The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015964	Haemophilus parainfluenzae T3T1, complete genome	2086875	384246	457227	2086875	tail,capsid,holin,transposase,tRNA,portal,integrase,head,terminase,plate	Mannheimia_phage(40.48%)	79	403579:403624	434388:434433
WP_167313614.1|384246_384438_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.8	2.5e-11
WP_014064297.1|384664_385531_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_014064298.1|385765_386845_-	porin	NA	NA	NA	NA	NA
WP_014064299.1|387010_387964_-	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_041918198.1|387960_388866_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014064301.1|388894_389476_-	YcxB family protein	NA	NA	NA	NA	NA
WP_014064302.1|389493_390537_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_014064303.1|390638_391562_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	38.4	1.2e-34
WP_014064304.1|391614_392118_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_014064305.1|392227_392902_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_014064306.1|392959_393634_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_014064307.1|393646_394318_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014064308.1|394482_396147_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_014064309.1|396279_396609_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014064310.1|396647_397793_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_014064311.1|397814_398402_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014064312.1|398441_399887_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	26.6	3.5e-12
WP_014064313.1|399936_401649_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_014064314.1|401862_402657_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014064315.1|402691_403480_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
403579:403624	attL	ATGGCAGGGGCGGAGAGGCTCGAACTCCCAACACCCGGTTTTGGAG	NA	NA	NA	NA
WP_014064316.1|404122_405133_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	60.5	2.1e-117
WP_014064317.1|405142_406918_-	oxidoreductase	NA	A0A0M3LRV4	Mannheimia_phage	63.4	2.7e-216
WP_041918199.1|407086_407908_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	47.6	9.1e-58
WP_014064319.1|407929_408964_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	53.7	1.8e-90
WP_014064320.1|408969_409620_+|terminase	terminase	terminase	Q19US0	Mannheimia_phage	45.2	1.2e-44
WP_014064321.1|409741_410248_+|head	head completion/stabilization protein	head	A0A0M3LPQ0	Mannheimia_phage	44.6	2.0e-31
WP_014064322.1|410247_410457_+|tail	tail protein	tail	E5FFI3	Burkholderia_phage	39.3	8.6e-05
WP_014064323.1|410458_410686_+|holin	holin	holin	NA	NA	NA	NA
WP_005700153.1|410678_411197_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	46.9	1.6e-36
WP_014064324.1|411181_411532_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_014064326.1|411706_411922_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	47.9	7.5e-12
WP_014064327.1|411918_412401_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	41.5	2.7e-25
WP_014064328.1|412400_412859_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.1	6.0e-27
WP_014064329.1|412878_415584_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	36.1	1.0e-73
WP_014064330.1|415698_416292_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	54.9	1.2e-35
WP_014064331.1|416291_416642_+	hypothetical protein	NA	A0A1S5NNH3	Burkholderia_phage	52.6	4.8e-16
WP_014064332.1|416625_417540_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	61.5	1.4e-96
WP_014064333.1|417529_418066_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	54.7	2.7e-50
WP_014064334.1|418074_419997_+|tail	tail fiber protein	tail	Q19UQ3	Mannheimia_phage	43.8	1.4e-37
WP_014064335.1|420015_420600_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	25.5	4.1e-12
WP_014064336.1|420584_420857_+	hypothetical protein	NA	Q776W9	Haemophilus_phage	72.0	2.1e-27
WP_014064337.1|420974_422159_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	49.0	7.9e-103
WP_005700105.1|422162_422669_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	61.9	5.8e-55
WP_005700107.1|422747_423041_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	40.4	3.3e-10
WP_005700138.1|423040_423187_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.9e-07
WP_005700061.1|423516_423954_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	56.0	7.7e-40
WP_014064339.1|423953_425147_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	52.3	7.4e-101
WP_014064340.1|425174_425567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155106200.1|425554_426208_-	WYL domain-containing protein	NA	A0A0M3LNP7	Mannheimia_phage	33.3	2.4e-13
WP_014064342.1|426265_426940_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	44.5	6.6e-46
WP_014064343.1|427059_427272_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	50.8	4.8e-11
WP_005700172.1|427307_427730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005700108.1|427741_427939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005633752.1|427981_428137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080351297.1|428182_428425_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	68.1	9.0e-22
WP_014064344.1|428569_428779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014064345.1|428794_429154_+	hypothetical protein	NA	P79676	Haemophilus_phage	35.3	7.8e-14
WP_014064346.1|429162_429417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014064347.1|429413_429662_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005700155.1|429780_430089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014064349.1|430096_432295_+	replication endonuclease	NA	Q1I108	Pasteurella_virus	46.5	3.8e-175
WP_014064351.1|432561_433077_+	pyrophosphatase	NA	B3GVZ0	Streptococcus_phage	42.0	7.5e-26
WP_041918306.1|433073_433406_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041918200.1|433315_434371_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	37.2	6.9e-58
WP_014064354.1|440297_440804_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
434388:434433	attR	ATGGCAGGGGCGGAGAGGCTCGAACTCCCAACACCCGGTTTTGGAG	NA	NA	NA	NA
WP_032822573.1|440803_442267_-	potassium transporter	NA	NA	NA	NA	NA
WP_014064355.1|442277_442889_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.0	4.1e-23
WP_005697464.1|443005_443245_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	66.7	2.1e-07
WP_014064356.1|443274_444192_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_014064358.1|444647_445550_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_014064359.1|445558_447418_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	28.9	1.5e-12
WP_014064360.1|447414_448797_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_005635637.1|449113_450298_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.6	2.9e-12
WP_014064361.1|450363_452466_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.9e-60
WP_005699184.1|452550_453021_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_005543325.1|453167_453542_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_014064362.1|453727_454621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041918201.1|454851_456237_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	24.2	8.0e-06
WP_014064364.1|456240_457227_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
