The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	550189	599372	3995227	terminase,tRNA,protease,portal,tail,head,integrase	Bacillus_phage(32.56%)	71	560380:560399	604165:604184
WP_013351177.1|550189_550666_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_013351178.1|550646_551336_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_013351179.1|551346_551802_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351180.1|551794_552835_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	1.2e-62
WP_014469833.1|553058_554987_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.6	6.0e-60
WP_003155986.1|555126_555639_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013351182.1|555635_556283_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003155981.1|556301_556472_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_088030482.1|556478_557240_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|557278_557470_-	YdiK family protein	NA	NA	NA	NA	NA
WP_013351184.1|557466_558201_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013351185.1|558437_558722_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	3.7e-19
WP_013351186.1|558763_560398_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
560380:560399	attL	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
WP_014471487.1|560476_561688_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	41.8	4.0e-78
WP_050807603.1|561699_562029_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013351188.1|562366_562714_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.1	5.1e-18
WP_020953912.1|562727_563249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471489.1|563516_563897_-	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	39.7	1.9e-10
WP_020953913.1|564030_564273_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014471490.1|564315_564495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155923.1|564478_564724_-	hypothetical protein	NA	X2KU02	Streptococcus_phage	61.3	1.1e-22
WP_014471492.1|564804_565119_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	48.9	3.6e-15
WP_003155918.1|565115_565886_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.5	8.5e-74
WP_003155916.1|565995_566568_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_013351192.1|566564_566822_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.5	3.5e-08
WP_013351193.1|566818_567016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471494.1|567117_567303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471495.1|567302_568253_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.0	2.8e-135
WP_013351197.1|568255_569095_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	80.9	1.8e-122
WP_014471497.1|569259_569976_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	44.5	2.1e-42
WP_142919103.1|569860_570808_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.2	1.2e-56
WP_014471499.1|570804_570948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471500.1|571093_571534_+	hypothetical protein	NA	D2XR52	Bacillus_phage	35.0	7.1e-09
WP_014471501.1|571520_571979_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	80.0	2.1e-59
WP_013351203.1|572098_572251_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.2e-08
WP_003155894.1|572332_572536_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_013351204.1|572567_572909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041915529.1|572905_573160_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.3	6.5e-07
WP_014471503.1|573164_574541_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	48.9	4.5e-142
WP_014471504.1|574552_574876_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	3.5e-05
WP_014471505.1|574872_575433_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	50.0	2.6e-40
WP_014471506.1|575432_575867_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	52.9	2.9e-31
WP_014471507.1|575863_576082_+	hypothetical protein	NA	A0A0A0RMF3	Bacillus_phage	38.6	1.3e-08
WP_014471509.1|576516_576951_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.8e-50
WP_014471510.1|576984_577275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471511.1|577473_577602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471512.1|577616_578132_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	3.0e-27
WP_014304494.1|578236_578374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|578672_578885_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_014471513.1|579016_579799_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_014471514.1|579987_580713_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	57.1	9.5e-51
WP_013351221.1|580699_581974_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	72.3	6.5e-180
WP_013351222.1|581995_583447_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	49.4	1.3e-128
WP_013351223.1|583433_584357_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	1.0e-81
WP_013351224.1|584360_584630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351225.1|584783_585449_+	phage scaffolding protein	NA	I1TLE1	Bacillus_phage	49.3	4.5e-23
WP_013351226.1|585461_586448_+	hypothetical protein	NA	D2J006	Enterococcus_phage	37.4	2.7e-48
WP_076983707.1|586425_586710_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	65.4	3.3e-23
WP_013351227.1|586710_586902_+	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013351228.1|586906_587203_+|head,tail	phage head-tail connector protein	head,tail	Q4ZBR3	Staphylococcus_phage	40.4	5.6e-10
WP_013351229.1|587199_587538_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014471518.1|587530_587947_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_013351231.1|587965_588364_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.8	2.4e-24
WP_013351232.1|588377_588890_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013351233.1|588831_589146_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	79.0	5.4e-27
WP_076983168.1|589159_589402_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_003155845.1|589458_589965_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	6.7e-11
WP_041481705.1|590012_590321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041915530.1|590325_595401_+	membrane protein	NA	Q4ZC60	Staphylococcus_virus	27.2	1.2e-35
WP_014471522.1|595397_596162_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_014471523.1|596174_599372_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	46.1	1.7e-131
604165:604184	attR	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
>prophage 2
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	645395	655286	3995227		Synechococcus_phage(50.0%)	9	NA	NA
WP_014469853.1|645395_646688_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_014469854.1|646763_647483_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	9.8e-48
WP_014469855.1|647482_647737_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	35.8	2.1e-05
WP_014469856.1|647733_648417_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014469857.1|648400_650629_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	3.8e-159
WP_014469858.1|650604_652035_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_014469859.1|652126_653167_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	8.2e-64
WP_014469860.1|653163_653751_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	1.0e-26
WP_014469861.1|653747_655286_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.1	2.3e-78
>prophage 3
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	847427	931903	3995227	capsid,terminase,tRNA,protease,portal,tail,plate,head,holin,integrase	Bacillus_phage(21.62%)	91	853273:853289	922111:922127
WP_014469929.1|847427_848339_-|protease	serine protease	protease	NA	NA	NA	NA
WP_003155495.1|848476_848629_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_013351439.1|848752_849022_+	YfhJ family protein	NA	NA	NA	NA	NA
WP_014469930.1|849154_849682_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_014469931.1|849767_850100_+	SdpI family protein	NA	NA	NA	NA	NA
WP_014469932.1|850096_850957_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
WP_014471590.1|851153_852134_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.7	8.9e-60
WP_014471591.1|852170_854756_+	YfhO family protein	NA	NA	NA	NA	NA
853273:853289	attL	AGAGTATGCTGATATCC	NA	NA	NA	NA
WP_013351447.1|854752_855736_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_013351448.1|855956_857105_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.7	1.2e-34
WP_041915533.1|857172_857637_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.0	1.2e-38
WP_013351450.1|857651_857957_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	50.5	2.0e-18
WP_013351451.1|858229_858430_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	65.6	3.3e-14
WP_014471597.1|858416_858689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471598.1|858738_858888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351453.1|858884_859166_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	41.9	8.0e-14
WP_014471599.1|859152_859461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351454.1|859451_860099_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	41.6	1.9e-34
WP_013351455.1|860111_860957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050807612.1|861118_861487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471601.1|861498_862272_+	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	47.0	2.3e-39
WP_041915535.1|862264_862621_+	hypothetical protein	NA	W8EIZ4	Geobacillus_phage	34.1	8.3e-08
WP_014471603.1|862621_863950_+	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.7	2.7e-136
WP_010329612.1|863939_864152_+	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	48.4	9.9e-09
WP_014471604.1|864148_864349_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	60.0	1.8e-07
WP_014471605.1|864447_864906_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.8	3.8e-37
WP_014471606.1|865238_865451_+	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	40.7	5.1e-05
WP_014471608.1|865788_866403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041915536.1|866415_866616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041915537.1|866647_866962_+	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	45.5	3.3e-16
WP_014471610.1|867190_867646_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBQ3	Clostridium_phage	35.2	1.4e-12
WP_013351469.1|867635_869426_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	61.1	7.7e-211
WP_013351470.1|869437_870658_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	36.8	1.3e-65
WP_014471611.1|870632_871355_+|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	65.2	1.1e-67
WP_014471612.1|871351_872557_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	49.0	4.8e-100
WP_014471613.1|872570_872885_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	40.3	1.1e-06
WP_014471614.1|872891_873221_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_013351474.1|873217_873646_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	44.3	2.0e-08
WP_014471615.1|873642_874032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471616.1|874090_874666_+|tail	tail protein	tail	A0A1I9KKC4	Lactobacillus_phage	35.7	1.0e-23
WP_013351477.1|874741_875062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471618.1|875244_881001_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	32.7	1.2e-15
WP_013351480.1|881003_881843_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	32.8	9.7e-31
WP_013351481.1|881852_883007_+|tail	phage tail protein	tail	A0A1W6JQ67	Staphylococcus_phage	33.6	1.9e-24
WP_013351482.1|882999_883308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721179.1|883499_884315_+	SGNH/GDSL hydrolase family protein	NA	Q4ZE16	Staphylococcus_virus	44.8	4.3e-60
WP_014471620.1|884330_885617_+|plate	BppU family phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	39.1	9.2e-81
WP_014471621.1|885617_885953_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_014471622.1|885959_886205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351487.1|886239_886455_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	2.0e-12
WP_014471623.1|886466_886733_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	68.7	1.1e-23
WP_014471624.1|886788_887946_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.2	6.1e-68
WP_013351490.1|887991_888939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471625.1|889002_889557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164463356.1|890945_891095_+	PhrK family phosphatase-inhibitory pheromone	NA	Q9ZXD2	Bacillus_phage	97.3	2.8e-10
WP_013351494.1|891433_892531_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_013351495.1|892537_892762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351496.1|892844_893597_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_013351497.1|893664_893835_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_014471626.1|893995_894262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155475.1|894397_894928_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013351498.1|895009_896752_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	9.6e-49
WP_013351499.1|896828_897893_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_013351500.1|898102_899392_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013351501.1|899548_900022_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013351502.1|900146_900584_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_013351503.1|900618_900972_-	YgzB family protein	NA	NA	NA	NA	NA
WP_013351504.1|901174_902059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014469936.1|909103_910681_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_014471629.1|910761_911460_+	peptidase E	NA	NA	NA	NA	NA
WP_013351590.1|911739_913512_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_013351592.1|913979_914165_+	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_013351593.1|914161_915889_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351594.1|915958_916915_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351595.1|916928_917834_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351596.1|917830_918817_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	1.5e-14
WP_013351597.1|918809_919775_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014471634.1|919846_921292_-	catalase	NA	A0A2K9L0T1	Tupanvirus	41.7	2.1e-110
WP_013351599.1|921550_922486_+	amidohydrolase	NA	NA	NA	NA	NA
922111:922127	attR	AGAGTATGCTGATATCC	NA	NA	NA	NA
WP_013351600.1|922707_923475_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	1.6e-32
WP_014469938.1|923490_924480_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088030491.1|924476_925313_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014471636.1|925336_926473_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_041481717.1|926814_927114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351605.1|927217_927487_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_013351606.1|927507_927975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014469942.1|927971_928175_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013351608.1|928527_929151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351609.1|929235_930396_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_038463192.1|930472_931384_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_088030492.1|931420_931903_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 4
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	1156794	1190371	3995227	tRNA,protease,coat	Planktothrix_phage(16.67%)	38	NA	NA
WP_012117281.1|1156794_1157787_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013351824.1|1158531_1160166_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351825.1|1160272_1161208_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351826.1|1161211_1162129_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_013351827.1|1162141_1163218_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_014470613.1|1163210_1164128_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_013351829.1|1164235_1165423_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_013351830.1|1165540_1166119_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003327578.1|1166296_1166692_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_013351831.1|1166749_1167406_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
WP_014470612.1|1167681_1168338_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_013351833.1|1168489_1169650_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_013351834.1|1169878_1171708_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1171743_1171911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351835.1|1172195_1173098_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_013351836.1|1173094_1173493_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_013351837.1|1173717_1174404_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
WP_013351838.1|1174408_1174981_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_013351839.1|1175105_1175471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351840.1|1175498_1176134_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013351841.1|1176151_1176952_+	NAD kinase	NA	NA	NA	NA	NA
WP_013351842.1|1176966_1177860_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
WP_014471693.1|1177893_1178643_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A8E2N0	Enterococcus_phage	25.4	4.6e-08
WP_014470611.1|1178868_1180713_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_013351845.1|1180961_1181672_+	thiaminase II	NA	NA	NA	NA	NA
WP_014470610.1|1181646_1182264_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_013351847.1|1182247_1183357_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013351848.1|1183353_1183557_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1183553_1184324_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013351849.1|1184320_1185331_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_013351850.1|1185353_1186166_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013351851.1|1186296_1187073_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_164848957.1|1187164_1187758_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|1187815_1188259_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|1188407_1188890_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351855.1|1189039_1189540_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|1189632_1189947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470608.1|1189984_1190371_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	1211739	1214745	3995227		Bacillus_phage(100.0%)	6	NA	NA
WP_013351882.1|1211739_1211898_-	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
WP_013351883.1|1212057_1212387_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351884.1|1212379_1212772_+	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351885.1|1213421_1213697_-	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_014470521.1|1214147_1214357_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351886.1|1214370_1214745_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
>prophage 6
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	1250110	1285595	3995227	capsid,terminase,portal,plate,holin,tail	Bacillus_phage(30.3%)	47	NA	NA
WP_014470508.1|1250110_1251463_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	1.0e-13
WP_014470507.1|1251889_1252081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351927.1|1252248_1253013_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013351928.1|1253156_1253624_-	DinB family protein	NA	NA	NA	NA	NA
WP_088030497.1|1253828_1254965_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_003154881.1|1254954_1255089_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_013351930.1|1255232_1256186_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_013351931.1|1256223_1256601_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351932.1|1256710_1257313_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351933.1|1257455_1258046_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351934.1|1258193_1258532_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1258722_1258902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470504.1|1258891_1259719_+	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_013351937.1|1259618_1260419_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.3	2.3e-58
WP_003154863.1|1260418_1260586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351938.1|1260683_1261025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351939.1|1261014_1261218_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351940.1|1261330_1261840_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_014470502.1|1261954_1262749_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.4	1.2e-59
WP_013351942.1|1262745_1264044_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_044051899.1|1264092_1265484_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351944.1|1265503_1266346_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_013351945.1|1266372_1267308_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_014470501.1|1267324_1267708_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_013351946.1|1267704_1268061_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_013351947.1|1268057_1268561_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351948.1|1268557_1269004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351949.1|1269000_1269210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351950.1|1269209_1270607_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_003154837.1|1270608_1271052_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1271126_1271573_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1271614_1271767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471718.1|1271754_1276635_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	8.4e-42
WP_013351953.1|1276627_1277287_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_013351954.1|1277300_1278278_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351955.1|1278277_1278544_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_014470499.1|1278693_1279119_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.2	3.3e-11
WP_014471720.1|1279111_1280158_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	2.3e-69
WP_014470497.1|1280141_1280720_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	1.8e-12
WP_013351959.1|1280716_1280989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470496.1|1280991_1282755_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	50.0	6.6e-13
WP_014470495.1|1282766_1283093_+	XkdW family protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	39.8	1.2e-13
WP_014470494.1|1283092_1283257_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	60.4	1.0e-13
WP_014470493.1|1283311_1284109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351964.1|1284162_1284426_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_014470492.1|1284439_1284703_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	6.7e-23
WP_014470491.1|1284716_1285595_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
>prophage 7
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	1870822	1881207	3995227		Bacillus_phage(71.43%)	14	NA	NA
WP_013352403.1|1870822_1871443_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
WP_016935991.1|1871604_1871694_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352404.1|1872110_1872647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471863.1|1872975_1873125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471864.1|1873290_1875708_-	peptidase G2	NA	D6R401	Bacillus_phage	50.2	6.5e-221
WP_013352407.1|1875995_1876235_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_013352408.1|1876405_1876840_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352409.1|1876890_1877076_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352410.1|1877281_1878103_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352411.1|1878209_1878359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352412.1|1878345_1879176_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352413.1|1879203_1879653_-	YndM family protein	NA	NA	NA	NA	NA
WP_013352414.1|1879809_1880238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611720.1|1880586_1881207_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
>prophage 8
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	2139774	2201182	3995227	integrase	Bacillus_phage(91.55%)	94	2158507:2158525	2202684:2202702
WP_014471917.1|2139774_2140329_-	Holliday junction resolvase RecU	NA	O64195	Bacillus_phage	92.1	4.2e-91
WP_041915545.1|2140426_2140666_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	64.5	2.5e-24
WP_014471919.1|2141060_2141231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915546.1|2141227_2141398_-	hypothetical protein	NA	O64190	Bacillus_phage	57.9	2.3e-08
WP_014471920.1|2141398_2141947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915547.1|2141927_2142335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471921.1|2142372_2142627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471922.1|2142667_2143498_-	metallophosphoesterase	NA	O64184	Bacillus_phage	88.7	8.4e-152
WP_038458497.1|2143657_2143870_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	98.6	9.2e-31
WP_014471923.1|2143897_2144203_-	hypothetical protein	NA	J9Q6K5	Salmonella_phage	51.3	9.6e-05
WP_050807609.1|2144368_2144674_-	hypothetical protein	NA	A0A1P8CX46	Bacillus_phage	72.7	1.1e-32
WP_050807610.1|2144744_2145299_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	43.1	2.5e-27
WP_041915548.1|2145291_2145669_-	hypothetical protein	NA	R4JDR8	Bacillus_phage	87.9	9.6e-63
WP_014471927.1|2145886_2146258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471928.1|2146317_2146704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471929.1|2146833_2147340_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	40.9	1.3e-33
WP_014471930.1|2147339_2148179_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	89.6	1.6e-150
WP_041915549.1|2148249_2148858_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_014471932.1|2149311_2149611_-	hypothetical protein	NA	O64180	Bacillus_phage	51.1	2.8e-17
WP_014471934.1|2149769_2150168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471935.1|2150285_2150720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471936.1|2150813_2151242_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	90.8	1.2e-72
WP_014471938.1|2151720_2151963_-	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	93.8	1.3e-36
WP_014471939.1|2151987_2152725_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	59.6	3.6e-82
WP_041915551.1|2152714_2153695_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	79.9	8.7e-148
WP_041481780.1|2153758_2154097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471941.1|2155738_2156470_-	GIY-YIG nuclease family protein	NA	A0A024FSJ1	Bacillus_phage	68.2	1.3e-63
WP_014471942.1|2156841_2157525_-	HNH endonuclease	NA	L0LCB9	Bacillus_phage	57.6	3.4e-50
WP_148230874.1|2157628_2158306_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	96.0	1.1e-120
WP_014470230.1|2158313_2158709_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	94.7	1.5e-63
2158507:2158525	attL	TTTATTTTATTTTTATTCT	NA	NA	NA	NA
WP_014471944.1|2158708_2159062_-	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	100.0	3.8e-61
WP_014470228.1|2159113_2159446_-	hypothetical protein	NA	O64168	Bacillus_phage	86.0	5.5e-14
WP_041915615.1|2159459_2159675_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	82.6	1.8e-29
WP_148230871.1|2159721_2159940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915616.1|2160069_2160327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471948.1|2160635_2160983_-	hypothetical protein	NA	O64164	Bacillus_phage	88.7	3.2e-49
WP_041915553.1|2160997_2161405_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	63.6	7.5e-37
WP_014471952.1|2162057_2162264_-	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	50.0	2.6e-06
WP_041915554.1|2162558_2162822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471955.1|2163592_2163811_-	hypothetical protein	NA	O64155	Bacillus_phage	60.0	4.3e-15
WP_148230875.1|2163861_2165355_-	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	95.8	4.1e-258
WP_014471957.1|2165421_2166258_-	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	42.9	1.8e-45
WP_041915557.1|2166382_2166730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471958.1|2166791_2167310_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	91.3	1.3e-89
WP_014471959.1|2167287_2167815_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	81.2	7.1e-72
WP_014471960.1|2167811_2167970_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	62.7	4.2e-12
WP_014471961.1|2167974_2168178_-	YorP family protein	NA	O64150	Bacillus_phage	74.6	2.5e-25
WP_014471962.1|2168189_2168897_-	hypothetical protein	NA	A0A1P8CX16	Bacillus_phage	34.8	2.8e-23
WP_014471963.1|2168923_2172853_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.6	0.0e+00
WP_014471964.1|2172865_2174596_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	90.3	8.0e-306
WP_014471965.1|2174595_2175732_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.4	1.5e-204
WP_014471966.1|2175747_2177262_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	94.6	9.2e-274
WP_014471967.1|2177276_2177747_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	90.4	7.4e-81
WP_014471968.1|2177787_2178759_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	96.6	1.4e-174
WP_014471969.1|2178848_2179763_-	hypothetical protein	NA	O64140	Bacillus_phage	90.5	4.3e-157
WP_041915558.1|2179785_2180166_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	78.4	2.4e-53
WP_041915559.1|2180304_2180688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471971.1|2180879_2181257_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	3.4e-52
WP_014471972.1|2181295_2183038_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.1	7.2e-222
WP_014471973.1|2183034_2183856_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	61.4	3.5e-86
WP_014471974.1|2183960_2184179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470192.1|2184253_2184526_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_014470191.1|2184515_2185403_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_014470190.1|2185451_2185931_-	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	35.4	4.0e-13
WP_014471975.1|2185946_2186198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470188.1|2186223_2186469_-	hypothetical protein	NA	O64132	Bacillus_phage	84.1	2.5e-27
WP_014470187.1|2186539_2187214_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	1.4e-77
WP_014470186.1|2187283_2188096_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.1	4.2e-140
WP_014470184.1|2188313_2188511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915561.1|2188809_2189031_-	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	86.3	1.6e-30
WP_014471977.1|2189425_2189788_-	hypothetical protein	NA	A0A140HLN5	Bacillus_phage	49.0	9.9e-33
WP_014470180.1|2189830_2190082_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	56.5	1.6e-18
WP_014471978.1|2190125_2190341_-	hypothetical protein	NA	U5PU52	Bacillus_phage	65.2	3.7e-19
WP_041915562.1|2190458_2190833_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	65.9	8.1e-38
WP_148230872.1|2190846_2191077_-	hypothetical protein	NA	O64123	Bacillus_phage	93.0	6.5e-30
WP_014471981.1|2191212_2191401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470175.1|2191432_2191825_-	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	46.9	6.3e-25
WP_014471982.1|2191857_2192052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026113712.1|2192100_2192358_-	hypothetical protein	NA	O64116	Bacillus_phage	92.9	3.5e-40
WP_014471986.1|2193485_2193722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471987.1|2193762_2194281_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014471988.1|2194277_2194448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471989.1|2194444_2194849_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	72.0	3.1e-51
WP_193345657.1|2194845_2195127_-	hypothetical protein	NA	M4ZRU5	Bacillus_phage	89.0	3.7e-43
WP_020954128.1|2195492_2195738_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_014471993.1|2195812_2196112_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	51.0	6.1e-20
WP_014471994.1|2196276_2196498_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	78.1	1.4e-26
WP_014471995.1|2196719_2197703_-	hypothetical protein	NA	A0A1P8CWX4	Bacillus_phage	77.4	1.3e-138
WP_014471996.1|2197723_2199073_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.7	2.5e-190
WP_014471997.1|2199149_2200208_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.7	2.3e-154
WP_014471998.1|2200217_2200382_-	hypothetical protein	NA	A0A1P8CWX2	Bacillus_phage	52.6	3.9e-05
WP_014471999.1|2200420_2200651_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_014472000.1|2200665_2200878_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_014472001.1|2201026_2201182_-	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	68.6	8.3e-13
2202684:2202702	attR	TTTATTTTATTTTTATTCT	NA	NA	NA	NA
>prophage 9
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	2204341	2207922	3995227		Bacillus_phage(100.0%)	11	NA	NA
WP_014472005.1|2204341_2204473_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	88.4	3.6e-17
WP_041915567.1|2204484_2204700_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	5.2e-13
WP_014472006.1|2204702_2204954_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	59.0	4.6e-21
WP_041915568.1|2205024_2205207_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.5e-26
WP_014472007.1|2205217_2205502_-	XRE family transcriptional regulator	NA	A0A172JIG2	Bacillus_phage	60.6	1.4e-13
WP_014472008.1|2205779_2206262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472009.1|2206294_2206717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472010.1|2206726_2206963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472011.1|2207001_2207379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470138.1|2207410_2207602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|2207718_2207922_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
>prophage 10
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	2211744	2249080	3995227	integrase	Bacillus_phage(94.12%)	45	2216738:2216753	2248993:2249008
WP_014472013.1|2211744_2212497_-	phage antirepressor KilAC domain-containing protein	NA	A0A1P8CWY0	Bacillus_phage	50.6	2.9e-58
WP_014472014.1|2212719_2214516_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.2	0.0e+00
WP_014472015.1|2214517_2215120_-	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	100.0	3.9e-106
WP_014472016.1|2215121_2216042_-	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	94.1	8.4e-153
WP_041915570.1|2216046_2216835_-	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	88.7	3.6e-128
2216738:2216753	attL	AGCATCTTTAACTTTT	NA	NA	NA	NA
WP_014472019.1|2217177_2218395_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.2	1.2e-199
WP_014472020.1|2218475_2218715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915572.1|2219018_2219198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472021.1|2220146_2221259_-	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	30.3	7.5e-31
WP_041915573.1|2221258_2221543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020954165.1|2221721_2221958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014417885.1|2222077_2222257_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.5e-18
WP_148230876.1|2222318_2224172_+	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	86.4	0.0e+00
WP_041915575.1|2224518_2225148_+	hypothetical protein	NA	O64076	Bacillus_phage	73.9	1.2e-81
WP_014472022.1|2225408_2225684_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	79.1	1.2e-30
WP_010328101.1|2227640_2227832_+	YonK family protein	NA	A0A1P8CWT3	Bacillus_phage	100.0	1.9e-27
WP_014472023.1|2227848_2229066_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	98.8	8.0e-228
WP_014470112.1|2229303_2229804_+	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	32.5	1.1e-18
WP_014472024.1|2229913_2230834_+	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	98.0	3.6e-172
WP_014472025.1|2230820_2232590_+	hypothetical protein	NA	O64069	Bacillus_phage	99.5	0.0e+00
WP_014472026.1|2232607_2234143_+	hypothetical protein	NA	O64068	Bacillus_phage	89.2	7.7e-260
WP_014472027.1|2234173_2235610_+	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	84.3	3.7e-232
WP_014472028.1|2235634_2236171_+	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	97.2	9.7e-93
WP_014472029.1|2236208_2237225_+	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	97.9	4.6e-184
WP_041915576.1|2237259_2237730_+	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	96.8	4.8e-80
WP_014472031.1|2237744_2238140_+	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	93.9	7.4e-66
WP_014472032.1|2238136_2238391_+	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	77.4	3.3e-27
WP_041915577.1|2238374_2239028_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	86.9	4.6e-105
WP_014417869.1|2239024_2239531_+	hypothetical protein	NA	O64060	Bacillus_phage	68.5	6.8e-64
WP_014472034.1|2239527_2240253_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	7.3e-27
WP_014472035.1|2240291_2241083_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	35.5	7.5e-17
WP_014472036.1|2241103_2241571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470098.1|2241642_2241999_+	hypothetical protein	NA	O64055	Bacillus_phage	78.8	2.4e-47
WP_014472037.1|2241998_2243330_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	42.3	2.5e-20
WP_014470096.1|2243343_2243619_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	1.2e-09
WP_014470095.1|2243619_2243772_+	XkdX family protein	NA	NA	NA	NA	NA
WP_014472038.1|2243790_2244639_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014472039.1|2244721_2245207_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.3	8.3e-59
WP_014472040.1|2245206_2245623_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	68.3	1.4e-46
WP_014472041.1|2245636_2246638_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.7	2.2e-170
WP_014472042.1|2246682_2246898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472043.1|2246977_2247685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472044.1|2247746_2247905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472045.1|2247971_2248382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470085.1|2248453_2249080_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	32.8	1.9e-23
2248993:2249008	attR	AAAAGTTAAAGATGCT	NA	NA	NA	NA
>prophage 11
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	2261002	2279300	3995227	holin	Bacillus_phage(84.62%)	16	NA	NA
WP_014470080.1|2261002_2263552_+	hypothetical protein	NA	D6R401	Bacillus_phage	35.9	6.4e-142
WP_014472049.1|2265220_2265613_+	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	97.7	1.6e-60
WP_014472050.1|2265633_2265885_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	83.1	7.6e-32
WP_099762739.1|2266222_2266528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014472052.1|2266679_2267840_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	1.3e-33
WP_014472053.1|2268003_2268618_-	DNA polymerase	NA	A0A1P8CWP4	Bacillus_phage	91.8	1.9e-92
WP_014472054.1|2268658_2270470_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	41.6	3.3e-28
WP_014472055.1|2271021_2271732_-	lesion bypass phage DNA polymerase	NA	O64031	Bacillus_phage	91.4	2.9e-121
WP_014472056.1|2271724_2272057_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	6.3e-42
WP_080558536.1|2272274_2273033_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_041915578.1|2273161_2273365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967548.1|2273614_2273731_+	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_014472060.1|2274038_2274599_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	58.2	3.9e-52
WP_014472061.1|2274598_2276353_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	70.2	3.5e-240
WP_014472062.1|2276524_2277508_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.5	5.6e-78
WP_014472063.1|2277758_2279300_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	32.3	2.8e-36
>prophage 12
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	2380189	2386442	3995227		Staphylococcus_phage(66.67%)	9	NA	NA
WP_013352726.1|2380189_2380783_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_013352727.1|2380772_2381528_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_076983148.1|2381735_2381825_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352728.1|2381912_2382434_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_013352729.1|2382499_2382874_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352730.1|2382990_2383455_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352731.1|2383487_2384684_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_014470033.1|2384698_2385346_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352733.1|2385326_2386442_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 13
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	2666551	2725997	3995227	tRNA,protease,coat	uncultured_Mediterranean_phage(25.0%)	59	NA	NA
WP_014472138.1|2666551_2666995_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014472139.1|2667007_2669212_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_013353031.1|2669370_2669883_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	7.2e-29
WP_014472140.1|2669888_2672246_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	8.1e-91
WP_013353033.1|2672301_2672628_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_013353034.1|2672691_2673189_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_013353035.1|2673319_2675539_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.9	3.5e-27
WP_013353036.1|2675575_2675872_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_014472141.1|2675986_2677543_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_013353038.1|2677550_2678207_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013353039.1|2678373_2678760_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2678812_2679073_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014472142.1|2679104_2680250_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	3.7e-89
WP_013353041.1|2680277_2681306_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013353042.1|2681331_2681532_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013353043.1|2681524_2682529_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	5.2e-07
WP_003152683.1|2682539_2683145_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038463270.1|2683279_2683756_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014470776.1|2684165_2684759_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014470777.1|2684907_2686059_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_014470778.1|2686185_2687289_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014472144.1|2687288_2688137_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014472145.1|2688133_2689684_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013353051.1|2689789_2690941_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.5	5.1e-30
WP_013353052.1|2690937_2691480_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013353053.1|2691506_2692364_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2692379_2692823_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_013353054.1|2692876_2694163_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013353055.1|2694194_2694773_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2695089_2695374_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038462961.1|2695386_2695728_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2695730_2696039_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013353057.1|2696184_2697051_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013353058.1|2697043_2697847_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2697975_2698779_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013353059.1|2698781_2699462_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014470782.1|2699515_2700034_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013353061.1|2700030_2700894_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013353062.1|2700924_2701938_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_013353063.1|2702029_2702725_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013353064.1|2702756_2703326_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013353065.1|2703467_2704469_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013353066.1|2704595_2705348_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013353067.1|2705487_2706780_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013353068.1|2706838_2709481_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_013353069.1|2709931_2710123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353070.1|2710137_2711160_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013353071.1|2711193_2712717_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353072.1|2712849_2714139_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_088613212.1|2714167_2715142_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013353074.1|2715144_2715927_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013353075.1|2715916_2716858_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2716892_2717723_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_013353076.1|2717730_2719098_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013353077.1|2719294_2719786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353078.1|2719818_2720406_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013353079.1|2720402_2722727_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	8.8e-183
WP_013353080.1|2722925_2724584_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_014470784.1|2724734_2725997_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	2.5e-147
>prophage 14
NC_017190	Bacillus amyloliquefaciens LL3, complete sequence	3995227	3107519	3199343	3995227	capsid,terminase,coat,plate,protease,portal,integrase,head,holin,tail	Bacillus_phage(36.36%)	103	3142829:3142849	3180641:3180661
WP_014472214.1|3107519_3108536_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_013353454.1|3108689_3109190_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.0	5.7e-39
WP_013353455.1|3109216_3109987_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_013353456.1|3110020_3110455_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3110480_3110756_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3110974_3111871_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_013353457.1|3112073_3113051_+	L-Ala--D-Glu endopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_013353458.1|3113088_3113847_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_013353459.1|3113953_3115348_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013353460.1|3115365_3116187_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013353461.1|3116206_3117058_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_013353462.1|3117084_3117438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353463.1|3117511_3118876_-	allantoinase	NA	NA	NA	NA	NA
WP_013353464.1|3119056_3120652_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014472216.1|3120847_3121027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470983.1|3121059_3121368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353465.1|3121799_3122243_-	hypothetical protein	NA	A0A1U9WQP1	Geobacillus_phage	58.4	4.0e-28
WP_014472218.1|3123351_3124548_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_013353467.1|3124670_3125924_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_013353468.1|3125942_3127184_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_014472219.1|3127402_3128269_+	endonuclease	NA	NA	NA	NA	NA
WP_013353470.1|3128313_3129420_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.6	3.3e-18
WP_013353471.1|3129573_3130302_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_013353472.1|3130326_3131181_-	fructosamine kinase	NA	NA	NA	NA	NA
WP_013353473.1|3131194_3132079_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_041481667.1|3132082_3132961_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041481740.1|3132997_3134266_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013353476.1|3134339_3135326_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.2	7.7e-11
WP_013353477.1|3135523_3136450_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013353478.1|3136483_3137074_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_014470991.1|3137066_3138011_-	membrane protein	NA	NA	NA	NA	NA
WP_014470992.1|3138007_3138538_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_013353481.1|3138660_3138933_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_013353482.1|3138972_3139347_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_013353483.1|3139414_3140530_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013353485.1|3141345_3141810_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_013353486.1|3141944_3142781_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.0	3.4e-20
3142829:3142849	attL	GCCTTCCATTTCGAATTTGAT	NA	NA	NA	NA
WP_017418248.1|3143036_3143189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353487.1|3143221_3143584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353488.1|3143599_3144079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353489.1|3144242_3145256_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	95.3	5.4e-185
WP_014472221.1|3145304_3145727_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.1	1.0e-57
WP_013353491.1|3145777_3145966_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_013353492.1|3145962_3146325_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.1	5.1e-53
WP_014472222.1|3146321_3147458_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	74.1	1.7e-142
WP_013353494.1|3147470_3150035_-	peptidase G2	NA	D6R401	Bacillus_phage	57.6	2.4e-290
WP_013353495.1|3150067_3151786_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	69.4	2.5e-222
WP_014472224.1|3151798_3152635_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	3.0e-109
WP_014472225.1|3152649_3156396_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	63.8	5.7e-107
WP_014472226.1|3156456_3156639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472227.1|3156650_3157013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472228.1|3157070_3157649_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	39.9	7.4e-30
WP_014472229.1|3157668_3158061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472230.1|3158057_3158447_-	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	36.7	2.6e-10
WP_013353503.1|3158446_3158773_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014472232.1|3158762_3159056_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_014472233.1|3159106_3159556_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	62.0	1.6e-11
WP_014472234.1|3159583_3160780_-|capsid	phage major capsid protein	capsid	A0A2H4J312	uncultured_Caudovirales_phage	49.7	2.2e-76
WP_041915582.1|3160828_3161425_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	52.2	3.1e-47
WP_013353508.1|3161417_3162644_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	1.2e-66
WP_014472236.1|3162648_3162855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472237.1|3162871_3164578_-|terminase	terminase large subunit	terminase	A0A2H4JC16	uncultured_Caudovirales_phage	42.4	2.4e-121
WP_014472238.1|3164570_3165065_-|terminase	phage terminase small subunit P27 family	terminase	A0A1Q1PVW3	Staphylococcus_phage	35.5	2.6e-20
WP_013353512.1|3166149_3166530_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
WP_041915583.1|3166526_3167882_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.3	1.4e-180
WP_032864196.1|3167841_3168156_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	56.6	2.4e-19
WP_041915584.1|3168462_3170874_-	phage-like protein	NA	A0A0A7RTG3	Clostridium_phage	56.5	2.6e-278
WP_041915585.1|3170897_3171101_-	hypothetical protein	NA	O64114	Bacillus_phage	77.1	5.2e-15
WP_014472243.1|3171176_3171941_-	DNA cytosine methyltransferase	NA	A0A0K2CYZ1	Paenibacillus_phage	52.6	5.6e-70
WP_014472244.1|3172056_3174003_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	66.8	8.3e-251
WP_041915586.1|3173999_3174551_-	hypothetical protein	NA	Q38587	Bacillus_phage	64.0	3.1e-25
WP_014472245.1|3174611_3175187_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	76.4	2.2e-74
WP_014472246.1|3175217_3176396_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.1	1.2e-132
WP_014472247.1|3176392_3176788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017418276.1|3176800_3177202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041915587.1|3177392_3177662_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	45.3	1.1e-17
WP_041915588.1|3177658_3177847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014472250.1|3178048_3178234_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	70.5	3.1e-14
WP_014472251.1|3178503_3178935_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	59.0	4.5e-40
WP_014472252.1|3178943_3179366_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	61.6	4.7e-42
WP_014472253.1|3179408_3180566_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	68.1	6.8e-152
WP_003151878.1|3180628_3182026_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3180641:3180661	attR	GCCTTCCATTTCGAATTTGAT	NA	NA	NA	NA
WP_003151877.1|3182045_3182489_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_013353526.1|3182478_3183699_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.3	1.2e-117
WP_013353527.1|3183698_3185012_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|3185029_3185815_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.7	3.5e-06
WP_003151857.1|3185991_3186144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030652.1|3186336_3186723_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013353529.1|3186806_3187622_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_013353530.1|3187635_3188304_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013353531.1|3188296_3189322_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.7e-32
WP_013353532.1|3189644_3189995_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353533.1|3190092_3190413_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014470995.1|3190418_3190784_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_013353535.1|3190852_3191089_-	YusG family protein	NA	NA	NA	NA	NA
WP_013353536.1|3191143_3191527_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013353537.1|3191586_3191943_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	50.0	1.1e-20
WP_014472255.1|3192056_3193841_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013353539.1|3193859_3195035_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_013353540.1|3195045_3197415_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_013353541.1|3197605_3197746_+	YuzL family protein	NA	NA	NA	NA	NA
WP_013353543.1|3198741_3198999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353544.1|3199010_3199343_+|coat	spore coat protein	coat	NA	NA	NA	NA
