The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	0	5592	2687335	tRNA,transposase	Shigella_phage(33.33%)	6	NA	NA
WP_013744828.1|210_1068_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_043885237.1|1167_1980_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.9	4.2e-47
WP_013744830.1|1900_2215_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	47.3	4.1e-11
WP_013744831.1|2285_2618_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_013744832.1|2671_4069_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_013744833.1|4188_5592_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EJK5	Megavirus	36.8	2.5e-79
>prophage 2
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	9768	11600	2687335	transposase	Orpheovirus(25.0%)	4	NA	NA
WP_013744837.1|9768_10383_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.2	4.4e-25
WP_148234026.1|10460_10688_-|transposase	transposase	transposase	Q716C2	Shigella_phage	64.1	1.1e-16
WP_043885238.1|10647_11184_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.6	3.2e-11
WP_013744838.1|11294_11600_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	40.8	6.9e-11
>prophage 3
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	15181	18248	2687335		Acinetobacter_phage(100.0%)	3	NA	NA
WP_013744842.1|15181_16606_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.4	1.5e-31
WP_013744843.1|16616_17618_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	5.7e-54
WP_013744844.1|17666_18248_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.0	6.9e-36
>prophage 4
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	32779	33124	2687335		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_013744856.1|32779_33124_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	48.6	7.2e-25
>prophage 5
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	37570	39289	2687335		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_013744862.1|37570_39289_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	28.7	6.8e-55
>prophage 6
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	58377	65702	2687335		Virus_Rctr197k(33.33%)	4	NA	NA
WP_013744876.1|58377_60339_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	36.2	4.3e-05
WP_013744877.1|60338_63938_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	20.4	2.1e-05
WP_013744878.1|64028_64385_-	DsrE family protein	NA	NA	NA	NA	NA
WP_013744879.1|64394_65702_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.4	1.1e-60
>prophage 7
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	77117	77963	2687335		Vibrio_phage(100.0%)	1	NA	NA
WP_043885306.1|77117_77963_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.9	6.7e-40
>prophage 8
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	89211	89751	2687335		uncultured_virus(100.0%)	1	NA	NA
WP_013744901.1|89211_89751_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	30.9	1.4e-14
>prophage 9
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	95717	97004	2687335	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_013744908.1|95717_97004_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.4	8.3e-98
>prophage 10
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	102735	106232	2687335	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_013744911.1|102735_103509_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	27.4	6.9e-15
WP_013744912.1|103508_104603_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_013744913.1|104717_106232_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.4	2.4e-88
>prophage 11
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	114481	115336	2687335		Streptococcus_phage(100.0%)	1	NA	NA
WP_013744925.1|114481_115336_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	1.6e-49
>prophage 12
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	120300	126968	2687335	tRNA	Tetraselmis_virus(16.67%)	6	NA	NA
WP_013744930.1|120300_121236_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.7	1.2e-37
WP_013744931.1|121245_121806_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	28.1	1.9e-06
WP_013744932.1|121915_123916_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.5	8.0e-23
WP_013744933.1|124178_124640_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.2	4.9e-45
WP_013744934.1|124706_125453_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	2.5e-38
WP_013744935.1|125585_126968_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	78.1	8.7e-170
>prophage 13
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	133887	140868	2687335		Catovirus(50.0%)	6	NA	NA
WP_013744943.1|133887_134733_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.7	4.2e-26
WP_013744944.1|134831_135386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013744945.1|135443_136751_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_013744946.1|136945_138748_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.5	2.5e-44
WP_013744947.1|138895_139873_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	33.5	7.3e-22
WP_013744948.1|139872_140868_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	4.8e-13
>prophage 14
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	147843	148314	2687335		Staphylococcus_phage(100.0%)	1	NA	NA
WP_013744954.1|147843_148314_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 15
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	152388	161468	2687335	tRNA,protease	Aeromonas_phage(20.0%)	7	NA	NA
WP_013744962.1|152388_153474_-|protease	protease SohB	protease	A0A219YA27	Aeromonas_phage	26.6	2.7e-09
WP_013744963.1|153702_154593_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_013744964.1|154646_156308_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	75.1	4.7e-247
WP_013744965.1|156592_157759_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	50.9	2.3e-06
WP_013744966.1|157767_159705_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	44.1	1.7e-41
WP_013744967.1|159801_161172_+	TolC family protein	NA	NA	NA	NA	NA
WP_013744968.1|161258_161468_-	cold shock domain-containing protein CspD	NA	Q9AZD3	Lactococcus_phage	53.8	8.0e-11
>prophage 16
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	164753	165875	2687335		Bacillus_virus(100.0%)	1	NA	NA
WP_013744971.1|164753_165875_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	37.9	3.1e-32
>prophage 17
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	169194	275019	2687335	integrase,portal,tRNA,protease,holin,head,tail,plate,transposase,terminase,capsid	Mannheimia_phage(27.78%)	111	168986:169009	230254:230277
168986:169009	attL	ACCAACACTTTTGTCTACTATGCC	NA	NA	NA	NA
WP_043885242.1|169194_170007_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.9	3.2e-47
WP_013744977.1|169927_170302_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	39.1	9.3e-10
WP_013744978.1|170581_171088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013744979.1|171187_173074_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_013744980.1|173075_174467_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_013744981.1|174528_175359_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_013744984.1|176217_177204_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_013744985.1|177375_177783_+	OsmC family protein	NA	NA	NA	NA	NA
WP_013744986.1|178146_178434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013744987.1|178445_179000_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013744988.1|179103_179997_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013744991.1|181156_181963_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	3.2e-39
WP_013744992.1|182152_183058_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013744993.1|183549_184476_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.7	7.1e-59
WP_013744994.1|184596_186024_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.6	6.9e-37
WP_013744995.1|186039_186843_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	26.4	4.2e-07
WP_013744996.1|186930_187791_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_013744997.1|187852_190360_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	2.1e-12
WP_013744998.1|191123_192452_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013744999.1|192538_193402_+	membrane protein	NA	NA	NA	NA	NA
WP_013745000.1|193439_194795_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_013745001.1|194808_195849_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.0	4.0e-18
WP_013745002.1|195863_197723_-	signal peptide peptidase SppA	NA	A0A2I6UG67	Salinibacter_virus	25.8	9.1e-13
WP_013745003.1|197854_198415_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_013745004.1|198483_199611_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_013745005.1|199630_200689_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.3	9.2e-87
WP_013745006.1|200933_201290_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013745007.1|201655_202903_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.9	1.7e-71
WP_013745008.1|202987_204196_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.7e-50
WP_013745009.1|204293_204488_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_013745010.1|204509_206609_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	43.3	5.1e-129
WP_013745011.1|206610_206868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745012.1|206929_207112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745013.1|207101_207374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745014.1|207402_207651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745015.1|207735_207996_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	60.3	5.3e-20
WP_013745016.1|208005_208578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745018.1|208740_208929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745019.1|209057_209438_+	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	35.9	3.5e-12
WP_013745020.1|209472_209709_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013745021.1|209709_209916_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_013745022.1|209943_210321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745023.1|210387_211122_+	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_013745024.1|211102_211288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745025.1|211362_211569_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	55.9	2.2e-13
WP_013745026.1|211606_213592_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_013745027.1|213586_214636_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	67.3	1.5e-134
WP_013745028.1|214869_215322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745029.1|215318_216458_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	48.5	3.2e-93
WP_193359441.1|216454_216892_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	52.4	1.0e-39
WP_013745031.1|216895_217009_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_013745032.1|217050_217383_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	37.3	7.5e-11
WP_013745033.1|217424_217931_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	56.5	6.2e-49
WP_013745034.1|217944_219144_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	55.2	8.5e-121
WP_013745035.1|219308_219581_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	75.6	7.0e-31
WP_013745036.1|219628_220222_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	37.2	4.3e-17
WP_013745037.1|220233_221646_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	49.5	7.8e-49
WP_013745038.1|221664_222204_-|tail	phage tail protein I	tail	A0A0M3LQW2	Mannheimia_phage	47.5	2.4e-43
WP_013745039.1|222196_223108_-|plate	baseplate J/gp47 family protein	plate	A0A0M4REB7	Salmonella_phage	52.1	2.2e-76
WP_148234064.1|223108_223420_-	GPW/gp25 family protein	NA	Q19UQ6	Mannheimia_phage	52.1	9.1e-19
WP_013745041.1|223437_224064_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	47.6	6.5e-24
WP_013745042.1|224187_224484_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043885244.1|224724_225861_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.8	3.5e-124
WP_013745045.1|226126_226396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745046.1|226469_229313_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	39.9	1.6e-80
WP_013745047.1|229391_229673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745048.1|229678_230059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158305794.1|230047_230248_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	47.5	3.9e-07
WP_013745051.1|231296_231599_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	43.8	2.9e-09
230254:230277	attR	GGCATAGTAGACAAAAGTGTTGGT	NA	NA	NA	NA
WP_013745052.1|231586_232078_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	47.1	3.8e-27
WP_013745053.1|232074_232287_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013745054.1|232433_232769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745055.1|232756_233275_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	44.8	2.8e-36
WP_052115771.1|233258_233453_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_039090772.1|233455_233662_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	46.4	1.3e-08
WP_013745058.1|233679_234138_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	32.8	3.9e-10
WP_013745059.1|234181_234934_-|terminase	phage small terminase subunit	terminase	Q19US0	Mannheimia_phage	40.1	1.2e-32
WP_013745060.1|234946_236008_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	53.4	1.4e-98
WP_013745061.1|236024_236912_-|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	51.2	1.4e-56
WP_013745062.1|237046_238819_+	oxidoreductase	NA	A0A0M3LRV4	Mannheimia_phage	62.8	2.2e-205
WP_013745063.1|238827_239826_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	55.5	1.3e-103
WP_013745065.1|241291_242626_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	28.3	1.2e-43
WP_013745066.1|242641_243166_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_013745067.1|243385_245329_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_043885245.1|245433_246078_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.8	2.2e-22
WP_013745069.1|246104_246665_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	38.2	3.2e-06
WP_013745070.1|246860_248270_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_013745071.1|248429_250439_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	6.9e-83
WP_013745072.1|250546_251203_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013745073.1|251429_252662_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_013745074.1|252645_255303_+	MCE family protein	NA	NA	NA	NA	NA
WP_013745075.1|255560_257483_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.7	5.6e-58
WP_013745076.1|257597_258506_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013745077.1|258536_259298_-	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	28.6	3.0e-15
WP_013745078.1|259288_260254_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_026210961.1|260246_261200_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	50.6	1.9e-83
WP_013745080.1|261396_262155_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013745081.1|262199_263255_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	6.5e-24
WP_013745082.1|263247_263964_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013745083.1|263989_264760_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013745084.1|264760_265702_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	1.9e-19
WP_013745085.1|265821_266511_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_013745086.1|266517_267054_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_013745087.1|267129_267993_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_013745088.1|268093_269158_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_013745089.1|269692_270256_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	28.4	4.8e-10
WP_013745090.1|270308_271052_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013745091.1|271064_271517_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_013745092.1|271520_272414_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_013745093.1|272427_274197_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	1.7e-08
WP_013745094.1|274290_275019_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	S5VMD2	Pseudomonas_phage	30.5	1.9e-22
>prophage 18
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	281468	282965	2687335		Aphanizomenon_phage(100.0%)	1	NA	NA
WP_013745101.1|281468_282965_+	AAA family ATPase	NA	A0A2H4PB07	Aphanizomenon_phage	27.9	2.3e-27
>prophage 19
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	291192	294145	2687335		Bacillus_phage(50.0%)	4	NA	NA
WP_013745111.1|291192_292071_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.6	3.1e-11
WP_179256243.1|292063_292894_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013745113.1|293018_293354_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_013745114.1|293482_294145_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.5e-47
>prophage 20
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	308948	309857	2687335		Catovirus(100.0%)	1	NA	NA
WP_013745127.1|308948_309857_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.2	1.1e-14
>prophage 21
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	325795	331984	2687335		Yersinia_phage(33.33%)	5	NA	NA
WP_013745141.1|325795_329806_-	YadA-like family protein	NA	A0A0B5A2K4	Yersinia_phage	41.2	1.8e-05
WP_013745142.1|330007_330181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745143.1|330184_330481_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	55.8	2.1e-20
WP_013745144.1|330731_331010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745145.1|331150_331984_+	hypothetical protein	NA	A0A0E3D995	Bacillus_phage	29.1	6.9e-05
>prophage 22
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	351339	352293	2687335		Caulobacter_phage(100.0%)	1	NA	NA
WP_013745172.1|351339_352293_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.9	2.4e-49
>prophage 23
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	364800	372494	2687335		Lactobacillus_phage(33.33%)	8	NA	NA
WP_013745193.1|364800_365010_-	hypothetical protein	NA	A0A0A7NNQ1	Lactobacillus_phage	56.0	6.6e-05
WP_013745194.1|365263_365779_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_013745195.1|366628_367051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745196.1|367975_369934_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	32.6	2.0e-47
WP_013745197.1|369930_370191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745198.1|370500_371001_-	DUF3158 family protein	NA	NA	NA	NA	NA
WP_013745199.1|370997_371729_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_013745201.1|372074_372494_-	single-stranded DNA-binding protein	NA	D5LH30	Escherichia_phage	57.7	8.5e-28
>prophage 24
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	376207	377545	2687335		Escherichia_phage(100.0%)	1	NA	NA
WP_013745205.1|376207_377545_-	replicative DNA helicase	NA	O80281	Escherichia_phage	41.1	1.7e-82
>prophage 25
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	386698	387907	2687335		Klosneuvirus(100.0%)	1	NA	NA
WP_013745213.1|386698_387907_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.7	6.5e-28
>prophage 26
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	400462	404780	2687335		Leptospira_phage(50.0%)	2	NA	NA
WP_013745223.1|400462_403552_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	2.1e-59
WP_013745224.1|403730_404780_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	20.7	2.1e-06
>prophage 27
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	410733	415615	2687335		Prochlorococcus_phage(66.67%)	4	NA	NA
WP_013745232.1|410733_411774_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.0	1.2e-75
WP_013745233.1|411773_412424_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	38.9	1.6e-25
WP_013745235.1|413581_414763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745236.1|414892_415615_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	49.8	7.0e-46
>prophage 28
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	434555	446816	2687335	transposase	Tetraselmis_virus(12.5%)	15	NA	NA
WP_013745245.1|434555_435296_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	29.2	2.9e-23
WP_013745246.1|435320_436337_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	2.7e-88
WP_013745247.1|436350_437622_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_013745248.1|437694_438339_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	35.2	9.4e-10
WP_013745249.1|438471_439428_+	AEC family transporter	NA	NA	NA	NA	NA
WP_148234035.1|439495_439972_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	49.7	1.8e-34
WP_013745251.1|439991_440219_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013745252.1|440363_440606_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	46.8	2.4e-11
WP_013745253.1|441215_442481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745254.1|442483_443065_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	39.5	2.4e-28
WP_013745255.1|443080_443737_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.9	5.6e-34
WP_013745256.1|443942_444122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745257.1|444118_444439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745258.1|444477_445080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745259.1|445952_446816_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.7	5.8e-31
>prophage 29
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	454844	455387	2687335		Agrobacterium_phage(100.0%)	1	NA	NA
WP_080558789.1|454844_455387_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	1.2e-13
>prophage 30
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	458642	472225	2687335		uncultured_Mediterranean_phage(40.0%)	12	NA	NA
WP_013745272.1|458642_458975_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	37.0	2.4e-09
WP_031205127.1|459090_460935_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_013745274.1|460949_461924_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.2	4.7e-45
WP_013745275.1|462032_462515_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_013745277.1|462684_464433_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_013745278.1|464436_464889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745279.1|464902_465583_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	2.3e-22
WP_013745280.1|465592_466756_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_013745281.1|466799_467153_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_013745282.1|467342_470243_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.5	1.4e-81
WP_013745283.1|470253_470868_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013745284.1|470887_472225_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	5.1e-82
>prophage 31
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	475415	476438	2687335		Bacillus_virus(100.0%)	1	NA	NA
WP_039150890.1|475415_476438_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	4.2e-28
>prophage 32
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	502974	505395	2687335		Bacillus_virus(100.0%)	1	NA	NA
WP_013745311.1|502974_505395_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.3	7.9e-118
>prophage 33
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	515681	518587	2687335		Streptococcus_phage(50.0%)	3	NA	NA
WP_013745325.1|515681_516314_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	45.5	6.2e-30
WP_013745326.1|516310_517360_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_013745327.1|517471_518587_-	methionine biosynthesis PLP-dependent protein	NA	A0A1V0SL56	Klosneuvirus	25.5	1.9e-18
>prophage 34
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	526027	527617	2687335		Streptococcus_phage(100.0%)	1	NA	NA
WP_013745334.1|526027_527617_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.4	5.0e-28
>prophage 35
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	531545	537291	2687335		Phage_21(33.33%)	5	NA	NA
WP_013745339.1|531545_532799_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	53.7	3.2e-06
WP_013745340.1|532962_533634_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_013745341.1|533636_534098_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_013745342.1|534169_535120_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.7	1.9e-67
WP_013745343.1|535326_537291_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	6.1e-92
>prophage 36
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	544044	547539	2687335		Staphylococcus_phage(50.0%)	2	NA	NA
WP_013745348.1|544044_546009_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	1.5e-90
WP_013745349.1|546078_547539_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.9	5.9e-100
>prophage 37
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	558498	559599	2687335		Bacillus_virus(100.0%)	1	NA	NA
WP_013745356.1|558498_559599_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	35.1	7.2e-26
>prophage 38
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	567969	570610	2687335		uncultured_Caudovirales_phage(25.0%)	4	NA	NA
WP_013745363.1|567969_568644_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.9	1.2e-55
WP_043885324.1|568627_569056_+	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	40.3	6.0e-21
WP_013745365.1|569055_569667_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	36.9	1.6e-11
WP_013745366.1|569749_570610_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.6	8.6e-51
>prophage 39
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	574667	579390	2687335	transposase	Macacine_betaherpesvirus(25.0%)	7	NA	NA
WP_013745370.1|574667_575057_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	52.8	5.3e-32
WP_013745371.1|575132_575582_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_013745372.1|575645_576233_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_013745373.1|576382_576772_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148234038.1|576795_578132_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.9	2.7e-59
WP_013745376.1|578219_578699_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.3	1.4e-18
WP_013745377.1|578817_579390_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	35.2	1.2e-27
>prophage 40
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	590052	591564	2687335		Staphylococcus_phage(100.0%)	1	NA	NA
WP_013745387.1|590052_591564_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.9e-16
>prophage 41
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	595135	678697	2687335	protease,transposase	Escherichia_phage(25.0%)	65	NA	NA
WP_013745391.1|595135_597175_+	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	32.9	2.7e-10
WP_013745392.1|597211_597511_+	trp operon repressor	NA	NA	NA	NA	NA
WP_013745393.1|597497_598208_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_013745394.1|598368_599799_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.6	1.5e-84
WP_026211001.1|599933_601835_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQ50	Micromonas_sp._RCC1109_virus	44.3	4.9e-115
WP_013745396.1|601896_602526_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_013745398.1|602896_604033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745399.1|604104_605523_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_013745400.1|605708_606011_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_013745402.1|606846_607995_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	1.2e-127
WP_013745403.1|608230_608707_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013745404.1|614946_616026_-	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_013745405.1|616186_617473_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_026211127.1|617656_619039_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.4	8.2e-27
WP_013745407.1|619096_621052_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_013745408.1|621161_621983_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013745409.1|621984_622671_+	NAD-dependent deacetylase	NA	R9TG77	Vibrio_phage	41.2	6.7e-30
WP_013745410.1|622743_623430_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_013744975.1|623849_624452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013745412.1|624606_626877_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_013745413.1|627344_628049_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_013745414.1|628077_629274_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	9.3e-27
WP_013745415.1|629270_630218_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_013745416.1|630563_631577_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_162467668.1|631747_633787_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_013745418.1|633854_634976_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.9	4.8e-17
WP_013745419.1|635102_637022_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.0	9.6e-151
WP_013745420.1|637333_638647_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_013745421.1|638671_640081_+	YdgA family protein	NA	NA	NA	NA	NA
WP_013745422.1|640143_641367_-	MFS transporter	NA	NA	NA	NA	NA
WP_080558814.1|641366_642254_-	cytochrome P450	NA	NA	NA	NA	NA
WP_013745424.1|642423_643815_-	radical SAM protein	NA	NA	NA	NA	NA
WP_013745425.1|643831_644212_-	adenosylmethionine decarboxylase	NA	A0A1D7SGA8	Cyanophage	35.1	2.3e-08
WP_013745426.1|644707_645154_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_013745427.1|645178_646843_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_013745430.1|648729_649479_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_013745431.1|649602_650334_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_013745432.1|650355_651756_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013745433.1|651756_652164_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_013745434.1|652274_652658_+	copper ion binding protein	NA	NA	NA	NA	NA
WP_013745435.1|652624_654925_+	cation-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.8	1.3e-85
WP_013745436.1|654912_655140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043885251.1|655160_656297_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_013745438.1|656438_657029_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_013745439.1|657030_657918_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_013745440.1|658033_659458_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_013745441.1|659535_660498_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_013745442.1|660579_660858_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_013745443.1|660871_661156_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_013745444.1|661422_662910_-	gluconate permease	NA	NA	NA	NA	NA
WP_013745445.1|662924_663872_-	SDR family oxidoreductase	NA	K7QJG5	Escherichia_phage	27.5	1.0e-07
WP_013745446.1|663893_664676_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013745447.1|664678_665311_-	aldolase	NA	A0A077SK32	Escherichia_phage	55.8	2.0e-60
WP_013745448.1|665307_666546_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	54.1	1.7e-116
WP_013745449.1|666547_667447_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	69.4	5.8e-106
WP_013745450.1|667688_668453_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	51.0	5.1e-63
WP_013745451.1|668432_670376_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	7.2e-37
WP_148234065.1|670669_672721_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_018346751.1|672809_673076_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_013745453.1|673052_674351_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	36.5	7.9e-72
WP_039084830.1|674491_675385_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_013745455.1|675387_676632_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_013745456.1|676873_677731_+	EamA family transporter	NA	NA	NA	NA	NA
WP_013745457.1|677802_678363_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_013745458.1|678433_678697_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.1	2.5e-25
>prophage 42
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	688594	691756	2687335		Liberibacter_phage(100.0%)	1	NA	NA
WP_013745469.1|688594_691756_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.2	1.5e-71
>prophage 43
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	698396	699431	2687335		Planktothrix_phage(100.0%)	1	NA	NA
WP_013745471.1|698396_699431_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-34
>prophage 44
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	707977	714610	2687335		Bacillus_phage(33.33%)	4	NA	NA
WP_013745483.1|707977_709726_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.1	2.1e-51
WP_013745484.1|709798_712183_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	27.2	1.1e-18
WP_031204683.1|712515_712965_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_013745486.1|713101_714610_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	38.1	3.1e-27
>prophage 45
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	721466	726904	2687335	tRNA	Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_013745493.1|721466_723020_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.8	1.7e-09
WP_013745494.1|723399_725352_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_043885328.1|725352_725811_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_031204677.1|725818_726904_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.2	7.3e-47
>prophage 46
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	734325	735054	2687335		Planktothrix_phage(100.0%)	1	NA	NA
WP_013745505.1|734325_735054_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.6	1.8e-28
>prophage 47
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	738340	742675	2687335		Aeromonas_phage(50.0%)	3	NA	NA
WP_013745509.1|738340_739603_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	4.0e-97
WP_013745510.1|739772_741059_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_013745511.1|741073_742675_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	1.5e-72
>prophage 48
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	747980	750908	2687335		Escherichia_phage(50.0%)	2	NA	NA
WP_013745516.1|747980_749429_-	replicative DNA helicase	NA	O80281	Escherichia_phage	64.3	8.0e-158
WP_013745517.1|749576_750908_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	6.9e-55
>prophage 49
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	754758	757387	2687335		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_013745522.1|754758_756591_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	44.9	7.3e-132
WP_013745523.1|756613_757387_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.3	7.3e-17
>prophage 50
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	760446	765293	2687335		Pseudomonas_phage(33.33%)	6	NA	NA
WP_013745525.1|760446_760704_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	53.1	1.2e-11
WP_013745526.1|760700_761432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745527.1|761443_762859_-	nicotinate phosphoribosyltransferase	NA	A0A292GDC4	Xanthomonas_phage	45.8	9.4e-103
WP_013745528.1|762872_763520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745529.1|763543_764461_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_013745530.1|764669_765293_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.2	5.5e-47
>prophage 51
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	769029	773255	2687335		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_013745536.1|769029_770358_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	34.7	1.4e-31
WP_013745537.1|770456_771137_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_013745538.1|771238_772888_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_158305803.1|772943_773255_+	integration host factor subunit beta	NA	Q2A099	Sodalis_phage	37.8	4.7e-07
>prophage 52
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	779109	779916	2687335		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_013745548.1|779109_779916_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	29.6	1.3e-13
>prophage 53
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	790759	792740	2687335		Planktothrix_phage(50.0%)	2	NA	NA
WP_013745555.1|790759_791743_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.3e-15
WP_013745556.1|791735_792740_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	1.1e-15
>prophage 54
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	817438	818074	2687335		Enterobacteria_phage(100.0%)	1	NA	NA
WP_179255232.1|817438_818074_-	repressor LexA	NA	A5LH73	Enterobacteria_phage	46.1	5.8e-12
>prophage 55
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	825224	878831	2687335	tRNA,protease,transposase	Salmonella_phage(23.08%)	46	NA	NA
WP_013745587.1|825224_827486_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	1.7e-29
WP_013745588.1|827485_828217_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_013745589.1|828230_829088_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013745590.1|829143_829677_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_043885254.1|830005_831142_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.8	3.8e-123
WP_148234040.1|831171_831603_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.7	1.5e-48
WP_013745594.1|831924_836610_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_148234041.1|836633_837119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745596.1|837013_837520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745597.1|838186_840256_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_013745598.1|840302_841013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745599.1|841284_841668_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_013745600.1|841717_842755_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	40.0	1.7e-21
WP_013745601.1|842788_843055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745602.1|843054_843708_-	FABP family protein	NA	NA	NA	NA	NA
WP_013745603.1|843718_844630_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_013745604.1|844877_845690_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_013745605.1|845686_846832_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_013745606.1|847614_848430_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
WP_013745607.1|848541_849108_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.2	1.6e-21
WP_013745608.1|849279_850581_+	trigger factor	NA	NA	NA	NA	NA
WP_013745609.1|850721_851309_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.4	6.3e-61
WP_013745610.1|851320_852568_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.9	7.2e-123
WP_013745611.1|852709_853108_+	YbaN family protein	NA	NA	NA	NA	NA
WP_013745612.1|853238_854540_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_013745613.1|854759_855920_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_013745614.1|855921_856860_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_013745615.1|856863_858552_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_013745616.1|858599_859466_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013745617.1|859576_859975_+	DoxX family protein	NA	NA	NA	NA	NA
WP_013745618.1|860004_860595_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013745619.1|860744_861161_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.0e-49
WP_148234066.1|862493_863399_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_013745622.1|863398_863626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745623.1|863876_865460_+	asparagine synthase B	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	44.2	1.4e-99
WP_043885255.1|865620_866757_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	3.3e-122
WP_013745626.1|867332_867917_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_013745627.1|868019_868712_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_148234042.1|868711_871237_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_043885256.1|871248_872376_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_013745630.1|872458_873601_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	3.9e-91
WP_013745631.1|873685_874756_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013745632.1|874920_875919_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_013745633.1|876283_876589_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	40.2	1.5e-10
WP_013745634.1|877598_878249_-	stress protein	NA	NA	NA	NA	NA
WP_013745635.1|878252_878831_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.1	1.6e-29
>prophage 56
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	884961	892790	2687335		Escherichia_phage(25.0%)	5	NA	NA
WP_013745643.1|884961_885960_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	53.5	2.1e-85
WP_013745644.1|886139_887801_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.4	4.5e-189
WP_013745645.1|887827_888118_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	1.0e-11
WP_013745646.1|888451_889870_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_013745647.1|890012_892790_+	DNA polymerase I	NA	W5R9D5	Staphylococcus_phage	27.6	2.1e-45
>prophage 57
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	905445	906546	2687335		Rhizobium_phage(100.0%)	1	NA	NA
WP_013745659.1|905445_906546_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	27.1	1.0e-40
>prophage 58
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	927516	932212	2687335	tRNA	Mimivirus(25.0%)	4	NA	NA
WP_013745681.1|927516_928344_-	DNA ligase	NA	A0A1X9VNU1	Mimivirus	29.8	6.8e-29
WP_013745682.1|928489_929998_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.5	2.0e-87
WP_115241568.1|930094_931193_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	4.8e-06
WP_013745684.1|931372_932212_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	40.4	1.2e-44
>prophage 59
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	935980	937138	2687335		Halovirus(100.0%)	1	NA	NA
WP_013745690.1|935980_937138_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.5	2.9e-49
>prophage 60
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	940503	941823	2687335		Moraxella_phage(100.0%)	1	NA	NA
WP_013745692.1|940503_941823_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	79.5	1.2e-173
>prophage 61
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	945483	946629	2687335		Escherichia_phage(50.0%)	2	NA	NA
WP_013745697.1|945483_946305_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A222YWF0	Escherichia_phage	42.6	1.9e-07
WP_013745698.1|946356_946629_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	54.4	2.0e-17
>prophage 62
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	951119	952320	2687335		Haemophilus_phage(50.0%)	2	NA	NA
WP_148234044.1|951119_951743_+	hypothetical protein	NA	B7SDN5	Haemophilus_phage	48.7	9.0e-42
WP_013745705.1|951858_952320_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	45.1	1.5e-30
>prophage 63
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	961718	972868	2687335	tRNA	uncultured_Mediterranean_phage(16.67%)	9	NA	NA
WP_013745709.1|961718_963857_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	40.5	6.8e-12
WP_013745710.1|963893_964166_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_013745711.1|964229_964859_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.5	8.1e-14
WP_013745712.1|964942_965572_-	MarC family protein	NA	NA	NA	NA	NA
WP_013745713.1|965624_967532_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.8	1.9e-66
WP_013745714.1|967574_968594_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	4.5e-107
WP_013745715.1|968796_969012_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_013745716.1|969152_970943_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	31.6	4.4e-41
WP_013745717.1|970993_972868_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.4	2.9e-35
>prophage 64
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	987454	992998	2687335		Bacillus_phage(33.33%)	3	NA	NA
WP_013745727.1|987454_989467_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.7	8.9e-115
WP_013745728.1|989649_990834_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	25.8	1.4e-11
WP_013745729.1|990892_992998_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.9e-59
>prophage 65
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	998586	1006755	2687335		Bacillus_phage(33.33%)	5	NA	NA
WP_013745740.1|998586_1000428_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	6.4e-27
WP_013745741.1|1000505_1002134_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_013745742.1|1002262_1003711_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	25.7	1.5e-10
WP_013745743.1|1003703_1005398_-	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_013745744.1|1005555_1006755_-	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	32.1	7.7e-05
>prophage 66
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1016602	1025285	2687335	protease	Xanthomonas_phage(25.0%)	7	NA	NA
WP_013745758.1|1016602_1017055_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	1.2e-48
WP_013745759.1|1017041_1018271_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.1	2.0e-45
WP_043885333.1|1018462_1019137_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013745761.1|1019224_1021111_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.7	5.4e-122
WP_013745762.1|1021330_1021951_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_013745763.1|1022015_1022522_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_013745764.1|1022711_1025285_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	33.9	1.3e-123
>prophage 67
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1029366	1034934	2687335	integrase	Burkholderia_phage(33.33%)	6	1019743:1019757	1042470:1042484
1019743:1019757	attL	TCTTATTAAAGATTT	NA	NA	NA	NA
WP_013745767.1|1029366_1030476_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	28.3	9.5e-10
WP_013745768.1|1030472_1030907_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_013745769.1|1030922_1031801_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_013745770.1|1031793_1032798_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.9	1.8e-68
WP_013745771.1|1032794_1033880_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013745772.1|1034001_1034934_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	47.2	1.5e-77
1042470:1042484	attR	AAATCTTTAATAAGA	NA	NA	NA	NA
>prophage 68
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1043306	1048534	2687335		Gordonia_phage(33.33%)	4	NA	NA
WP_013745777.1|1043306_1044761_-	putative DNA binding domain-containing protein	NA	A0A1B3AYT3	Gordonia_phage	30.1	6.4e-46
WP_013745778.1|1044849_1046022_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013745779.1|1046018_1047002_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	3.1e-68
WP_013745780.1|1046998_1048534_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.3e-105
>prophage 69
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1054397	1061505	2687335		Trichoplusia_ni_ascovirus(20.0%)	9	NA	NA
WP_115241582.1|1054397_1055126_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.8	2.0e-16
WP_013745789.1|1055378_1055609_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	51.5	2.3e-11
WP_013745791.1|1055883_1056786_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_013745792.1|1056788_1056929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013745793.1|1057017_1058631_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	48.7	1.3e-129
WP_013745794.1|1058743_1059601_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.1	6.2e-25
WP_013745795.1|1059690_1059948_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_013745796.1|1059968_1060280_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013745797.1|1060533_1061505_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.0	3.4e-11
>prophage 70
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1070147	1072493	2687335		Lactococcus_phage(100.0%)	1	NA	NA
WP_013745807.1|1070147_1072493_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.4	1.3e-69
>prophage 71
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1086869	1090693	2687335	protease	Lactobacillus_phage(50.0%)	7	NA	NA
WP_013745819.1|1086869_1087391_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	30.0	1.4e-11
WP_013745820.1|1087541_1087868_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_013745821.1|1087927_1088224_-	DUF5374 domain-containing protein	NA	NA	NA	NA	NA
WP_013745822.1|1088204_1088858_-	DUF2572 family protein	NA	NA	NA	NA	NA
WP_013745823.1|1088841_1089564_-	type II secretion pathway, component PulJ	NA	NA	NA	NA	NA
WP_013745824.1|1089553_1090087_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_013745825.1|1090231_1090693_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.1	1.8e-26
>prophage 72
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1096315	1100177	2687335		Mycobacterium_phage(50.0%)	2	NA	NA
WP_013745832.1|1096315_1097383_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	2.0e-113
WP_013745833.1|1097591_1100177_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.4	2.3e-30
>prophage 73
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1119945	1128537	2687335		uncultured_Mediterranean_phage(25.0%)	6	NA	NA
WP_013745851.1|1119945_1122780_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
WP_013745852.1|1122921_1123437_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	67.8	4.5e-39
WP_013745853.1|1123533_1124421_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013745854.1|1124537_1125380_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	32.0	3.6e-33
WP_013745856.1|1125711_1126809_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_013745857.1|1126890_1128537_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	25.3	6.8e-28
>prophage 74
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1133092	1137340	2687335	transposase	Wolbachia_phage(50.0%)	4	NA	NA
WP_013745862.1|1133092_1134097_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.4	4.9e-90
WP_013745863.1|1134395_1135082_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_013745864.1|1135254_1135887_-	flavodoxin	NA	NA	NA	NA	NA
WP_013744838.1|1137034_1137340_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	40.8	6.9e-11
>prophage 75
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1147760	1148870	2687335	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_043885237.1|1147760_1148573_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.9	4.2e-47
WP_013745252.1|1148627_1148870_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	46.8	2.4e-11
>prophage 76
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1155220	1159129	2687335		Burkholderia_phage(100.0%)	1	NA	NA
WP_013745880.1|1155220_1159129_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.1	5.4e-116
>prophage 77
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1162268	1163462	2687335		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_013745884.1|1162268_1163462_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	45.9	5.0e-81
>prophage 78
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1181973	1198904	2687335	tRNA,transposase	Bacillus_phage(50.0%)	14	NA	NA
WP_043885261.1|1181973_1183110_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_013745892.1|1183283_1185449_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	9.6e-115
WP_013745893.1|1185568_1186414_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.5	3.3e-47
WP_013745894.1|1186555_1187596_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	39.0	5.5e-52
WP_013745895.1|1187659_1188610_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_013745896.1|1188609_1189458_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_013745897.1|1189468_1190245_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.4	4.8e-16
WP_013745898.1|1190273_1190963_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	34.1	5.7e-29
WP_013745899.1|1190966_1192271_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.8	8.9e-23
WP_013745900.1|1192272_1192926_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_013745901.1|1192928_1195847_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.4	4.1e-28
WP_013745902.1|1196084_1196768_+	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	39.5	1.3e-41
WP_013745903.1|1196861_1197311_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013745904.1|1197470_1198904_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.2	3.4e-84
>prophage 79
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1209146	1210598	2687335		Bacillus_phage(100.0%)	1	NA	NA
WP_043885262.1|1209146_1210598_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	22.2	3.1e-08
>prophage 80
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1225823	1231334	2687335		Indivirus(50.0%)	4	NA	NA
WP_013745924.1|1225823_1227584_+	ABC transporter ATP-binding protein/permease	NA	A0A1V0SE00	Indivirus	28.4	6.8e-10
WP_039154501.1|1227861_1228719_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148234068.1|1228741_1229668_+	D-allose transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013745927.1|1229792_1231334_+	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A285PWH2	Cedratvirus	25.8	9.2e-11
>prophage 81
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1235605	1235866	2687335		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_013745933.1|1235605_1235866_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.8	1.4e-17
>prophage 82
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1259308	1261701	2687335		Streptococcus_phage(50.0%)	2	NA	NA
WP_001096887.1|1259308_1260103_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_013745966.1|1260435_1261701_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.7	8.6e-31
>prophage 83
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1271847	1276961	2687335	transposase	Heterosigma_akashiwo_virus(33.33%)	4	NA	NA
WP_013745971.1|1271847_1272528_-	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	34.7	8.1e-20
WP_013745972.1|1272530_1273502_-	signal peptidase I	NA	NA	NA	NA	NA
WP_013745973.1|1273511_1275308_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.9	4.2e-23
WP_013745974.1|1275527_1276961_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.4	1.7e-83
>prophage 84
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1287531	1288197	2687335		Planktothrix_phage(100.0%)	1	NA	NA
WP_013745987.1|1287531_1288197_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.7	4.2e-29
>prophage 85
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1291589	1295482	2687335		Escherichia_phage(100.0%)	3	NA	NA
WP_013745992.1|1291589_1292411_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	31.7	1.5e-15
WP_013745993.1|1292412_1293030_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.2	2.0e-73
WP_013745994.1|1293040_1295482_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	48.1	2.8e-219
>prophage 86
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1304461	1309326	2687335		Liberibacter_phage(50.0%)	3	NA	NA
WP_013746006.1|1304461_1306081_-	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	27.8	2.4e-33
WP_013746007.1|1306070_1308074_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_013746008.1|1308081_1309326_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	41.2	2.3e-12
>prophage 87
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1317353	1321374	2687335	tRNA	uncultured_Mediterranean_phage(66.67%)	6	NA	NA
WP_013746014.1|1317353_1317977_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.9	1.1e-34
WP_013746015.1|1317982_1318723_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.8	3.4e-64
WP_013746016.1|1318764_1319250_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_013746017.1|1319246_1319942_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013746018.1|1319956_1320235_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_013746019.1|1320417_1321374_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	26.2	9.4e-06
>prophage 88
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1326045	1333678	2687335	tRNA	Caulobacter_phage(33.33%)	5	NA	NA
WP_013746024.1|1326045_1326576_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	28.4	2.4e-19
WP_013746025.1|1326902_1328294_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_013746026.1|1328290_1330129_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.4	5.8e-20
WP_013746027.1|1330225_1331482_+	TolC family protein	NA	NA	NA	NA	NA
WP_013746028.1|1331497_1333678_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	3.2e-25
>prophage 89
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1337484	1338000	2687335		Synechococcus_phage(100.0%)	1	NA	NA
WP_013746032.1|1337484_1338000_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.7	1.2e-15
>prophage 90
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1359938	1360466	2687335		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_013746053.1|1359938_1360466_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	65.1	3.4e-58
>prophage 91
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1369581	1380679	2687335	transposase	Escherichia_phage(20.0%)	9	NA	NA
WP_013746063.1|1369581_1372671_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	22.9	1.6e-06
WP_043885339.1|1372981_1374004_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_043885268.1|1374839_1375256_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	1.1e-48
WP_013746067.1|1375301_1376438_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.8	1.4e-125
WP_013746068.1|1376953_1377187_+	heme iron utilization protein	NA	NA	NA	NA	NA
WP_013746069.1|1377229_1377922_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_013746070.1|1377928_1379191_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.1	2.1e-90
WP_013746071.1|1379388_1379649_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_013746072.1|1380040_1380679_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.4e-42
>prophage 92
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1386815	1388183	2687335		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_013746077.1|1386815_1388183_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.4e-108
>prophage 93
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1394412	1395714	2687335		Streptococcus_phage(100.0%)	1	NA	NA
WP_013746086.1|1394412_1395714_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.5	1.9e-134
>prophage 94
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1399365	1403045	2687335		Ugandan_cassava_brown_streak_virus(50.0%)	4	NA	NA
WP_013746089.1|1399365_1399962_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.9	1.2e-11
WP_043885269.1|1399958_1401098_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_013746091.1|1401114_1401774_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_013746092.1|1401806_1403045_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	5.1e-105
>prophage 95
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1409159	1416009	2687335	transposase	uncultured_virus(50.0%)	5	NA	NA
WP_148234046.1|1409159_1410493_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.7	2.5e-65
WP_013746103.1|1410546_1410711_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_013746104.1|1411208_1412642_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.2	5.8e-84
WP_043885342.1|1412787_1414863_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.8	1.1e-88
WP_013746106.1|1415253_1416009_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	48.9	7.4e-38
>prophage 96
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1419479	1423857	2687335		Erysipelothrix_phage(100.0%)	2	NA	NA
WP_013746109.1|1419479_1421237_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	44.2	3.8e-130
WP_013746110.1|1421247_1423857_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	36.1	3.3e-138
>prophage 97
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1428801	1429986	2687335		Tupanvirus(100.0%)	1	NA	NA
WP_013746114.1|1428801_1429986_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.0	8.3e-12
>prophage 98
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1433304	1437220	2687335		Escherichia_phage(33.33%)	5	NA	NA
WP_013746119.1|1433304_1434072_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.4	3.3e-25
WP_013746120.1|1434084_1434945_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_013746121.1|1434960_1435200_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	1.5e-08
WP_013746122.1|1435275_1436598_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_013746123.1|1436608_1437220_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.8	7.8e-22
>prophage 99
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1441168	1447275	2687335	tRNA	Megavirus(50.0%)	4	NA	NA
WP_013746128.1|1441168_1443988_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	27.0	1.3e-84
WP_013746129.1|1444129_1444630_+	signal peptidase II	NA	NA	NA	NA	NA
WP_013746130.1|1444626_1445571_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_013746131.1|1445796_1447275_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	40.3	1.0e-06
>prophage 100
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1451125	1454853	2687335	transposase	Streptococcus_phage(50.0%)	3	NA	NA
WP_013746135.1|1451125_1452433_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	28.1	5.4e-36
WP_039092769.1|1452436_1453159_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_043885271.1|1453716_1454853_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	8.6e-123
>prophage 101
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1463100	1464285	2687335		Stx2-converting_phage(100.0%)	1	NA	NA
WP_013746144.1|1463100_1464285_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	46.2	2.0e-90
>prophage 102
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1469048	1470248	2687335		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_013746150.1|1469048_1470248_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	28.0	7.8e-34
>prophage 103
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1474899	1477263	2687335		Streptococcus_phage(100.0%)	2	NA	NA
WP_013746155.1|1474899_1476159_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	4.2e-94
WP_013746156.1|1476168_1477263_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.0	3.5e-65
>prophage 104
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1483791	1492129	2687335		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_013746166.1|1483791_1487829_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.7	6.1e-22
WP_013746167.1|1487902_1492129_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.6	1.5e-66
>prophage 105
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1500485	1542915	2687335	transposase	Bacillus_phage(15.38%)	37	NA	NA
WP_148234028.1|1500485_1500908_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	39.1	1.4e-09
WP_043885273.1|1500828_1501641_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.5	1.6e-46
WP_013746173.1|1501763_1502375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013746174.1|1502903_1504541_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	1.4e-158
WP_013746175.1|1504679_1505453_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_013746176.1|1505462_1506077_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	36.2	1.4e-10
WP_013746177.1|1506118_1506433_+	DUF2322 family protein	NA	NA	NA	NA	NA
WP_013746178.1|1506433_1507366_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	35.8	6.5e-28
WP_013746179.1|1507549_1508935_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_043885345.1|1509288_1510962_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_013746181.1|1510951_1512229_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_013746182.1|1512225_1513488_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_013746183.1|1513538_1514741_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_013746184.1|1514733_1515372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746185.1|1515373_1516516_-	MFS transporter	NA	NA	NA	NA	NA
WP_013746186.1|1516512_1517667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746187.1|1517706_1518261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746188.1|1518500_1519652_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_013746189.1|1519661_1520141_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	44.9	1.2e-33
WP_013746190.1|1520213_1520594_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	43.4	5.7e-15
WP_013746191.1|1520595_1521417_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013746192.1|1521793_1523449_+	acetolactate synthase 2 catalytic subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.4	3.6e-69
WP_013746193.1|1523450_1523687_+	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_013746194.1|1523705_1525541_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_031205022.1|1525558_1527103_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_013746196.1|1527198_1529814_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_013746197.1|1530062_1530419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746198.1|1530490_1530889_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_013746199.1|1530909_1531443_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_013746200.1|1531426_1531990_+	Sua5/YciO/YrdC/YwlC family protein	NA	A0A291ATS8	Pandoravirus	28.3	1.8e-09
WP_013746201.1|1531992_1532820_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_043885274.1|1533345_1534482_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.8	1.1e-122
WP_013745596.1|1535575_1536082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746205.1|1535976_1541175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080558801.1|1541496_1541730_-|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	34.3	4.1e-16
WP_193359435.1|1541775_1542561_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	56.2	2.0e-78
WP_013746208.1|1542591_1542915_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	61.0	2.6e-32
>prophage 106
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1554304	1556107	2687335		Streptococcus_phage(50.0%)	2	NA	NA
WP_013746219.1|1554304_1555120_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.8	7.2e-23
WP_013746220.1|1555198_1556107_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	48.0	1.1e-69
>prophage 107
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1559507	1561295	2687335		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_043885276.1|1559507_1561295_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	6.0e-54
>prophage 108
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1568024	1581442	2687335	tRNA,transposase	Streptomyces_phage(16.67%)	15	NA	NA
WP_043885349.1|1568024_1571498_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8J9	Streptomyces_phage	36.0	5.3e-192
WP_013746230.1|1571577_1571832_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013746231.1|1571841_1572183_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_013746232.1|1572208_1572853_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_013746233.1|1572875_1573385_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_013746234.1|1573401_1574187_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_013746235.1|1574183_1574978_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.2	4.1e-23
WP_039083706.1|1575115_1575670_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_013746237.1|1575650_1576169_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_013746238.1|1576178_1576904_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.6e-24
WP_013746239.1|1576918_1577434_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_013746240.1|1577466_1578336_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	25.0	1.9e-05
WP_043885277.1|1578460_1578946_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	39.8	1.4e-05
WP_013746242.1|1579054_1579882_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_148234047.1|1580010_1581442_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.2	2.6e-84
>prophage 109
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1589600	1591385	2687335		Bacillus_virus(100.0%)	1	NA	NA
WP_013746249.1|1589600_1591385_+	ABC transporter ATP-binding protein/permease	NA	G3M9Y6	Bacillus_virus	31.6	1.4e-10
>prophage 110
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1599580	1601523	2687335		Staphylococcus_phage(66.67%)	3	NA	NA
WP_013746258.1|1599580_1600567_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	42.5	1.0e-63
WP_013746259.1|1600674_1601001_+	thioredoxin TrxA	NA	A0A1X9I9P5	Staphylococcus_phage	45.0	5.8e-16
WP_013746260.1|1601043_1601523_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.4	8.8e-29
>prophage 111
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1608704	1611287	2687335	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_013746268.1|1608704_1611287_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	4.1e-189
>prophage 112
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1616922	1620840	2687335		Vibrio_phage(50.0%)	4	NA	NA
WP_043885278.1|1616922_1617822_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.2	2.8e-60
WP_013746276.1|1617825_1618917_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_013746277.1|1618950_1619478_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_013746278.1|1619697_1620840_-	type IV pilus secretin PilQ	NA	D0U174	Enterobacteria_phage	25.6	9.2e-16
>prophage 113
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1632355	1632826	2687335		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_013746291.1|1632355_1632826_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	5.8e-25
>prophage 114
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1641539	1642238	2687335		Vibrio_phage(100.0%)	1	NA	NA
WP_013746300.1|1641539_1642238_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	61.0	6.3e-60
>prophage 115
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1647866	1649354	2687335		Tupanvirus(100.0%)	1	NA	NA
WP_013746308.1|1647866_1649354_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	24.6	6.8e-19
>prophage 116
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1656961	1658803	2687335		Catovirus(100.0%)	1	NA	NA
WP_013746316.1|1656961_1658803_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	2.6e-84
>prophage 117
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1674153	1674816	2687335		Synechococcus_phage(100.0%)	1	NA	NA
WP_013746336.1|1674153_1674816_+	fructose-6-phosphate aldolase	NA	R9TM64	Synechococcus_phage	30.7	5.7e-26
>prophage 118
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1681546	1685827	2687335		Indivirus(100.0%)	1	NA	NA
WP_013746346.1|1681546_1685827_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1V0SEE0	Indivirus	24.3	4.1e-16
>prophage 119
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1689997	1690615	2687335		Haemophilus_virus(50.0%)	2	NA	NA
WP_013746351.1|1689997_1690405_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	69.6	5.2e-46
WP_039133250.1|1690432_1690615_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	73.7	1.3e-17
>prophage 120
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1705847	1814487	2687335	tRNA,integrase,head,tail,terminase,transposase,plate	Haemophilus_phage(11.76%)	107	1767498:1767513	1794654:1794669
WP_013746355.1|1705847_1708472_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	2.7e-79
WP_013746356.1|1708576_1708765_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	49.1	2.3e-09
WP_013746357.1|1708793_1710158_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.2	6.4e-32
WP_013746358.1|1710250_1711138_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.3	1.7e-57
WP_013746359.1|1711497_1712955_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_013746360.1|1713145_1714240_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_013746361.1|1714413_1714743_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013746362.1|1714824_1715121_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_013746363.1|1715149_1716124_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_013746365.1|1716450_1719489_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.5	3.8e-141
WP_013746366.1|1719701_1720421_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_013746367.1|1720420_1721404_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_013746368.1|1721413_1722406_+	DUF2891 domain-containing protein	NA	NA	NA	NA	NA
WP_039096894.1|1722816_1723533_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_026211038.1|1723535_1724279_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.4e-35
WP_013746371.1|1724826_1725072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746372.1|1725167_1725470_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013746373.1|1725462_1725846_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013746374.1|1726045_1726324_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.7	6.9e-18
WP_013746375.1|1726334_1726631_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	45.0	2.0e-07
WP_013746378.1|1727217_1727409_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_013746380.1|1728090_1729470_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.3	1.8e-50
WP_013746381.1|1729609_1730122_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_193359437.1|1730226_1741020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746383.1|1741261_1741741_-	Mu DNA-binding domain-containing protein	NA	A0A0C4UQZ2	Shigella_phage	61.0	8.0e-14
WP_013746384.1|1741953_1742181_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPY8	Mannheimia_phage	73.2	3.2e-21
WP_013746385.1|1742192_1744154_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	C9DGL1	Escherichia_phage	47.7	3.2e-170
WP_013746386.1|1744190_1744496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746387.1|1744820_1745741_+	AAA family ATPase	NA	M4M9P4	Vibrio_phage	42.0	7.5e-61
WP_013746388.1|1745737_1745974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746389.1|1745976_1746486_+	host-nuclease inhibitor Gam family protein	NA	F6MIJ0	Haemophilus_phage	57.0	1.7e-46
WP_013746390.1|1746488_1746644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746391.1|1746722_1746917_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013746392.1|1746913_1747090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746393.1|1747157_1747625_+	regulatory protein GemA	NA	F8TVB3	EBPR_siphovirus	29.1	3.8e-08
WP_013746394.1|1747624_1748191_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	40.7	2.6e-32
WP_013746395.1|1748171_1748537_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	43.0	1.6e-22
WP_013746396.1|1748621_1749167_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.3	3.2e-75
WP_013746397.1|1749176_1749326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746399.1|1749444_1749669_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	80.0	1.5e-23
WP_013746400.1|1749665_1749932_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_013746401.1|1750045_1750375_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_013746402.1|1750367_1750664_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	57.6	4.5e-23
WP_013746403.1|1750673_1751246_+	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	44.2	9.8e-35
WP_013746404.1|1751229_1752540_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	65.2	2.5e-150
WP_013746405.1|1752541_1753969_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	47.5	3.7e-115
WP_013746406.1|1753965_1755273_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	43.9	5.2e-47
WP_013746407.1|1755530_1755752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746408.1|1755823_1756282_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_013746409.1|1756546_1757620_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	46.0	2.3e-77
WP_013746410.1|1757641_1758571_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	51.3	1.1e-80
WP_013746411.1|1758582_1758888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746412.1|1758887_1759325_+	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	33.1	2.7e-08
WP_013746413.1|1759324_1759831_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_013746414.1|1759830_1761231_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	44.1	5.1e-101
WP_013746415.1|1761230_1761746_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	25.3	1.3e-06
WP_013746416.1|1761835_1762099_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080558803.1|1762095_1762239_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_013746417.1|1762231_1762429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746418.1|1762468_1765069_+|tail	phage tail tape measure protein	tail	A7YGZ1	Campylobacter_phage	36.3	6.8e-75
WP_013746419.1|1765068_1766001_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	33.2	3.5e-21
WP_013746420.1|1765993_1766218_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	41.8	1.1e-10
WP_013746421.1|1766214_1767276_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.0	1.1e-63
WP_013746422.1|1767253_1767769_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
1767498:1767513	attL	TTTACAATAATCAAGA	NA	NA	NA	NA
WP_013746423.1|1767824_1768190_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	40.3	8.8e-05
WP_013746424.1|1768182_1769298_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	38.9	5.5e-58
WP_013746425.1|1769290_1769860_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	42.2	8.8e-36
WP_013746426.1|1769874_1771026_+|tail	tail fiber protein	tail	A0A1Y0SVH2	Sinorhizobium_phage	60.0	8.7e-06
WP_013746429.1|1772113_1773133_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BVE3	unidentified_phage	32.1	1.4e-47
WP_013746430.1|1773222_1773879_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	48.7	1.1e-34
WP_013746431.1|1773875_1774370_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	54.4	2.6e-44
WP_043885280.1|1774380_1775247_+	DNA adenine methylase	NA	F6MIM2	Haemophilus_phage	66.3	6.3e-110
WP_013746433.1|1775266_1775512_-	hypothetical protein	NA	F6MIM3	Haemophilus_phage	46.9	1.4e-09
WP_013746434.1|1775696_1778264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746435.1|1778646_1780101_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.6	7.3e-42
WP_013746436.1|1780157_1780469_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013746437.1|1780461_1780890_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_013746438.1|1780897_1781617_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_013746439.1|1781619_1783119_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.1	1.4e-88
WP_013746440.1|1783243_1784047_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_013746441.1|1784057_1784600_-	ADP compounds hydrolase NudE	NA	A0A2K9VDH1	Lactobacillus_phage	27.7	4.4e-08
WP_013746442.1|1784727_1785135_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_013746443.1|1785138_1785624_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_158305796.1|1785754_1785943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013746444.1|1785902_1787390_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013746445.1|1787467_1787902_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_013746446.1|1787898_1788852_-	MucB/RseB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013746447.1|1788947_1789511_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_013746448.1|1789532_1790108_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	30.1	5.7e-06
WP_013746449.1|1790248_1790500_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_013746450.1|1790720_1791980_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_013746451.1|1792044_1794288_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_013746452.1|1794532_1795648_-	ABC transporter permease	NA	NA	NA	NA	NA
1794654:1794669	attR	TTTACAATAATCAAGA	NA	NA	NA	NA
WP_013746453.1|1795644_1796751_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013746454.1|1796747_1798469_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	2.4e-20
WP_013746455.1|1798468_1799305_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_193359452.1|1799481_1800213_-	methyltransferase	NA	NA	NA	NA	NA
WP_013746457.1|1800304_1801648_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.0	1.1e-47
WP_013746458.1|1801657_1803043_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	33.3	1.9e-31
WP_013746459.1|1803252_1804395_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_013746461.1|1806111_1808163_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_013746462.1|1808422_1809097_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013746463.1|1809109_1809772_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_013746464.1|1809787_1810786_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013746465.1|1810831_1811725_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.3	1.0e-33
WP_013746466.1|1811916_1813242_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_013746467.1|1813497_1814487_+	amidohydrolase family protein	NA	A0A076FFX9	Aureococcus_anophage	28.1	3.0e-31
>prophage 121
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1835416	1837742	2687335		Bacillus_phage(50.0%)	2	NA	NA
WP_013746483.1|1835416_1836826_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.2	3.1e-21
WP_013746484.1|1837022_1837742_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	34.4	1.7e-07
>prophage 122
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1849112	1850480	2687335		Indivirus(100.0%)	1	NA	NA
WP_148234049.1|1849112_1850480_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.0	3.9e-37
>prophage 123
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1855744	1860099	2687335	tRNA	Mycoplasma_phage(50.0%)	4	NA	NA
WP_013746504.1|1855744_1857046_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	30.0	9.4e-33
WP_013746505.1|1857212_1857683_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_013746506.1|1857692_1858271_-	VOC family protein	NA	NA	NA	NA	NA
WP_013746507.1|1858371_1860099_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.8	2.9e-90
>prophage 124
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1871995	1872847	2687335		Vibrio_phage(100.0%)	1	NA	NA
WP_013746521.1|1871995_1872847_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	75.6	4.6e-129
>prophage 125
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1884915	1886850	2687335		Cellulophaga_phage(50.0%)	2	NA	NA
WP_013746535.1|1884915_1885815_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	68.4	5.7e-05
WP_013746536.1|1886094_1886850_-	class I SAM-dependent methyltransferase	NA	M1HRH9	Acanthocystis_turfacea_Chlorella_virus	33.0	7.9e-08
>prophage 126
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1905597	1906353	2687335		Escherichia_phage(100.0%)	1	NA	NA
WP_013746556.1|1905597_1906353_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.4	1.1e-28
>prophage 127
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1927627	1930809	2687335		uncultured_virus(33.33%)	4	NA	NA
WP_013746572.1|1927627_1928011_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	7.0e-53
WP_013746573.1|1928061_1928385_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.7e-26
WP_013746574.1|1928418_1928937_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_013746575.1|1928955_1930809_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.6	1.3e-104
>prophage 128
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1937280	1939134	2687335		Streptococcus_phage(100.0%)	1	NA	NA
WP_013746583.1|1937280_1939134_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	42.9	1.6e-22
>prophage 129
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1944096	1945110	2687335		Salmonella_phage(100.0%)	1	NA	NA
WP_013746588.1|1944096_1945110_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	40.4	7.8e-27
>prophage 130
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1952592	1953321	2687335		Bacillus_virus(100.0%)	1	NA	NA
WP_013746599.1|1952592_1953321_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	1.8e-25
>prophage 131
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1958798	1959353	2687335		Rhizobium_phage(100.0%)	1	NA	NA
WP_013746604.1|1958798_1959353_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A076YN96	Rhizobium_phage	29.0	2.8e-10
>prophage 132
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1963474	1964611	2687335	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_043885282.1|1963474_1964611_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.3	1.5e-122
>prophage 133
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	1995463	2001630	2687335		Virus_Rctr41k(25.0%)	6	NA	NA
WP_013746631.1|1995463_1996354_-	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	32.1	1.2e-18
WP_013746632.1|1996369_1997062_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_013746633.1|1997071_1997896_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_013746634.1|1998045_1998624_+	thymidine kinase	NA	Q56BQ4	Escherichia_virus	53.7	1.1e-54
WP_013746635.1|1998644_1999595_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.4	1.3e-26
WP_013746636.1|1999653_2001630_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.1	9.6e-29
>prophage 134
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2008593	2011837	2687335	tRNA	Vibrio_phage(50.0%)	3	NA	NA
WP_193359457.1|2008593_2009760_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2I7SAR1	Vibrio_phage	36.4	4.9e-57
WP_013746644.1|2009771_2010377_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_013746645.1|2010577_2011837_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	35.0	1.2e-56
>prophage 135
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2020068	2020794	2687335		Flavobacterium_phage(100.0%)	1	NA	NA
WP_013746654.1|2020068_2020794_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	44.4	2.8e-26
>prophage 136
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2029835	2034777	2687335		Cafeteria_roenbergensis_virus(33.33%)	6	NA	NA
WP_013746663.1|2029835_2030429_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.7	2.1e-24
WP_013746664.1|2030432_2031116_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_013746665.1|2031185_2032916_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	4.4e-62
WP_013746666.1|2032919_2033588_+	thiol:disulfide interchange signal peptide protein	NA	NA	NA	NA	NA
WP_013746667.1|2033584_2034277_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_013746668.1|2034435_2034777_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	64.9	1.4e-20
>prophage 137
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2040565	2043032	2687335		Vibrio_phage(50.0%)	3	NA	NA
WP_013746673.1|2040565_2041342_+	DNA adenine methylase	NA	A0A2I7QVZ2	Vibrio_phage	52.8	2.4e-07
WP_013746674.1|2041338_2042028_+	type II restriction endonuclease NlaIII	NA	NA	NA	NA	NA
WP_013746675.1|2042036_2043032_+	DNA adenine methylase	NA	A0A2L0UZL7	Agrobacterium_phage	45.8	6.4e-74
>prophage 138
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2047605	2051389	2687335		Enterobacteria_phage(50.0%)	3	NA	NA
WP_013746680.1|2047605_2048610_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.3	1.2e-22
WP_013746681.1|2048816_2049809_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_013746682.1|2049868_2051389_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	7.7e-10
>prophage 139
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2056626	2057355	2687335		Planktothrix_phage(100.0%)	1	NA	NA
WP_013746691.1|2056626_2057355_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	45.2	3.5e-37
>prophage 140
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2060489	2062802	2687335		Tetraselmis_virus(100.0%)	1	NA	NA
WP_013746695.1|2060489_2062802_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-162
>prophage 141
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2066760	2067711	2687335		Cyanophage(100.0%)	1	NA	NA
WP_013746700.1|2066760_2067711_+	transaldolase	NA	A0A127KNC6	Cyanophage	26.9	7.4e-11
>prophage 142
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2073998	2082327	2687335		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_148234070.1|2073998_2080145_+	S8 family serine peptidase	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	29.5	1.1e-17
WP_013746708.1|2080215_2082327_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.6	1.9e-54
>prophage 143
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2089504	2090431	2687335		Synechococcus_phage(100.0%)	1	NA	NA
WP_013746712.1|2089504_2090431_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	37.6	1.0e-33
>prophage 144
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2096743	2097757	2687335		Vibrio_phage(100.0%)	1	NA	NA
WP_013746720.1|2096743_2097757_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	41.3	2.3e-66
>prophage 145
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2104620	2110068	2687335	transposase	Streptococcus_phage(33.33%)	5	NA	NA
WP_013746727.1|2104620_2105754_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.5	1.1e-50
WP_001339197.1|2106434_2107643_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_035689358.1|2107652_2108024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000428546.1|2108156_2108750_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_013746729.1|2108862_2110068_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
>prophage 146
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2113949	2115158	2687335	transposase	Bluetongue_virus(100.0%)	1	NA	NA
WP_001339197.1|2113949_2115158_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 147
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2118217	2121504	2687335		Wolbachia_phage(50.0%)	2	NA	NA
WP_013746733.1|2118217_2120083_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	28.5	1.1e-58
WP_013746734.1|2120085_2121504_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	25.9	2.5e-18
>prophage 148
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2139938	2150925	2687335	transposase	Salmonella_phage(16.67%)	10	NA	NA
WP_043885285.1|2139938_2141075_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	1.5e-122
WP_080558807.1|2141120_2141354_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.1	3.0e-14
WP_013746752.1|2141704_2142253_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	4.5e-29
WP_013746753.1|2142325_2143387_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_013746754.1|2143660_2143918_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_013746755.1|2143973_2145701_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.2	1.1e-17
WP_013746756.1|2145774_2146275_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_013746757.1|2146340_2148032_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_043885366.1|2148333_2150448_+	anaerobic ribonucleoside-triphosphate reductase	NA	Q76Z50	Aeromonas_virus	60.6	1.0e-254
WP_013746759.1|2150457_2150925_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	59.6	9.4e-52
>prophage 149
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2156970	2158137	2687335		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_193359458.1|2156970_2158137_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	23.9	3.9e-22
>prophage 150
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2161139	2161928	2687335		Mycobacterium_phage(100.0%)	1	NA	NA
WP_013746774.1|2161139_2161928_-	alpha/beta fold hydrolase	NA	A0A2D1GCA0	Mycobacterium_phage	33.3	5.9e-06
>prophage 151
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2167565	2174074	2687335		Pandoravirus(33.33%)	6	NA	NA
WP_013746778.1|2167565_2168654_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.1	8.0e-86
WP_013746779.1|2168643_2169489_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_013746780.1|2169503_2170268_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_013746781.1|2170273_2171224_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_013746782.1|2171332_2171878_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.4	9.4e-27
WP_013746783.1|2171899_2174074_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	6.6e-47
>prophage 152
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2177850	2180727	2687335	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_013746791.1|2177850_2180727_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	38.7	9.0e-153
>prophage 153
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2184719	2185694	2687335		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_013746794.1|2184719_2185694_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	2.1e-05
>prophage 154
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2190234	2194434	2687335		Bacillus_virus(100.0%)	2	NA	NA
WP_013746800.1|2190234_2192145_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.1	2.1e-89
WP_043885286.1|2192160_2194434_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.4	8.0e-88
>prophage 155
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2216657	2220015	2687335		Streptococcus_phage(50.0%)	5	NA	NA
WP_013746826.1|2216657_2217743_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.9	8.8e-85
WP_013746827.1|2217955_2218300_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_013746828.1|2218536_2218926_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_026211022.1|2218942_2219371_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_013746830.1|2219652_2220015_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	33.1	4.2e-07
>prophage 156
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2225801	2228619	2687335		Tupanvirus(33.33%)	4	NA	NA
WP_013746839.1|2225801_2226758_+	SPFH/Band 7/PHB domain protein	NA	A0A2K9KZA2	Tupanvirus	31.9	2.9e-23
WP_013746840.1|2226754_2227207_+	NfeD family protein	NA	NA	NA	NA	NA
WP_013746841.1|2227260_2227644_-	autonomous glycyl radical cofactor GrcA	NA	A0A2K9VG12	Escherichia_phage	71.0	6.8e-32
WP_013746842.1|2227950_2228619_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.9	1.3e-54
>prophage 157
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2233374	2234037	2687335		Alteromonas_phage(100.0%)	1	NA	NA
WP_013746848.1|2233374_2234037_-	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	28.2	8.5e-06
>prophage 158
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2239965	2246781	2687335		Ostreococcus_tauri_virus(33.33%)	8	NA	NA
WP_013746855.1|2239965_2241606_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A9YVW0	Ostreococcus_tauri_virus	29.1	2.0e-35
WP_013746856.1|2241676_2241913_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_013746857.1|2241915_2242476_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_013746858.1|2242503_2243259_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.1	2.2e-26
WP_013746859.1|2243381_2244395_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013746860.1|2244465_2245005_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_013746861.1|2245001_2245709_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_013746862.1|2245722_2246781_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	3.8e-32
>prophage 159
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2252765	2253440	2687335		Faecalibacterium_phage(100.0%)	1	NA	NA
WP_013746867.1|2252765_2253440_-	ribonuclease T	NA	A0A2K9V2V7	Faecalibacterium_phage	33.1	2.6e-10
>prophage 160
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2256982	2257612	2687335		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_013746872.1|2256982_2257612_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	56.0	2.6e-57
>prophage 161
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2264237	2266371	2687335		Staphylococcus_phage(50.0%)	2	NA	NA
WP_013746879.1|2264237_2265062_-	glycerophosphoryl diester phosphodiesterase	NA	A0A220BY94	Staphylococcus_phage	24.2	3.3e-07
WP_013746880.1|2265297_2266371_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.7e-27
>prophage 162
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2273041	2273704	2687335		Planktothrix_phage(100.0%)	1	NA	NA
WP_013746887.1|2273041_2273704_-	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	4.1e-24
>prophage 163
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2278409	2287433	2687335	tRNA,transposase	Catovirus(25.0%)	8	NA	NA
WP_043885288.1|2278409_2280455_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	25.2	4.9e-28
WP_013746894.1|2280652_2281771_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_013746895.1|2281910_2283344_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.7	3.8e-83
WP_039085718.1|2283579_2284689_+	Fic family protein	NA	NA	NA	NA	NA
WP_013746897.1|2284753_2285494_-	glycosyltransferase family 25 protein	NA	A0A1D8KNF8	Synechococcus_phage	30.1	1.9e-14
WP_013746898.1|2285494_2286724_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_013746899.1|2286790_2287009_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_013746900.1|2287133_2287433_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.3	2.0e-18
>prophage 164
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2292725	2293793	2687335		Catovirus(100.0%)	1	NA	NA
WP_080558808.1|2292725_2293793_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	41.6	4.9e-11
>prophage 165
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2298215	2311184	2687335	transposase	Streptococcus_phage(16.67%)	9	NA	NA
WP_013746911.1|2298215_2299319_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	66.5	1.8e-146
WP_013746912.1|2299328_2300756_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_013746913.1|2300855_2301884_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	22.9	4.5e-06
WP_013746914.1|2301951_2302986_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.7	6.4e-101
WP_013746917.1|2304166_2305483_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	25.7	1.5e-22
WP_043885289.1|2305728_2306865_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.8	1.3e-123
WP_013746920.1|2307098_2308562_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_013746921.1|2308728_2309205_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_013746922.1|2309486_2311184_+	long-chain-fatty-acid--CoA ligase FadD	NA	Q75ZG1	Hepacivirus	27.8	6.1e-40
>prophage 166
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2321796	2324352	2687335		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_013746932.1|2321796_2324352_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.7	4.4e-26
>prophage 167
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2330476	2334882	2687335		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_013746939.1|2330476_2330764_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	41.1	3.1e-13
WP_013744975.1|2331077_2331680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013746940.1|2332034_2332397_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_013746941.1|2332396_2332663_-	antitoxin MazE	NA	NA	NA	NA	NA
WP_013746942.1|2332866_2334882_-	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.5	1.2e-140
>prophage 168
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2339770	2341279	2687335		Mycoplasma_phage(100.0%)	1	NA	NA
WP_013746949.1|2339770_2341279_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.4	3.2e-48
>prophage 169
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2348858	2369708	2687335	tRNA,transposase	Moraxella_phage(20.0%)	15	NA	NA
WP_013746954.1|2348858_2350283_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.1e-42
WP_013746955.1|2350453_2352853_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	49.7	1.1e-199
WP_013746956.1|2352965_2354831_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_013746957.1|2354912_2356208_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.5e-17
WP_193359459.1|2356262_2360162_+	ATP-dependent RNA helicase HrpA	NA	M1PGM1	Moumouvirus	36.3	1.1e-49
WP_013746959.1|2360272_2360725_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_013746960.1|2360724_2361843_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.1	7.5e-47
WP_013746961.1|2361868_2362315_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_013746962.1|2362286_2362721_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_013746963.1|2362904_2363561_+	GTP cyclohydrolase I FolE	NA	I6XC45	Vibriophage	52.2	1.6e-52
WP_013746964.1|2363757_2365689_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.0e-128
WP_013746965.1|2365818_2367249_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	42.4	2.6e-84
WP_013746966.1|2367424_2367799_-	SufE family protein	NA	NA	NA	NA	NA
WP_013746967.1|2367798_2369022_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	33.2	1.5e-56
WP_013746968.1|2369012_2369708_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	40.4	1.3e-36
>prophage 170
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2389303	2403552	2687335	tRNA	Pseudomonas_phage(12.5%)	15	NA	NA
WP_013746987.1|2389303_2390386_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.0	1.9e-07
WP_043885367.1|2390393_2391260_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013746989.1|2391261_2392104_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013746990.1|2392120_2392975_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.7	5.8e-47
WP_013746991.1|2393063_2394005_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	28.5	4.7e-26
WP_013746992.1|2394112_2395297_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013746993.1|2395289_2396009_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.9	9.5e-35
WP_013746994.1|2396008_2397259_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_193359460.1|2397357_2398425_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.9	3.4e-81
WP_013746996.1|2398479_2399193_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_013746997.1|2399189_2401124_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	2.2e-94
WP_013746998.1|2401259_2402087_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_013746999.1|2402143_2402464_-	YciU family protein	NA	NA	NA	NA	NA
WP_013747000.1|2402487_2402988_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	33.3	2.1e-12
WP_013747001.1|2403003_2403552_-	PadR family transcriptional regulator	NA	A0A2I7RSZ7	Vibrio_phage	31.8	4.1e-06
>prophage 171
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2425507	2428120	2687335		Acinetobacter_phage(100.0%)	1	NA	NA
WP_013747018.1|2425507_2428120_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.0	2.3e-22
>prophage 172
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2435650	2436517	2687335		Tetraselmis_virus(100.0%)	1	NA	NA
WP_013747028.1|2435650_2436517_+	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	2.0e-07
>prophage 173
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2446633	2460828	2687335	tRNA	Bacillus_phage(14.29%)	14	NA	NA
WP_013747035.1|2446633_2447632_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	1.9e-09
WP_013747036.1|2447653_2448262_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013747037.1|2448481_2449369_+	DMT family transporter	NA	NA	NA	NA	NA
WP_013747038.1|2449426_2449969_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.0	1.4e-30
WP_013747039.1|2449979_2450822_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_013747040.1|2450928_2452278_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_013747041.1|2452344_2453349_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.2	8.2e-77
WP_148234071.1|2453482_2454361_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_039087862.1|2454624_2455299_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
WP_013747044.1|2455533_2456517_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.3	2.9e-34
WP_013747045.1|2456540_2458928_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_013747046.1|2458931_2459228_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.3e-11
WP_013747047.1|2459296_2459791_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	42.1	1.3e-14
WP_013747048.1|2459877_2460828_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.8	1.8e-41
>prophage 174
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2467180	2675588	2687335	portal,integrase,tRNA,protease,holin,head,tail,terminase,transposase,plate,capsid	Mannheimia_phage(18.39%)	202	2546408:2546467	2597385:2597478
WP_043885292.1|2467180_2467396_-|transposase	transposase	transposase	Q716C2	Shigella_phage	62.9	1.5e-15
WP_052297110.1|2467367_2467904_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_148234057.1|2468048_2468339_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	46.8	3.8e-11
WP_013747057.1|2468403_2469732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747058.1|2469731_2470646_+	CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6	NA	NA	NA	NA	NA
WP_013747059.1|2470721_2471012_+	CRISPR-associated protein Csx16	NA	NA	NA	NA	NA
WP_013747060.1|2471031_2472186_+	DUF1887 family protein	NA	NA	NA	NA	NA
WP_013747061.1|2472187_2473342_+	TIGR02584 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_013747062.1|2473528_2473807_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_013747063.1|2473816_2474827_+	CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_013747064.1|2474829_2475114_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_013747065.1|2477593_2477746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747066.1|2477754_2478009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747067.1|2478064_2478655_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_013747068.1|2478835_2479756_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_013747069.1|2479826_2481503_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_013747070.1|2481873_2483544_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.9	5.1e-39
WP_013747071.1|2483815_2484994_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_013747072.1|2485011_2485764_+	esterase family protein	NA	NA	NA	NA	NA
WP_013747074.1|2486071_2488087_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_013747075.1|2488162_2488612_+	TonB-system energizer ExbB	NA	NA	NA	NA	NA
WP_013747076.1|2488621_2489011_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_013747077.1|2489011_2489743_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_013747078.1|2489743_2490352_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_013747079.1|2490444_2490804_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_013747080.1|2490828_2491260_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013747081.1|2491265_2492735_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_013747082.1|2492821_2493991_-	MFS transporter	NA	NA	NA	NA	NA
WP_013747083.1|2494086_2495133_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013747087.1|2495986_2497042_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_013747088.1|2497041_2498451_-	YcjX family protein	NA	NA	NA	NA	NA
WP_043885294.1|2499920_2500337_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	1.8e-49
WP_013747090.1|2500483_2501086_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_013747091.1|2501498_2503193_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013747092.1|2503189_2504149_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013747093.1|2504141_2505029_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013747094.1|2505042_2506098_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.3	5.2e-05
WP_013747095.1|2506102_2506864_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013747096.1|2506906_2507833_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_013747097.1|2508033_2508579_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_193359438.1|2508716_2510522_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_013747099.1|2510691_2511540_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_013747100.1|2511575_2512538_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.5	4.3e-59
WP_013747101.1|2512599_2514354_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.9	4.2e-12
WP_013747102.1|2514364_2516107_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.4e-20
WP_013747103.1|2516159_2519195_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.1	6.1e-67
WP_013747104.1|2519891_2520461_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_013747105.1|2520466_2521468_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	39.5	1.6e-48
WP_013747106.1|2521464_2522472_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_013747107.1|2522480_2523785_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_013747108.1|2524138_2525431_-	ammonium transporter	NA	NA	NA	NA	NA
WP_013747109.1|2525475_2525814_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_013747110.1|2526125_2526929_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013747111.1|2527002_2528193_+	MFS transporter	NA	NA	NA	NA	NA
WP_013747113.1|2528671_2528893_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_043885295.1|2529469_2530282_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.9	3.2e-47
WP_013747115.1|2530336_2530579_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	46.8	3.2e-11
WP_013747116.1|2530929_2531127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747117.1|2531113_2531344_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	47.2	4.1e-08
WP_013747118.1|2531772_2531988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013747119.1|2532002_2532173_+	YegP family protein	NA	NA	NA	NA	NA
WP_052297111.1|2533939_2534701_+	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_013747123.1|2534645_2535752_-	beta family protein	NA	NA	NA	NA	NA
WP_013747124.1|2535954_2536575_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.6	3.5e-38
WP_013747125.1|2536826_2537018_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_013747126.1|2537038_2537302_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	41.5	3.7e-05
WP_013747127.1|2537382_2537703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013747128.1|2537864_2538557_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	54.9	2.0e-53
WP_013747129.1|2538553_2539351_+	hypothetical protein	NA	A0A1J0MF60	Staphylococcus_phage	50.0	2.1e-27
WP_013747130.1|2539350_2540022_+	Replication protein P	NA	D0UIL4	Aggregatibacter_phage	43.3	3.7e-41
WP_013747131.1|2540030_2540585_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	54.1	9.8e-48
WP_013747132.1|2540574_2541000_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	65.7	3.7e-47
WP_013747133.1|2541030_2541711_-	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	39.0	1.3e-33
WP_021460868.1|2541986_2542151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747134.1|2542116_2542578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013747135.1|2542649_2542970_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	57.1	2.7e-26
WP_043885296.1|2542979_2543285_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	51.0	1.4e-19
WP_013747137.1|2543367_2543598_+	recombination protein NinG	NA	NA	NA	NA	NA
WP_013745252.1|2543648_2543891_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	46.8	2.4e-11
WP_043885297.1|2543945_2544758_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.9	5.5e-47
WP_013747139.1|2545150_2545555_+	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	37.7	8.8e-06
WP_013747140.1|2545603_2545879_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	75.8	6.6e-37
WP_013747141.1|2545890_2546175_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	79.1	2.6e-36
2546408:2546467	attL	TTGATCTGACCCCGAAAAGTTAGACTGTTATTTTAAGGACTGAATTCTGTATTGAACAGG	NA	NA	NA	NA
WP_148234060.1|2546711_2547506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080558819.1|2548931_2549183_+|holin	phage holin, lambda family	holin	A0A2D1GNJ3	Pseudomonas_phage	47.0	1.5e-08
WP_013747147.1|2549169_2549577_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	49.3	3.0e-30
WP_013747148.1|2549580_2549907_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_080558820.1|2549881_2550094_+	lytic protein Rz1	NA	NA	NA	NA	NA
WP_013747149.1|2550254_2550725_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	56.1	7.5e-41
WP_013747150.1|2550724_2552845_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.4	1.7e-273
WP_013747152.1|2553065_2553446_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_013747153.1|2553531_2553756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747155.1|2554009_2555512_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	57.4	3.4e-159
WP_013747156.1|2555536_2556748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747158.1|2557119_2559084_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A291AWT6	Escherichia_phage	55.2	1.5e-199
WP_013747160.1|2559353_2559677_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	39.4	1.2e-10
WP_013747161.1|2559669_2559975_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013747162.1|2559978_2560506_+|tail	phage tail protein	tail	E4WL28	Enterobacteria_phage	34.6	2.2e-12
WP_013747163.1|2560515_2560926_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_013747164.1|2560925_2561579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885299.1|2561676_2562057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747166.1|2562101_2562338_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_013747168.1|2562916_2563129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013747170.1|2564441_2564795_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_013747171.1|2564845_2565100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747172.1|2565141_2565390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052297113.1|2565445_2566744_+	tape measure domain-containing protein	NA	B7SE05	Pseudomonas_virus	43.0	2.2e-42
WP_080558821.1|2567746_2568859_+|tail	phage tail tape measure protein	tail	A0A1U9WR13	Escherichia_phage	33.9	5.6e-26
WP_013747173.1|2568858_2569185_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	42.1	2.3e-20
WP_013747174.1|2569184_2569901_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.0	7.3e-88
WP_013747175.1|2569897_2570197_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	45.1	2.7e-12
WP_013747176.1|2570207_2570486_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	50.0	1.6e-22
WP_013747177.1|2570547_2571282_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	63.3	9.2e-94
WP_043885300.1|2571224_2571875_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	58.3	3.3e-55
WP_013747179.1|2571880_2578255_+	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	46.6	0.0e+00
WP_013747180.1|2578336_2578630_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	64.6	3.7e-30
WP_013747181.1|2578720_2580280_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_013747182.1|2580304_2580976_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_031204912.1|2581136_2582606_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	1.6e-97
WP_013747184.1|2582806_2583700_+	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	36.9	1.6e-31
WP_148234062.1|2584348_2584585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885301.1|2584677_2585814_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	3.3e-122
WP_013747187.1|2585952_2586462_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	34.3	1.1e-08
WP_013747188.1|2586593_2586878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747190.1|2587212_2587485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747191.1|2587706_2588258_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_013747192.1|2588260_2588677_-	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_013747193.1|2588679_2589465_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_013747194.1|2589473_2590259_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	9.7e-17
WP_013747195.1|2590454_2591915_+	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	50.0	7.9e-20
WP_013747196.1|2591945_2594330_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_013747197.1|2594376_2596035_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.8	7.3e-38
WP_013747198.1|2596451_2597366_+	YadA-like family protein	NA	B0FIT1	Escherichia_phage	41.3	1.6e-07
WP_013747201.1|2598827_2599721_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
2597385:2597478	attR	TTGATCTGACCCCGAAAAGTTAGACTGTTATTTTAAGGACTGAATTCTGTATTGAACAGGGCTCAGTCCATTTAATTTTAATTGTATTCTTTCC	NA	NA	NA	NA
WP_013747202.1|2599927_2600725_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_013747203.1|2600895_2601180_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_013747204.1|2601478_2602084_+	DedA family protein	NA	NA	NA	NA	NA
WP_080558812.1|2602261_2602393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747206.1|2611218_2612481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158305802.1|2614553_2614832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747209.1|2615888_2616476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747210.1|2616550_2616796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747212.1|2617091_2617418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747213.1|2617697_2618843_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	62.4	6.4e-142
WP_013747214.1|2619010_2621644_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.5e-109
WP_013747215.1|2621731_2623189_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	6.2e-09
WP_013747216.1|2623342_2623795_+	DNA polymerase V subunit UmuD	NA	NA	NA	NA	NA
WP_013747217.1|2623989_2624910_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	85.5	1.5e-125
WP_013747218.1|2625292_2626042_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013747219.1|2626189_2627530_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_013747220.1|2627551_2628271_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_013747221.1|2628270_2632737_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_013747222.1|2632815_2633262_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A2I7RG30	Vibrio_phage	52.7	5.1e-31
WP_013747223.1|2633420_2633624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747224.1|2633735_2634677_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_013747225.1|2634755_2635526_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_013747226.1|2635666_2635810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747227.1|2635867_2636362_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_013747228.1|2636377_2636863_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_013747229.1|2637016_2637739_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_013747230.1|2638000_2640607_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	35.2	5.1e-86
WP_013747231.1|2640787_2641804_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_013747232.1|2641826_2642309_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013747233.1|2642305_2642551_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_013747234.1|2642552_2643008_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_013747235.1|2643032_2643476_-	DUF412 family protein	NA	NA	NA	NA	NA
WP_013747236.1|2643666_2644872_+	acetate kinase	NA	NA	NA	NA	NA
WP_013747237.1|2644938_2647077_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_013747238.1|2647235_2648366_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.1	7.9e-169
WP_013747239.1|2648430_2650701_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	66.4	9.5e-299
WP_013747240.1|2651275_2651539_-	ogr/Delta-like zinc finger family protein	NA	Q1I103	Pasteurella_virus	48.3	9.1e-20
WP_013747241.1|2651635_2651857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013747242.1|2652172_2653192_-|portal	phage portal protein	portal	Q94MZ7	Haemophilus_virus	65.7	1.4e-116
WP_013747243.1|2653208_2655002_-|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	66.0	1.4e-236
WP_013747245.1|2655179_2656031_+|capsid	GPO family capsid scaffolding protein	capsid	Q1I100	Pasteurella_virus	59.2	5.7e-39
WP_013747246.1|2656061_2657075_+|capsid	phage major capsid protein, P2 family	capsid	Q94MZ4	Haemophilus_virus	60.4	1.7e-114
WP_013747247.1|2657091_2657895_+|terminase	terminase	terminase	Q94MZ3	Haemophilus_virus	49.1	2.3e-66
WP_013747248.1|2657888_2658341_+|head	head completion/stabilization protein	head	Q94MZ2	Haemophilus_virus	52.0	3.0e-39
WP_013747249.1|2658328_2658796_+|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	46.6	4.0e-34
WP_013747250.1|2658788_2659442_+	phage virion morphogenesis family	NA	NA	NA	NA	NA
WP_013747251.1|2659463_2660594_+	DUF2586 domain-containing protein	NA	Q94MY9	Haemophilus_virus	71.7	1.3e-155
WP_013747252.1|2660597_2661053_+	DUF2597 family protein	NA	Q1I0Z3	Pasteurella_virus	68.9	2.9e-53
WP_013747253.1|2661136_2661355_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_013747254.1|2661348_2661870_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	45.1	1.1e-35
WP_013747255.1|2661851_2662217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747256.1|2662176_2662401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747257.1|2662390_2662693_+|tail	putative phage tail assembly chaperone	tail	Q775G2	Haemophilus_virus	54.9	1.2e-23
WP_013747259.1|2662881_2665386_+|tail	phage tail tape measure protein	tail	Q94MY4	Haemophilus_virus	55.5	7.9e-137
WP_013747260.1|2665378_2665717_+	DUF2590 family protein	NA	Q1I0Y6	Pasteurella_virus	72.0	1.2e-35
WP_013747261.1|2665703_2666891_+|plate	baseplate J/gp47 family protein	plate	Q94MY2	Haemophilus_virus	68.8	4.1e-160
WP_013747262.1|2666880_2667402_+	hypothetical protein	NA	Q94MY1	Haemophilus_virus	68.2	1.5e-61
WP_013747263.1|2667419_2669336_+|tail	phage tail protein	tail	Q94MY0	Haemophilus_virus	56.7	1.1e-98
WP_013747264.1|2669361_2669646_-	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	37.3	1.2e-06
WP_013747265.1|2669617_2669899_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_013747266.1|2669973_2670633_+	DUF4376 domain-containing protein	NA	A0A0M3LRX2	Mannheimia_phage	39.4	2.3e-27
WP_013747267.1|2670613_2670886_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	74.1	3.1e-31
WP_013747268.1|2670941_2671778_+	DNA adenine methylase	NA	F6MIM2	Haemophilus_phage	53.6	5.0e-80
WP_013747269.1|2671819_2672572_+	hypothetical protein	NA	Q94MX8	Haemophilus_virus	49.6	7.3e-62
WP_013747270.1|2672568_2673153_+	hypothetical protein	NA	Q94MX7	Haemophilus_virus	68.4	3.1e-44
WP_013747271.1|2673156_2674758_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	63.5	3.8e-169
WP_013747272.1|2675061_2675286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013747273.1|2675306_2675588_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	45.6	3.4e-12
>prophage 175
NC_015460	Gallibacterium anatis UMN179, complete sequence	2687335	2679350	2683271	2687335	integrase	Pasteurella_virus(50.0%)	3	2677559:2677572	2687126:2687139
2677559:2677572	attL	AGAGCGAGCTGAAC	NA	NA	NA	NA
WP_013747285.1|2679350_2681786_+	replication endonuclease	NA	Q1I108	Pasteurella_virus	39.8	1.0e-144
WP_013747286.1|2681825_2682293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013747287.1|2682281_2683271_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	51.2	2.3e-79
2687126:2687139	attR	AGAGCGAGCTGAAC	NA	NA	NA	NA
