229_843315_+	agmatine deiminase	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	47.5	2.0e-89
WP_001246755.1|843324_844200_+	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	50.0	1.1e-77
WP_000593608.1|844380_845190_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000602451.1|845461_845683_+|bacteriocin	SP_0924 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000745371.1|845736_846408_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001025710.1|846649_847558_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|847554_848016_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403195.1|848005_848893_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	1.3e-09
WP_000728261.1|848895_850791_+|holin	phosphorylcholine esterase CbpE	holin	I2E8W4	Clostridium_phage	24.8	1.6e-12
WP_074186894.1|850870_852001_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.4	1.5e-114
WP_000254695.1|852010_853273_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.5	3.8e-140
WP_000689706.1|853276_854074_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.2	8.0e-59
WP_000033362.1|854293_854932_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	68.1	9.8e-76
854169:854213	attR	CCTGCGGCTAGCTTCCTAGTTTGCTCTTTGATTTTCATTGAGTAT	NA	NA	NA	NA
WP_000806714.1|854928_855819_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.7	4.9e-73
WP_000358228.1|855858_856176_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166894.1|856178_857048_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.4	2.5e-114
WP_001261453.1|857274_857793_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000345254.1|857901_858549_+	replication initiator protein A	NA	A0A2P0VK56	Streptococcus_phage	33.7	7.0e-13
>prophage 7
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	1114528	1127425	2037254		Bacillus_phage(22.22%)	12	NA	NA
WP_001152997.1|1114528_1116997_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.5	1.2e-105
WP_000204733.1|1117190_1118177_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000731127.1|1118525_1119221_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	47.7	4.7e-23
WP_001812387.1|1119267_1119522_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	51.2	7.0e-17
WP_000208080.1|1119523_1119766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001289493.1|1119856_1120666_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	39.0	1.8e-34
WP_000886210.1|1120667_1122017_-	cell wall metabolism sensor histidine kinase VicK	NA	W8CYF6	Bacillus_phage	34.6	1.8e-34
WP_000722076.1|1122009_1122714_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	2.8e-39
WP_000886147.1|1122768_1123944_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	29.8	8.8e-22
WP_000845287.1|1124272_1125943_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_000699489.1|1126172_1126862_+	phosphopantothenate--cysteine ligase	NA	Q9HH70	Methanothermobacter_phage	31.6	2.9e-17
WP_001284130.1|1126873_1127425_+	phosphopantothenoylcysteine decarboxylase	NA	A0A1V0S7W6	Shearwaterpox_virus	36.1	5.2e-25
>prophage 8
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	1266552	1320830	2037254	transposase,tRNA,holin	Bacillus_virus(16.67%)	57	NA	NA
WP_001090165.1|1266552_1267581_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_074017658.1|1268241_1269369_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_000835659.1|1270083_1270635_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000058033.1|1270881_1271706_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.5	1.8e-74
WP_000283157.1|1271702_1273163_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.5	3.0e-104
WP_000797184.1|1273278_1273767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107505.1|1273756_1273966_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000640911.1|1274350_1274803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000773444.1|1274866_1275079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001809119.1|1276943_1277255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169080.1|1277269_1278556_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	1.6e-40
WP_001262531.1|1279179_1279362_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078131890.1|1279371_1279725_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000217307.1|1279732_1280923_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	37.4	7.0e-43
WP_000122904.1|1281437_1282430_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000708373.1|1282589_1284344_+	ABC transporter ATP-binding protein	NA	F2Y352	Organic_Lake_phycodnavirus	32.6	1.3e-24
WP_000657836.1|1284327_1286049_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	6.4e-29
WP_000368971.1|1286059_1286644_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_001141942.1|1286643_1287339_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000229369.1|1287326_1288691_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	35.5	3.3e-20
WP_001809122.1|1289145_1289304_-|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_001809123.1|1289896_1290109_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000484475.1|1290117_1290423_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_000691853.1|1290409_1290604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014632422.1|1290800_1291124_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001136125.1|1291029_1291290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065723.1|1291593_1293156_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936189.1|1293297_1293996_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071669.1|1294038_1294935_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872215.1|1294943_1295879_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102214.1|1295875_1296601_-	proteinase	NA	NA	NA	NA	NA
WP_000290648.1|1296684_1297320_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	28.2	4.3e-07
WP_000972925.1|1297321_1298149_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001272961.1|1299748_1300360_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855734.1|1300404_1301133_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272311.1|1301170_1302082_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.5	2.9e-89
WP_000926599.1|1302147_1302372_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590985.1|1302449_1303193_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	1.6e-29
WP_001103449.1|1303192_1303993_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1304150_1304507_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170344.1|1304500_1305031_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405832.1|1305030_1305525_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
WP_000858730.1|1305659_1306106_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097984.1|1306102_1306750_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689948.1|1306770_1307352_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1307352_1308228_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036789.1|1308379_1309759_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175417.1|1310052_1310976_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915924.1|1311035_1311641_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	54.2	7.7e-54
WP_000673687.1|1311659_1312904_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.1	2.2e-55
WP_000371287.1|1313126_1313384_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164753.1|1313425_1315462_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038744.1|1315721_1316639_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000429564.1|1316833_1317595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099678.1|1317867_1318710_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.3e-51
WP_042672207.1|1318823_1320215_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001809132.1|1320449_1320830_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_021028	Streptococcus pneumoniae SPN034183, complete genome	2037254	2015097	2023851	2037254		Streptococcus_phage(33.33%)	9	NA	NA
WP_000510408.1|2015097_2015937_-	energy-coupling factor transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.8	3.0e-16
WP_000835715.1|2015921_2016749_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	2.8e-22
WP_000712141.1|2016745_2017291_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2017301_2018123_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170216.1|2018164_2019448_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	30.5	1.2e-16
WP_000424281.1|2019444_2020695_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.5	9.2e-94
WP_000455903.1|2020853_2021222_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2021224_2022322_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073423.1|2022372_2023851_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
