The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015433	Streptococcus suis ST3, complete sequence	2028815	33478	43538	2028815		Synechococcus_phage(28.57%)	7	NA	NA
WP_024390481.1|33478_37198_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.3	3.0e-39
WP_009908857.1|37200_38655_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	9.4e-58
WP_009908859.1|38710_39733_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	3.0e-58
WP_009908860.1|39729_40281_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.5	2.1e-26
WP_002935323.1|40290_41838_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.0	8.5e-73
WP_002935322.1|41902_42733_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	59.3	7.7e-89
WP_032499218.1|42722_43538_+	site-specific DNA-methyltransferase	NA	A0A1W6JJW1	Lactococcus_phage	33.5	1.1e-26
>prophage 2
NC_015433	Streptococcus suis ST3, complete sequence	2028815	423898	447250	2028815	portal,integrase	Streptococcus_phage(97.06%)	36	426687:426704	445241:445258
WP_002937018.1|423898_425299_+	Cof-type HAD-IIB family hydrolase	NA	A0A1V0S9I2	Catovirus	43.5	2.3e-24
WP_002937017.1|425300_425672_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002937015.1|425698_426625_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	100.0	9.9e-170
426687:426704	attL	AAAAAAACTATCTCGCCG	NA	NA	NA	NA
WP_013730163.1|426854_428012_-|integrase	site-specific integrase	integrase	A0A1X9I5C3	Streptococcus_phage	99.7	5.0e-219
WP_013730164.1|428208_428940_-	hypothetical protein	NA	A0A1X9I5E4	Streptococcus_phage	100.0	3.7e-103
WP_013730165.1|428987_429371_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I5R2	Streptococcus_phage	100.0	2.9e-67
WP_002937004.1|429377_429758_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I5A1	Streptococcus_phage	100.0	3.9e-64
WP_002937001.1|429942_430143_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	100.0	9.6e-30
WP_013730166.1|430212_430539_+	hypothetical protein	NA	A0A1X9I594	Streptococcus_phage	100.0	8.0e-58
WP_013730167.1|430612_430867_+	hypothetical protein	NA	A0A1X9I581	Streptococcus_phage	100.0	9.7e-43
WP_013730168.1|430907_431156_+	hypothetical protein	NA	A0A1X9I6Q0	Streptococcus_phage	100.0	1.1e-38
WP_022540561.1|431145_431298_+	hypothetical protein	NA	A0A1X9I663	Streptococcus_phage	100.0	2.0e-19
WP_013730169.1|431302_431644_+	hypothetical protein	NA	A0A1X9I5G6	Streptococcus_phage	100.0	2.1e-56
WP_013730170.1|431643_432123_+	siphovirus Gp157 family protein	NA	A0A1X9I5D2	Streptococcus_phage	100.0	4.8e-67
WP_013730171.1|432119_432365_+	hypothetical protein	NA	A0A1X9I5F0	Streptococcus_phage	100.0	4.3e-40
WP_013730172.1|432345_432810_+	hypothetical protein	NA	A0A1X9I5S7	Streptococcus_phage	100.0	7.1e-84
WP_013730173.1|432778_433951_+	hypothetical protein	NA	M1PF69	Streptococcus_phage	98.7	7.0e-229
WP_013730174.1|433971_434292_+	hypothetical protein	NA	A1EAC9	Streptococcus_phage	94.3	4.6e-50
WP_013730175.1|434301_435000_+	ERF family protein	NA	A0A1X9I5A9	Streptococcus_phage	100.0	2.2e-113
WP_022540564.1|434999_435296_+	hypothetical protein	NA	A0A1X9I5B1	Streptococcus_phage	100.0	1.6e-52
WP_013730176.1|435292_435691_+	single-stranded DNA-binding protein	NA	A0A1X9I6R5	Streptococcus_phage	97.7	5.2e-67
WP_013730177.1|435701_436529_+	bifunctional DNA primase/polymerase	NA	A0A1X9I684	Streptococcus_phage	100.0	4.6e-158
WP_079253058.1|436512_437892_+	helicase	NA	A0A1X9I5H6	Streptococcus_phage	99.8	3.8e-266
WP_013730179.1|438269_438425_+	hypothetical protein	NA	A0A1X9I5E8	Streptococcus_phage	100.0	9.7e-22
WP_013730180.1|438421_438730_+	DUF1372 family protein	NA	A0A1X9I5G5	Streptococcus_phage	100.0	3.8e-49
WP_013730181.1|438731_438947_+	hypothetical protein	NA	A0A1X9I5W1	Streptococcus_phage	100.0	9.7e-36
WP_013730182.1|439135_439450_+	hypothetical protein	NA	A0A1X9I5C1	Streptococcus_phage	100.0	5.2e-54
WP_002937915.1|439522_439957_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	100.0	2.0e-72
WP_013730183.1|440053_440401_+	HNH endonuclease	NA	A0A1X9I5C9	Streptococcus_phage	100.0	1.3e-61
WP_029694150.1|440482_440851_+	hypothetical protein	NA	A0A1X9I6S2	Streptococcus_phage	100.0	1.3e-40
WP_013730185.1|440847_442113_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	100.0	5.4e-243
WP_013730186.1|442105_443326_+	hypothetical protein	NA	A0A1X9I5H8	Streptococcus_phage	100.0	2.0e-239
WP_022540567.1|443330_443564_+	hypothetical protein	NA	A0A1X9I5G0	Streptococcus_phage	100.0	1.6e-39
WP_041179173.1|444264_444471_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_004194123.1|445268_445901_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	97.6	1.3e-109
445241:445258	attR	AAAAAAACTATCTCGCCG	NA	NA	NA	NA
WP_004194121.1|445957_447250_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	99.1	6.3e-247
>prophage 3
NC_015433	Streptococcus suis ST3, complete sequence	2028815	722311	748889	2028815	transposase	Streptococcus_phage(85.0%)	22	NA	NA
WP_004194722.1|722311_724486_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	60.3	1.1e-230
WP_004194720.1|724601_725765_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.7	2.1e-140
WP_004194719.1|725761_726436_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	64.6	7.7e-79
WP_004194717.1|726439_727606_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	3.5e-39
WP_013730266.1|727613_728717_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002938966.1|728726_729065_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	100.0	1.9e-54
WP_162467394.1|729367_730660_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	95.8	6.8e-217
WP_009909540.1|732323_732962_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	100.0	4.6e-126
WP_013730269.1|733024_735538_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	99.9	0.0e+00
WP_013730270.1|735699_736776_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	100.0	2.1e-195
WP_009909544.1|736840_738079_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	100.0	1.2e-223
WP_009909545.1|738088_738874_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	100.0	1.6e-136
WP_013730271.1|738896_739301_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	100.0	1.1e-64
WP_013730272.1|739427_740279_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	100.0	6.3e-155
WP_013730273.1|740377_741637_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	99.8	2.7e-242
WP_024381470.1|741759_742494_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	96.3	7.7e-117
WP_013730275.1|742623_744063_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	87.6	2.2e-200
WP_013730276.1|744078_744768_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	92.1	8.0e-108
WP_013730277.1|744777_745464_+	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	92.1	1.1e-104
WP_013730278.1|745502_746234_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_013730279.1|746263_748090_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	27.4	7.0e-26
WP_013730280.1|748175_748889_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.1	9.2e-06
>prophage 4
NC_015433	Streptococcus suis ST3, complete sequence	2028815	825261	891946	2028815	transposase,protease	Streptococcus_phage(79.17%)	57	NA	NA
WP_013730322.1|825261_827499_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	94.0	1.4e-97
WP_002935351.1|827500_827644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002935353.1|827822_828479_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	99.1	2.1e-113
WP_002935354.1|828572_829400_+	hypothetical protein	NA	M1PFV6	Streptococcus_phage	97.8	6.6e-133
WP_013730324.1|829405_830677_+	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	99.8	6.5e-212
WP_002935357.1|830713_831580_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	99.7	4.6e-153
WP_002935358.1|831754_832393_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	98.6	2.6e-113
WP_002935359.1|832389_833274_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	98.3	3.6e-153
WP_002935361.1|833293_833611_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	100.0	3.1e-54
WP_002935362.1|833612_834476_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	99.7	2.1e-158
WP_002935363.1|834945_836037_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	98.6	1.5e-204
WP_002935364.1|836036_836594_+	GNAT family acetyltransferase	NA	M1PSC3	Streptococcus_phage	98.4	4.5e-93
WP_002935365.1|836967_838149_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	99.7	2.7e-220
WP_002935366.1|838151_838658_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	97.0	1.2e-92
WP_002935368.1|838641_838995_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	100.0	1.9e-60
WP_009909675.1|839011_839911_-	cation transporter	NA	M1Q1N9	Streptococcus_phage	98.3	1.3e-161
WP_002935370.1|840210_841038_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	99.6	8.3e-152
WP_002935371.1|841193_842855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935372.1|843014_844403_+	amino acid permease	NA	NA	NA	NA	NA
WP_002935373.1|844525_845407_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935375.1|845599_846436_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002935376.1|846453_847329_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935377.1|847451_848063_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_002935380.1|851020_852943_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_029694137.1|853219_854098_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002935387.1|854422_855169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730329.1|856020_857739_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	98.8	0.0e+00
WP_013730330.1|857829_858399_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002935392.1|858385_858934_-	phosphopantothenoylcysteine decarboxylase	NA	A0A068EHP1	Penguinpox_virus	37.8	2.8e-23
WP_022540619.1|858926_859622_-	phosphopantothenate--cysteine ligase	NA	NA	NA	NA	NA
WP_002935394.1|860125_861796_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_013730331.1|861839_862649_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935400.1|864423_865275_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002935402.1|865432_866050_+	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	51.5	3.8e-48
WP_013730333.1|866050_866560_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002935405.1|866549_867203_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002935406.1|867213_867501_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_002935416.1|867797_868574_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_002935421.1|868705_869449_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002935426.1|869461_870436_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002935429.1|870624_870948_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002935430.1|870980_871286_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002935431.1|871298_872600_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002935432.1|872751_875196_+	glycyl radical protein	NA	A0A2H4YEI2	Aeromonas_phage	47.2	4.9e-06
WP_002935438.1|875207_875876_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.0	1.5e-21
WP_002935440.1|875907_876864_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002935441.1|876984_878079_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_002935442.1|878247_879324_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002935444.1|879396_880332_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_086558053.1|881035_882328_+|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
WP_002935451.1|882542_884333_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	100.0	0.0e+00
WP_002935455.1|884499_884838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002935458.1|885022_886390_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009909707.1|886679_888959_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.0	1.2e-128
WP_009909709.1|889400_890141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013730335.1|890419_891103_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_013730336.1|891181_891946_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NC_015433	Streptococcus suis ST3, complete sequence	2028815	1230568	1280448	2028815	transposase,protease,tRNA	Streptococcus_phage(20.0%)	47	NA	NA
WP_162467394.1|1230568_1231861_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	95.8	6.8e-217
WP_013730412.1|1232063_1235558_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_009910076.1|1235654_1235963_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002936073.1|1235969_1236785_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002936077.1|1236771_1237548_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002936080.1|1237567_1238059_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_013730413.1|1238068_1239259_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_002936085.1|1239270_1239705_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_022540650.1|1239990_1240632_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002936090.1|1240642_1241644_-	sugar kinase	NA	NA	NA	NA	NA
WP_002936092.1|1241660_1242302_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_002936093.1|1242353_1243169_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002936094.1|1244079_1245174_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_002936095.1|1245281_1245956_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002936096.1|1245965_1246283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012775187.1|1246292_1246982_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013730414.1|1247234_1247993_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_009910096.1|1247989_1248205_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013730415.1|1248217_1248784_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_013730417.1|1248930_1249128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099425949.1|1249244_1250091_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	25.1	6.8e-08
WP_002938097.1|1250228_1250681_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_009910105.1|1250755_1253374_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	1.5e-61
WP_002938099.1|1253653_1254139_-	LURP-one-related family protein	NA	NA	NA	NA	NA
WP_002938100.1|1254403_1255405_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_009910106.1|1255465_1256185_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_002938103.1|1256259_1256808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002938105.1|1256823_1257264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009910108.1|1257265_1259068_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002938107.1|1259299_1260241_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_074390814.1|1260304_1262362_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	31.1	5.8e-85
WP_002938116.1|1262461_1263055_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_002938119.1|1263355_1264393_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	34.3	2.2e-45
WP_002938121.1|1264402_1265428_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	35.2	3.2e-44
WP_002938123.1|1265473_1266343_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002938125.1|1266355_1267423_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_002938126.1|1267626_1268427_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.8	9.0e-10
WP_013730419.1|1268436_1269330_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013730420.1|1269384_1270359_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013730421.1|1270382_1271342_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013730422.1|1272082_1273084_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_013730423.1|1273107_1274253_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024390310.1|1274759_1275590_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009909533.1|1275616_1276249_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	6.6e-32
WP_013730426.1|1276258_1276900_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_013730427.1|1277073_1278885_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	37.6	9.5e-100
WP_013730428.1|1279191_1280448_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.4	7.5e-128
>prophage 6
NC_015433	Streptococcus suis ST3, complete sequence	2028815	1998426	2016132	2028815	transposase,integrase	Streptococcus_phage(70.59%)	22	2003507:2003532	2016263:2016288
WP_002938187.1|1998426_1999263_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.9	1.3e-22
WP_013730677.1|1999259_1999799_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002939074.1|1999808_2000666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002939071.1|2000747_2002031_-	insulinase family protein	NA	NA	NA	NA	NA
WP_009911054.1|2002027_2003281_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	99.0	4.2e-232
2003507:2003532	attL	CTCACTACTAATCTTAGTATGTTTTT	NA	NA	NA	NA
WP_013730680.1|2004064_2004613_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	58.1	4.7e-50
WP_013730681.1|2004690_2005149_-	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	42.0	7.6e-22
WP_013730682.1|2005161_2005977_-	DnaD domain protein	NA	A0A2I6QQV2	Streptococcus_phage	66.0	2.0e-81
WP_013730683.1|2005963_2006248_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	83.9	8.9e-37
WP_013730684.1|2006237_2006576_-	hypothetical protein	NA	A0A1X9I5Z6	Streptococcus_phage	97.8	5.1e-47
WP_013730685.1|2006572_2006722_-	hypothetical protein	NA	A0A1X9I6A8	Streptococcus_phage	89.8	2.4e-17
WP_013730686.1|2006733_2006937_-	hypothetical protein	NA	A0A1X9I5T6	Streptococcus_phage	79.1	7.2e-25
WP_013730687.1|2006924_2007314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013730688.1|2007752_2008379_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	32.8	9.5e-15
WP_013730689.1|2008391_2009138_-	Bro-N domain-containing protein	NA	A0A0A7RW33	Clostridium_phage	50.7	2.1e-24
WP_013730690.1|2009156_2009384_-	helix-turn-helix transcriptional regulator	NA	Q38329	Lactococcus_phage	51.6	2.8e-09
WP_013730691.1|2009537_2010251_+	helix-turn-helix transcriptional regulator	NA	Q708R9	Streptococcus_phage	50.6	3.7e-15
WP_013730692.1|2010614_2011445_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	62.1	1.2e-89
WP_013730693.1|2011609_2012782_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	96.9	3.1e-216
WP_002936175.1|2012919_2013303_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	94.5	4.6e-36
WP_002936177.1|2013305_2014400_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_086558053.1|2014839_2016132_-|transposase	IS110-like element ISSsu7 family transposase	transposase	A0A1X9I619	Streptococcus_phage	100.0	1.4e-225
2016263:2016288	attR	CTCACTACTAATCTTAGTATGTTTTT	NA	NA	NA	NA
