The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_008390	Burkholderia ambifaria AMMD chromosome 1, complete sequence	3556545	726163	735248	3556545		Hokovirus(16.67%)	7	NA	NA
WP_011656038.1|726163_728116_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.4	2.7e-148
WP_011656039.1|728369_729506_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	2.2e-22
WP_011656040.1|729510_731430_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.6	3.1e-56
WP_011656041.1|731581_732397_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.9e-37
WP_011656042.1|732439_733126_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	29.5	9.4e-08
WP_011656043.1|733122_733665_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_041491091.1|733700_735248_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.3	5.2e-22
>prophage 2
NC_008390	Burkholderia ambifaria AMMD chromosome 1, complete sequence	3556545	833079	843509	3556545		Enterobacteria_phage(50.0%)	8	NA	NA
WP_011656130.1|833079_834141_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.6	1.9e-87
WP_011656131.1|834152_835046_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.2	3.7e-97
WP_011656132.1|835030_835582_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	6.1e-50
WP_082089582.1|835500_836475_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.7	4.3e-22
WP_011656134.1|836692_838138_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.8	2.9e-51
WP_011656135.1|838207_838456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011656136.1|838455_839784_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011656137.1|839783_843509_+	glycosyltransferase	NA	Q684B1	Sulfolobus_virus	39.5	1.6e-05
>prophage 3
NC_008390	Burkholderia ambifaria AMMD chromosome 1, complete sequence	3556545	2024036	2105205	3556545	integrase,holin,capsid,plate,portal,head,protease,tail,terminase	uncultured_Caudovirales_phage(26.19%)	75	2023829:2023878	2070243:2070292
2023829:2023878	attL	CAACTTCCACATGACGATATGTCTGATCACTTCGTTCGCTCCAGTTCGTG	NA	NA	NA	NA
WP_011657092.1|2024036_2025281_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	40.0	2.0e-72
WP_011657093.1|2025494_2027015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657094.1|2027011_2028304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127456332.1|2028300_2029467_+	adenine methyltransferase	NA	NA	NA	NA	NA
WP_011657096.1|2029610_2030315_-	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	75.1	2.4e-107
WP_011657097.1|2030368_2030860_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	72.8	1.3e-67
WP_011657098.1|2031058_2031466_+	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	46.2	6.8e-14
WP_011657099.1|2031470_2031974_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	41.7	5.4e-21
WP_041491364.1|2032321_2032909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657102.1|2032914_2033649_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	40.1	4.1e-33
WP_011657103.1|2033688_2034477_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.5	4.7e-144
WP_082089628.1|2034646_2035141_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	40.4	4.1e-21
WP_041491193.1|2035137_2035632_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	87.2	1.7e-75
WP_011657106.1|2035634_2035919_-|holin	holin	holin	C7BGD7	Burkholderia_phage	94.7	2.3e-40
WP_011657107.1|2035997_2037047_-	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.3	6.1e-83
WP_011657108.1|2037056_2037263_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	1.2e-14
WP_011657109.1|2037237_2038116_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	3.6e-36
WP_011657110.1|2038127_2040572_-|tail	tail length determination protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.1	2.1e-57
WP_011657111.1|2040652_2040955_-|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	40.0	3.3e-05
WP_011657112.1|2041052_2041556_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	54.3	1.7e-43
WP_011657113.1|2041566_2042736_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.6	1.6e-156
WP_011657114.1|2042815_2043577_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	55.2	4.2e-57
WP_011657115.1|2043590_2045798_-|tail	tail fiber protein	tail	A4JWY0	Burkholderia_virus	36.1	9.3e-65
WP_011657116.1|2045785_2046364_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.7	3.0e-31
WP_011657117.1|2046353_2047250_-|plate	baseplate J protein	plate	S4TNY7	Salmonella_phage	40.4	3.9e-46
WP_041491366.1|2047246_2047564_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	48.5	1.5e-21
WP_011657119.1|2047581_2047782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127456331.1|2047872_2048709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657121.1|2048692_2049373_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	29.8	1.3e-17
WP_011657122.1|2049376_2049901_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	38.8	1.1e-24
WP_011657123.1|2049890_2050421_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.9	2.4e-11
WP_011657124.1|2050423_2050714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011657125.1|2050715_2051711_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.0	1.7e-114
WP_011657126.1|2051795_2052140_-|head	head decoration protein	head	NA	NA	NA	NA
WP_011657127.1|2052170_2053256_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	39.2	5.4e-50
WP_011657128.1|2053257_2054745_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.9	2.0e-135
WP_011657129.1|2054741_2054948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041491195.1|2054957_2057072_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.1	4.6e-178
WP_041491196.1|2057570_2057765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041491197.1|2058081_2058336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041491198.1|2058580_2059354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011657133.1|2059576_2062084_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.4	1.2e-95
WP_166488179.1|2062159_2062333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011657134.1|2062345_2062729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085963129.1|2062715_2063258_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	48.8	1.1e-30
WP_011657136.1|2063646_2064078_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	64.4	4.5e-16
WP_041491200.1|2064534_2064753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657137.1|2064802_2065165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657138.1|2065164_2066763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082089626.1|2067189_2067393_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	38.9	2.9e-05
WP_127456330.1|2067785_2068346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011657139.1|2068348_2069863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011657141.1|2070855_2071785_+	hypothetical protein	NA	NA	NA	NA	NA
2070243:2070292	attR	CAACTTCCACATGACGATATGTCTGATCACTTCGTTCGCTCCAGTTCGTG	NA	NA	NA	NA
WP_011657142.1|2072229_2072760_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_011657143.1|2073522_2075664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657144.1|2075809_2077210_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.0	4.9e-19
WP_011657145.1|2077507_2078686_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011657146.1|2078735_2079368_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	37.1	1.8e-21
WP_011657147.1|2079413_2081498_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011657148.1|2081680_2083324_-	fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.5	1.2e-21
WP_011657149.1|2083487_2085056_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.7	1.6e-55
WP_011657150.1|2085094_2085526_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006753406.1|2085650_2086181_+	septation protein A	NA	NA	NA	NA	NA
WP_011657151.1|2086182_2086491_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011657152.1|2086509_2087292_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011657153.1|2087525_2088068_-	N-acetyltransferase	NA	A9YX37	Burkholderia_phage	70.0	1.2e-05
WP_011657154.1|2088067_2092132_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	91.6	1.3e-221
WP_011657155.1|2092483_2093788_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011657156.1|2093841_2095386_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_012364074.1|2095497_2097120_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011657158.1|2097195_2097897_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.9	5.1e-33
WP_011657159.1|2097895_2098573_+	arylesterase	NA	NA	NA	NA	NA
WP_011657160.1|2098663_2100598_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011657161.1|2101312_2103736_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.2	1.7e-224
WP_006754177.1|2103933_2105205_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.5	2.1e-133
>prophage 4
NC_008390	Burkholderia ambifaria AMMD chromosome 1, complete sequence	3556545	2662039	2671168	3556545	integrase	Burkholderia_phage(28.57%)	11	2669770:2669785	2677824:2677839
WP_127456315.1|2662039_2663221_+	hypothetical protein	NA	Q6J1Q8	Burkholderia_virus	50.6	3.5e-26
WP_011657591.1|2663266_2664343_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011657592.1|2664751_2665318_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	29.5	7.8e-08
WP_011657593.1|2665554_2665815_+	hypothetical protein	NA	I6NSR8	Burkholderia_phage	63.9	1.0e-23
WP_011657594.1|2665973_2666234_+	hypothetical protein	NA	I6NSR8	Burkholderia_phage	59.0	4.3e-22
WP_158380531.1|2666508_2667381_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_081085431.1|2667374_2667665_+	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	43.9	3.2e-10
WP_082089617.1|2667727_2668006_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	36.4	1.6e-06
WP_011657596.1|2668313_2668868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011657597.1|2669121_2669646_+	hypothetical protein	NA	NA	NA	NA	NA
2669770:2669785	attL	ATGAATTCTGTCGGGG	NA	NA	NA	NA
WP_011657598.1|2669953_2671168_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	41.1	5.2e-86
WP_011657598.1|2669953_2671168_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	41.1	5.2e-86
2677824:2677839	attR	ATGAATTCTGTCGGGG	NA	NA	NA	NA
>prophage 1
NC_008391	Burkholderia ambifaria AMMD chromosome 2, complete sequence	2646969	179356	187943	2646969		Escherichia_phage(33.33%)	8	NA	NA
WP_011658412.1|179356_181282_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	31.7	2.8e-17
WP_011658413.1|181579_182596_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.2	8.9e-79
WP_011658414.1|182592_183477_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_011658415.1|183473_184055_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.3	7.1e-49
WP_011658416.1|184051_184948_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	56.8	1.2e-95
WP_011658417.1|185047_186445_-	MFS transporter	NA	NA	NA	NA	NA
WP_011658418.1|186441_187161_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.0e-12
WP_011658419.1|187157_187943_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	23.5	5.0e-05
