The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017529	Listeria monocytogenes L99, complete genome	2979198	70213	110809	2979198	holin,protease,terminase,capsid,portal,integrase,tail	Listeria_phage(89.13%)	60	71288:71332	109693:109737
WP_012582203.1|70213_71170_+	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.9	6.5e-31
71288:71332	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_012582202.1|71437_72616_-|integrase	site-specific integrase	integrase	A0A0B5CTW8	Listeria_phage	55.3	6.2e-116
WP_012582201.1|72698_73247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014588975.1|73266_73779_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S7FYX8	Listeria_phage	73.2	1.5e-66
WP_012582200.1|73802_74138_-	helix-turn-helix transcriptional regulator	NA	A0A1S7FZ25	Listeria_phage	64.2	2.0e-32
WP_012582199.1|74409_74613_+	helix-turn-helix domain-containing protein	NA	A0A1S7FZ40	Listeria_phage	68.8	5.6e-17
WP_012582198.1|74613_74799_+	helix-turn-helix domain-containing protein	NA	A0A1S7FYV9	Listeria_phage	71.9	1.0e-17
WP_041931062.1|74791_75076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582197.1|75065_75332_+	hypothetical protein	NA	A0A1S7FYW4	Listeria_phage	74.4	1.5e-25
WP_012582196.1|75337_75595_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	87.7	3.9e-31
WP_014588976.1|75612_75951_+	DUF3310 domain-containing protein	NA	E2GLY2	Acinetobacter_phage	52.0	5.6e-14
WP_012582194.1|75943_76174_+	hypothetical protein	NA	A0A1S7FYX1	Listeria_phage	57.9	1.7e-14
WP_012582193.1|76170_76386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582192.1|76382_77135_+	hypothetical protein	NA	A0A1S7FZ47	Listeria_phage	34.3	1.1e-09
WP_012582191.1|77136_78318_+	DUF2800 domain-containing protein	NA	A0A1S7FYX0	Listeria_phage	75.6	1.1e-173
WP_012582190.1|78401_78983_+	DUF2815 family protein	NA	A0A1S7FZ05	Listeria_phage	73.1	2.7e-64
WP_012582189.1|79276_80914_+	DNA polymerase	NA	A0A1S7FZ18	Listeria_phage	80.2	5.3e-259
WP_012582188.1|80926_81151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582186.1|81597_81984_+	hypothetical protein	NA	M1PLH5	Streptococcus_phage	32.8	2.4e-08
WP_012582185.1|81983_82253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582184.1|82253_82625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176601.1|82822_82990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582182.1|82986_83421_+	hypothetical protein	NA	A8ATD9	Listeria_phage	56.3	7.0e-33
WP_012582180.1|83637_83820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582179.1|83853_86292_+	virulence-associated E family protein	NA	A0A1S7FZ15	Listeria_phage	85.4	0.0e+00
WP_012582178.1|86597_86876_+	VRR-NUC domain-containing protein	NA	A0A1S7FZ22	Listeria_phage	74.2	6.0e-30
WP_012582177.1|86875_88267_+	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	80.2	2.8e-216
WP_012582176.1|88250_88616_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	58.7	1.0e-29
WP_012582175.1|88615_89158_+	hypothetical protein	NA	A0A1S7FZ07	Listeria_phage	71.6	1.8e-62
WP_041176473.1|89295_89628_+	hypothetical protein	NA	A0A060AG27	Listeria_phage	65.8	2.5e-38
WP_041176474.1|89628_89937_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	85.3	2.5e-45
WP_003768814.1|90059_90413_+|terminase	P27 family phage terminase small subunit	terminase	A0A1S7FYW6	Listeria_phage	80.3	1.7e-45
WP_012582174.1|90399_92046_+|terminase	terminase large subunit	terminase	A0A1S7FZ68	Listeria_phage	87.4	1.4e-291
WP_012582173.1|92057_93266_+|portal	phage portal protein	portal	A0A1S7FYX7	Listeria_phage	84.9	1.7e-193
WP_012582172.1|93262_94093_+|protease	Clp protease ClpP	protease	A0A1S7FZ23	Listeria_phage	71.4	2.5e-103
WP_012582171.1|94126_95272_+|capsid	phage major capsid protein	capsid	A0A1S7FZ31	Listeria_phage	86.3	9.4e-186
WP_012582170.1|95409_95706_+	hypothetical protein	NA	A0A1S7FYY9	Listeria_phage	68.4	3.4e-31
WP_094153171.1|95815_96022_+	hypothetical protein	NA	A0A1S7FZ08	Listeria_phage	79.1	2.8e-24
WP_041176475.1|96023_96425_+	hypothetical protein	NA	A0A1S7FYZ7	Listeria_phage	66.4	2.8e-44
WP_012582169.1|96411_96837_+	hypothetical protein	NA	A0A1S7FZ20	Listeria_phage	82.1	3.6e-58
WP_012582168.1|96852_97440_+	hypothetical protein	NA	A0A1S7FZ79	Listeria_phage	73.8	9.3e-81
WP_012582167.1|97450_97702_+	plasmid partitioning protein	NA	NA	NA	NA	NA
WP_012582166.1|97764_98136_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	69.9	5.7e-44
WP_012582165.1|98315_102710_+|tail	phage tail tape measure protein	tail	A0A1S7FYZ4	Listeria_phage	69.7	0.0e+00
WP_012582164.1|102706_103615_+	hypothetical protein	NA	A0A1S7FZ36	Listeria_phage	80.3	8.3e-137
WP_012582163.1|103614_104640_+	hypothetical protein	NA	A0A1S7FZ49	Listeria_phage	78.0	2.5e-158
WP_012582162.1|104642_105413_+	hypothetical protein	NA	A0A1S7FZ03	Listeria_phage	74.2	4.9e-114
WP_003768842.1|105412_105712_+	hypothetical protein	NA	A0A1S7FZ19	Listeria_phage	56.3	1.4e-24
WP_012582161.1|105708_105870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014588982.1|105899_106121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003768869.1|106122_106533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014588983.1|106542_106797_+|holin	phage holin	holin	Q8W5Y9	Listeria_phage	90.4	5.1e-36
WP_012582159.1|106796_107030_+	hypothetical protein	NA	R4IBI3	Listeria_phage	88.3	7.8e-31
WP_012582158.1|107032_107959_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	R4ICC5	Listeria_phage	86.0	1.0e-158
WP_014588984.1|107983_108403_+	hypothetical protein	NA	A0A0B5CTT3	Listeria_phage	47.9	1.2e-29
WP_012582157.1|108451_108715_-	AcrIIA4 family anti-CRISPR protein	NA	A0A2D0TCG7	unidentified_phage	81.6	4.2e-33
WP_012582156.1|108939_109128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582155.1|109159_109363_-	hypothetical protein	NA	A8ATJ3	Listeria_phage	77.3	2.0e-22
WP_041176476.1|109943_110270_+	hypothetical protein	NA	NA	NA	NA	NA
109693:109737	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_003728958.1|110305_110809_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	42.9	6.9e-08
>prophage 2
NC_017529	Listeria monocytogenes L99, complete genome	2979198	1198970	1299088	2979198	holin,protease,terminase,capsid,portal,integrase,tail,plate,tRNA	Listeria_phage(80.88%)	117	1198172:1198188	1293950:1293966
1198172:1198188	attL	AGAAGAATTTGGTCAAT	NA	NA	NA	NA
WP_012581500.1|1198970_1200023_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_012581499.1|1200022_1202431_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003729718.1|1202592_1203294_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	6.6e-33
WP_012581497.1|1203307_1206718_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003729716.1|1206815_1207268_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012581496.1|1207283_1210484_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_012581495.1|1210587_1211262_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
WP_041176503.1|1211299_1212226_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_012581493.1|1212379_1212643_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003729712.1|1212642_1213185_+	CvpA family protein	NA	NA	NA	NA	NA
WP_012581492.1|1213277_1214990_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.4	1.5e-17
WP_012581491.1|1215012_1217370_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_012581490.1|1217451_1217763_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	7.0e-19
WP_012581489.1|1217838_1219650_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003729709.1|1219843_1221058_+	aspartate kinase	NA	NA	NA	NA	NA
WP_014598970.1|1221115_1221610_-	YslB family protein	NA	NA	NA	NA	NA
WP_012581487.1|1221757_1222558_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1222570_1223317_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_012581486.1|1223320_1223932_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003726034.1|1223968_1224493_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012581485.1|1224778_1225933_-|integrase	site-specific integrase	integrase	Q8W5Y3	Listeria_phage	94.8	6.7e-208
WP_003730990.1|1226064_1226679_-	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	77.0	7.7e-78
WP_012581484.1|1226729_1227182_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.0	8.2e-77
WP_012581483.1|1227198_1227522_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	71.0	8.5e-36
WP_003730994.1|1227921_1228125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581482.1|1228191_1228383_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	86.9	4.6e-21
WP_003730996.1|1228404_1228647_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1228649_1228835_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_009929542.1|1229069_1229222_+	hypothetical protein	NA	A8ATD4	Listeria_phage	100.0	1.5e-19
WP_012581481.1|1229358_1229646_+	hypothetical protein	NA	A0A059T7V3	Listeria_phage	94.7	1.2e-44
WP_014589047.1|1229952_1231233_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	54.6	8.4e-119
WP_010991288.1|1231620_1231809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581477.1|1231805_1232099_+	hypothetical protein	NA	A8ATM4	Listeria_phage	78.4	8.9e-32
WP_012581476.1|1232115_1232514_+	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	56.4	6.8e-35
WP_012581475.1|1232514_1232685_+	hypothetical protein	NA	A0A059T7N2	Listeria_phage	94.4	6.7e-24
WP_012581474.1|1232684_1232873_+	hypothetical protein	NA	D7RWG4	Brochothrix_phage	45.0	8.8e-09
WP_012581473.1|1232869_1233325_+	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	85.9	6.2e-40
WP_003727764.1|1233321_1233507_+	hypothetical protein	NA	A0A059T5G1	Listeria_phage	100.0	4.1e-27
WP_003769971.1|1233503_1233794_+	hypothetical protein	NA	Q8W5X0	Listeria_phage	88.5	2.2e-43
WP_012581472.1|1233790_1233970_+	hypothetical protein	NA	A8ATE3	Listeria_phage	100.0	5.8e-26
WP_012581471.1|1233966_1234140_+	hypothetical protein	NA	A0A059T5G3	Listeria_phage	96.5	3.4e-23
WP_012581470.1|1234136_1234520_+	hypothetical protein	NA	A8ATE8	Listeria_phage	98.4	1.6e-65
WP_012581469.1|1234521_1235001_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	96.9	7.4e-76
WP_010991282.1|1235020_1235710_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	100.0	1.2e-130
WP_014589050.1|1235773_1237030_+	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	95.0	4.9e-220
WP_012581467.1|1237052_1237538_+	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	96.3	5.1e-85
WP_012581466.1|1237560_1239849_+	primase	NA	A8ATF3	Listeria_phage	91.3	0.0e+00
WP_012581465.1|1240182_1240500_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	94.2	2.1e-50
WP_003731659.1|1240501_1240714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581464.1|1241303_1241837_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	80.6	8.7e-78
WP_009917712.1|1241837_1242263_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_010991275.1|1242360_1243104_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_012581463.1|1243578_1243893_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	8.5e-57
WP_012581462.1|1243998_1244298_+|terminase	P27 family phage terminase small subunit	terminase	A8AT94	Listeria_phage	83.8	5.8e-39
WP_012581461.1|1244294_1245935_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	76.2	2.7e-250
WP_012581460.1|1245946_1247077_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	92.8	9.8e-204
WP_012581459.1|1247073_1247790_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.0	1.0e-65
WP_012581458.1|1247816_1248968_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	98.7	4.1e-213
WP_012581457.1|1248974_1249145_+	hypothetical protein	NA	A8AT99	Listeria_phage	92.9	1.2e-20
WP_003731645.1|1249154_1249454_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
WP_003731644.1|1249437_1249803_+	hypothetical protein	NA	A8ATA1	Listeria_phage	100.0	1.3e-64
WP_003731643.1|1249799_1250201_+	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
WP_012581456.1|1250197_1250581_+	hypothetical protein	NA	A8ATA3	Listeria_phage	100.0	3.8e-67
WP_012581455.1|1250602_1251190_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	100.0	4.0e-108
WP_009917698.1|1251260_1251593_+	hypothetical protein	NA	A8ATA5	Listeria_phage	99.1	1.8e-52
WP_009917697.1|1251643_1251793_+	hypothetical protein	NA	A8ATA6	Listeria_phage	100.0	3.0e-20
WP_014589053.1|1251808_1256725_+|tail	phage tail tape measure protein	tail	A8ATA7	Listeria_phage	97.4	0.0e+00
WP_012581452.1|1256724_1257555_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	100.0	1.7e-157
WP_012581451.1|1257564_1259157_+|tail	phage tail protein	tail	A8ATA9	Listeria_phage	100.0	1.2e-303
WP_012581450.1|1259156_1259381_+	hypothetical protein	NA	A8ATB0	Listeria_phage	100.0	1.5e-34
WP_012581449.1|1259380_1261300_+	hypothetical protein	NA	A8ATB1	Listeria_phage	99.8	0.0e+00
WP_014589054.1|1261311_1262586_+|plate	phage baseplate upper protein	plate	A8ATB2	Listeria_phage	96.5	6.1e-218
WP_012581447.1|1262602_1262923_+	hypothetical protein	NA	A8ATB3	Listeria_phage	81.1	5.5e-27
WP_012581446.1|1262923_1263070_+	XkdX family protein	NA	A0A059T6D9	Listeria_phage	100.0	1.1e-19
WP_012581445.1|1263095_1263551_+	hypothetical protein	NA	A8ATB5	Listeria_phage	100.0	1.2e-67
WP_012581444.1|1263517_1263913_+	hypothetical protein	NA	A8ATB6	Listeria_phage	100.0	2.4e-64
WP_012581443.1|1263925_1264174_+|holin	phage holin	holin	A8ATB7	Listeria_phage	100.0	1.4e-38
WP_012581442.1|1264173_1265004_+	M15 family metallopeptidase	NA	A8ATB8	Listeria_phage	89.1	2.3e-149
WP_012581441.1|1265384_1265651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041176506.1|1265643_1265973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581439.1|1265965_1266535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581438.1|1266605_1267055_-	anti-CRISPR protein AcrIIA1	NA	Q9T196	Listeria_phage	97.3	3.8e-74
WP_012581437.1|1267059_1267410_-	AcrIIA2 family anti-CRISPR protein	NA	Q9T195	Listeria_phage	98.3	1.2e-56
WP_012581436.1|1267441_1267819_-	anti-CRISPR protein AcrIIA3	NA	Q9T194	Listeria_phage	99.2	1.3e-67
WP_012581435.1|1267924_1268134_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	95.7	8.0e-27
WP_012581433.1|1269007_1269448_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012581432.1|1269901_1270312_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_012581431.1|1270402_1272028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003736406.1|1272340_1272760_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003736407.1|1272762_1273005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012581430.1|1273511_1273880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014589058.1|1273948_1274404_+	SUKH-3 domain-containing protein	NA	NA	NA	NA	NA
WP_012581428.1|1274618_1274981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012581427.1|1275648_1279338_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_012581426.1|1279460_1280819_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003723540.1|1280860_1281454_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_012581425.1|1281590_1281998_-	VOC family protein	NA	NA	NA	NA	NA
WP_003723542.1|1282162_1282762_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.5	2.9e-29
WP_003723543.1|1282794_1283055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581424.1|1283178_1284591_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	2.2e-51
WP_003730329.1|1284615_1284879_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_012581423.1|1285044_1285521_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003730327.1|1285557_1285803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581422.1|1285799_1287005_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726052.1|1287209_1287869_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1287908_1288103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730323.1|1288169_1289018_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1289348_1289486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003736429.1|1289636_1290350_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012581421.1|1290380_1292027_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1292045_1293530_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_012581420.1|1293647_1294109_+	NUDIX hydrolase	NA	NA	NA	NA	NA
1293950:1293966	attR	AGAAGAATTTGGTCAAT	NA	NA	NA	NA
WP_003726717.1|1294147_1294612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581419.1|1294800_1295715_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012581418.1|1295739_1296987_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.3	5.5e-107
WP_003736436.1|1296970_1297801_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.2e-46
WP_012581417.1|1297948_1299088_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NC_017529	Listeria monocytogenes L99, complete genome	2979198	1848683	1856969	2979198		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_012581151.1|1848683_1849250_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.1	1.7e-26
WP_012581150.1|1849246_1850296_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.1	3.2e-63
WP_003722245.1|1850314_1851742_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012581149.1|1851726_1853946_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.6e-160
WP_012581148.1|1853938_1854622_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1854625_1854871_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012581147.1|1854882_1855596_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	6.1e-42
WP_003729814.1|1855676_1856969_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 4
NC_017529	Listeria monocytogenes L99, complete genome	2979198	2531586	2539414	2979198		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2531586_2532558_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_012580771.1|2532565_2533534_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.9	8.8e-68
WP_003729205.1|2533535_2534411_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012580770.1|2534518_2536249_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.1e-174
WP_012580769.1|2536276_2537338_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003729208.1|2537353_2538337_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	1.8e-52
WP_003739737.1|2538454_2539414_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.1	1.5e-88
>prophage 5
NC_017529	Listeria monocytogenes L99, complete genome	2979198	2624907	2713634	2979198	holin,protease,terminase,capsid,portal,integrase,tail,plate,tRNA	Listeria_phage(83.58%)	105	2656858:2656872	2711097:2711111
WP_012580731.1|2624907_2626578_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|2626574_2627024_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_012580730.1|2627101_2627755_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_077904926.1|2627789_2628014_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_012580729.1|2628048_2629371_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.7	5.8e-30
WP_012580728.1|2629385_2630222_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003729274.1|2630540_2630741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003729275.1|2630763_2631087_-	YxeA family protein	NA	NA	NA	NA	NA
WP_012580727.1|2631240_2632902_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003726112.1|2633036_2633651_-	SdpI family protein	NA	NA	NA	NA	NA
WP_012580726.1|2633674_2634307_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003726114.1|2634307_2634832_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_012580725.1|2634834_2635833_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003729280.1|2635929_2636202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003729281.1|2636250_2637162_-	cation transporter	NA	NA	NA	NA	NA
WP_012580724.1|2637329_2638157_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012580723.1|2638271_2639144_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012580722.1|2639156_2639447_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012580721.1|2639494_2641579_-	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_012580719.1|2641986_2644308_-	InlB B-repeat-containing protein	NA	NA	NA	NA	NA
WP_003729288.1|2644659_2645331_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.6e-36
WP_012580718.1|2645330_2646419_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012580717.1|2646497_2647877_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	48.3	4.0e-58
WP_012580716.1|2647873_2648551_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.6	3.4e-58
WP_012580715.1|2648597_2649383_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_012580714.1|2649444_2649921_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_012580713.1|2649920_2652908_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012580712.1|2653405_2654248_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_012580711.1|2654297_2655779_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003728385.1|2655879_2656767_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2656858:2656872	attL	TTTAAACAATAAAAA	NA	NA	NA	NA
WP_012582427.1|2662557_2663586_-	P-loop NTPase	NA	NA	NA	NA	NA
WP_012582426.1|2663854_2665381_+	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	48.7	1.2e-26
WP_012582425.1|2665423_2666275_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.6	6.8e-48
WP_012582424.1|2666296_2666719_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012582423.1|2666840_2667203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582422.1|2667446_2668316_+	DUF4969 domain-containing protein	NA	NA	NA	NA	NA
WP_012582421.1|2668912_2669347_-	hypothetical protein	NA	A0A0B5CTT3	Listeria_phage	100.0	1.2e-80
WP_012582420.1|2669365_2670310_-	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	91.7	9.5e-168
WP_012582419.1|2670302_2670563_-|holin	phage holin	holin	Q8W5Y9	Listeria_phage	100.0	1.6e-40
WP_012582418.1|2670583_2670988_-	hypothetical protein	NA	Q8W5Z0	Listeria_phage	90.3	2.8e-44
WP_003743972.1|2670966_2671410_-	hypothetical protein	NA	Q8W5Z1	Listeria_phage	100.0	8.0e-77
WP_012582417.1|2671446_2671605_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	78.8	2.5e-12
WP_012582416.1|2671609_2671888_-	hypothetical protein	NA	A8ATB3	Listeria_phage	56.8	7.6e-17
WP_012582415.1|2671884_2672970_-|plate	BppU family phage baseplate upper protein	plate	A0A059T7W9	Listeria_phage	95.7	2.4e-82
WP_012582414.1|2672966_2673992_-	hypothetical protein	NA	A0A0B5D157	Listeria_phage	90.9	1.3e-173
WP_012582413.1|2673992_2675015_-|tail	phage tail protein	tail	A0A0B5D0G3	Listeria_phage	98.5	5.4e-193
WP_012582412.1|2675029_2675857_-|tail	phage tail family protein	tail	A0A059T6D8	Listeria_phage	96.7	1.1e-154
WP_012582411.1|2675853_2681220_-	tape measure protein	NA	Q9T1A7	Listeria_phage	95.6	0.0e+00
WP_003735024.1|2681230_2681830_-	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	72.0	1.9e-76
WP_003769943.1|2681835_2682258_-|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	97.9	5.9e-69
WP_012582410.1|2682312_2682552_-	Ig-like domain-containing protein	NA	A0A059T5E4	Listeria_phage	75.9	5.2e-22
WP_012582409.1|2682574_2683012_-	hypothetical protein	NA	A0A0B5CYN3	Listeria_phage	98.6	4.2e-78
WP_012582408.1|2683014_2683422_-	hypothetical protein	NA	A8ASK1	Listeria_phage	98.5	5.9e-66
WP_012582407.1|2683421_2683760_-	hypothetical protein	NA	A8ASK0	Listeria_phage	98.2	3.2e-57
WP_012582406.1|2683759_2684122_-	hypothetical protein	NA	Q9T1B4	Listeria_phage	94.2	1.5e-60
WP_010990219.1|2684121_2684517_-	hypothetical protein	NA	A0A059T5E3	Listeria_phage	99.2	6.7e-67
WP_012582405.1|2684535_2685537_-	hypothetical protein	NA	A0A059T6D4	Listeria_phage	99.4	1.4e-185
WP_012582404.1|2685536_2686127_-	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	92.0	9.1e-76
WP_012582403.1|2686205_2687345_-|capsid	phage minor capsid protein	capsid	A0A0B5D147	Listeria_phage	96.6	3.8e-203
WP_012582402.1|2687345_2689115_-|portal	phage portal protein	portal	A0A059T657	Listeria_phage	95.5	1.8e-265
WP_012582401.1|2689127_2690459_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	94.4	3.1e-249
WP_012582400.1|2690427_2690970_-|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.9	5.4e-91
WP_012582399.1|2691008_2691308_-	hypothetical protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	38.4	6.5e-14
WP_003735131.1|2691881_2692316_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_012582398.1|2692334_2692499_-	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	2.5e-20
WP_012582397.1|2692627_2693011_-	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	98.4	4.4e-63
WP_014589139.1|2693014_2693419_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	88.8	1.6e-60
WP_033533856.1|2693363_2693546_-	hypothetical protein	NA	A8ASP6	Listeria_phage	79.4	8.5e-17
WP_012582394.1|2693563_2694106_-	HNH endonuclease	NA	A0A1W6JNP0	Staphylococcus_phage	52.7	7.1e-43
WP_012582393.1|2694121_2694601_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	89.4	4.8e-75
WP_012582392.1|2694597_2694999_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	82.0	3.9e-54
WP_012582391.1|2695010_2695238_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	97.3	3.9e-35
WP_012582390.1|2695230_2695431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012582389.1|2695427_2695628_-	hypothetical protein	NA	A8ASP4	Listeria_phage	74.6	6.5e-18
WP_012582388.1|2695649_2696033_-	hypothetical protein	NA	A8ATZ3	Listeria_phage	90.6	1.5e-55
WP_012582387.1|2696029_2696491_-	hypothetical protein	NA	D9J0I6	Brochothrix_phage	33.1	8.2e-16
WP_012582386.1|2696487_2696661_-	hypothetical protein	NA	A0A059T7N2	Listeria_phage	93.0	4.7e-25
WP_012582385.1|2696661_2697051_-	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	54.6	3.8e-30
WP_012581477.1|2697067_2697361_-	hypothetical protein	NA	A8ATM4	Listeria_phage	78.4	8.9e-32
WP_010991288.1|2697357_2697546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010991289.1|2697538_2697937_-	hypothetical protein	NA	A0A0B5CYQ9	Listeria_phage	92.9	3.4e-66
WP_014589047.1|2697933_2699214_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1X9I6Y5	Streptococcus_phage	54.6	8.4e-119
WP_012582382.1|2699520_2699808_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	93.7	4.4e-44
WP_012582381.1|2699804_2700725_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	90.5	2.1e-140
WP_012582380.1|2700745_2701561_-	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	99.3	5.9e-150
WP_010991174.1|2701560_2702520_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	99.4	1.3e-177
WP_003731815.1|2702752_2702941_-	hypothetical protein	NA	A0A0B5CU43	Listeria_phage	98.4	1.7e-28
WP_003734955.1|2702956_2703247_-	hypothetical protein	NA	A0A0B5CYM2	Listeria_phage	100.0	1.0e-48
WP_012582379.1|2703271_2703805_-	hypothetical protein	NA	A0A0B5CU01	Listeria_phage	93.2	1.2e-82
WP_012582378.1|2703929_2704718_-	phage antirepressor Ant	NA	Q9T178	Listeria_phage	93.1	1.4e-135
WP_012582377.1|2704729_2705005_-	hypothetical protein	NA	A8ASM5	Listeria_phage	83.0	2.7e-38
WP_012582376.1|2705033_2705315_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	97.8	1.2e-46
WP_003735007.1|2705326_2705521_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_003727743.1|2705744_2706011_-	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_012582375.1|2706031_2706265_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	95.9	1.6e-31
WP_012582374.1|2706426_2706903_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	78.9	2.2e-56
WP_012582373.1|2707058_2707226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012582372.1|2707280_2707886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770015.1|2707947_2708823_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_012582371.1|2708890_2710084_+|integrase	site-specific integrase	integrase	A0A0B5CTZ4	Listeria_phage	100.0	2.2e-217
WP_003726075.1|2710169_2710562_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003727703.1|2710583_2711021_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_012582370.1|2711215_2711962_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
2711097:2711111	attR	TTTTTATTGTTTAAA	NA	NA	NA	NA
WP_003728530.1|2711967_2712765_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003727701.1|2712767_2713634_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.5e-10
