The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	415205	491635	2007018	terminase,capsid,tail,protease,plate,tRNA,head,integrase,portal	Mannheimia_phage(51.35%)	78	456320:456379	491636:491697
WP_006995391.1|415205_416924_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006995390.1|417008_418868_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	1.9e-87
WP_005655473.1|418869_419175_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_006995389.1|419435_420683_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005652269.1|420888_421515_+	response regulator	NA	NA	NA	NA	NA
WP_013527339.1|421605_422016_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_006995388.1|422019_422580_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_006995387.1|422693_422972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995386.1|423004_423178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996628.1|429183_429738_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_013527340.1|429913_430951_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.5	1.2e-33
WP_006995384.1|430940_431630_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005654466.1|431668_432490_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_005672324.1|432791_433559_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006995381.1|433588_434167_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_013527341.1|434193_434853_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_013527342.1|434855_437627_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	40.0	3.0e-20
WP_005661551.1|437821_438571_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.5	2.4e-17
WP_006995378.1|438800_440570_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_013527343.1|440642_442055_+	L-fuculokinase	NA	NA	NA	NA	NA
WP_005648572.1|442068_442503_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_006995376.1|442522_443173_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005668621.1|443211_444498_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_005654480.1|445025_445874_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	6.1e-33
WP_006995374.1|446011_447397_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_006995373.1|447535_448351_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005694542.1|448360_449164_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006995372.1|449180_450188_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006995371.1|450261_452793_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_006995370.1|453097_454309_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_006995369.1|454319_455606_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
456320:456379	attL	AAATGAAAGGTTTTTTATGGCAGGGGCGGAGAGGCTCGAACTCCCAACACCCGGTTTTGG	NA	NA	NA	NA
WP_005641196.1|456880_457891_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	62.1	3.5e-120
WP_041175147.1|457900_459676_-|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	65.4	1.9e-217
WP_006995363.1|460103_460748_+	phage repressor protein	NA	D0UIM5	Aggregatibacter_phage	35.0	5.3e-29
WP_006995362.1|460925_461741_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LNM2	Mannheimia_phage	60.7	1.2e-62
WP_006995361.1|461762_462812_+|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	51.6	4.4e-89
WP_013527346.1|462823_463474_+|terminase	terminase	terminase	Q19US0	Mannheimia_phage	45.5	9.1e-45
WP_006995358.1|463766_464273_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	51.0	1.3e-33
WP_005668467.1|464272_464482_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	40.6	4.5e-06
WP_006995357.1|464483_464705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005653059.1|464697_465216_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	46.6	9.5e-37
WP_006995356.1|465200_465551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995354.1|465725_465941_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	46.6	5.3e-10
WP_006995353.1|465937_466408_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	46.0	5.6e-28
WP_013527347.1|466407_466866_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	50.4	2.3e-26
WP_006995351.1|466843_467116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527348.1|467185_469921_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	36.1	1.8e-86
WP_006995349.1|469997_470165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995348.1|470142_470595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668437.1|470686_471286_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	66.0	7.1e-44
WP_005633786.1|471287_471626_+	GPW/gp25 family protein	NA	Q19UQ6	Mannheimia_phage	56.6	3.4e-19
WP_006995347.1|471622_472537_+|plate	baseplate J/gp47 family protein	plate	Q19UQ5	Mannheimia_phage	59.2	1.5e-93
WP_006995346.1|472526_473063_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	53.5	4.5e-50
WP_013527351.1|475319_475922_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.5	1.2e-94
WP_013525646.1|475918_476419_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	60.4	8.5e-51
WP_041175148.1|476594_476714_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013527352.1|476770_477616_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	73.2	5.0e-120
WP_006995341.1|478060_479245_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1S6KZY7	Salmonella_phage	48.7	6.0e-103
WP_006995340.1|479248_479755_+|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	59.5	7.1e-53
WP_005655095.1|479823_480123_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	40.7	4.4e-10
WP_006995339.1|480122_480269_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	65.0	2.2e-07
WP_006995337.1|480436_480598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006995336.1|480597_481035_+|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	56.7	1.0e-39
WP_013527353.1|481034_482228_+	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	51.0	1.5e-101
WP_005668419.1|482253_482493_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006995333.1|482503_483673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995332.1|483682_484372_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	34.9	1.0e-30
WP_013527354.1|484491_484740_+	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	49.1	1.4e-06
WP_005655063.1|485504_485747_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	68.1	1.2e-21
WP_041175149.1|485837_486101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005689773.1|486118_486499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668404.1|486502_486745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005655052.1|486870_487179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527356.1|487188_489330_+	replication endonuclease	NA	Q94N00	Haemophilus_virus	42.5	1.5e-165
WP_005668397.1|489393_489585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005668395.1|489595_489805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527357.1|489818_490340_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	41.8	1.6e-28
WP_013527358.1|490579_491635_+|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	36.2	2.2e-56
491636:491697	attR	AAATGAAAGGTTTTTTATGGCAGGGGCGGAGAGGCTCGAACTCCCAACACCCGGTTTTGGAG	NA	NA	NA	NA
>prophage 2
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	832217	841097	2007018		Mannheimia_phage(28.57%)	13	NA	NA
WP_005651292.1|832217_832634_-	hypothetical protein	NA	E5E463	Acinetobacter_phage	65.2	1.3e-07
WP_013525621.1|833962_834322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525620.1|834318_834555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525619.1|834551_835121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158305132.1|835131_835275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527462.1|835399_836503_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	61.9	7.5e-07
WP_005668705.1|836564_836999_-	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	7.5e-19
WP_013525616.1|836998_837649_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	71.6	1.2e-84
WP_013525615.1|837623_838574_-	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	68.3	1.0e-108
WP_041174891.1|838586_838880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013525614.1|838876_839224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527463.1|839237_839975_-	site-specific DNA-methyltransferase	NA	A0A0E3U2R2	Fusobacterium_phage	77.5	3.1e-113
WP_013525612.1|840065_841097_-	HNH endonuclease	NA	D0UIK6	Aggregatibacter_phage	82.8	5.2e-42
>prophage 3
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	844429	882458	2007018	terminase,capsid,tail,plate,tRNA	Pseudomonas_phage(15.15%)	52	NA	NA
WP_013525608.1|844429_845017_-	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	48.5	1.7e-37
WP_005651114.1|845109_845526_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	84.7	1.1e-62
WP_005633909.1|845562_845787_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013527465.1|845783_846425_-	replication P	NA	NA	NA	NA	NA
WP_013525606.1|846409_847192_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	45.1	4.3e-41
WP_013525605.1|847193_847427_-	helix-turn-helix domain-containing protein	NA	A0A0M3LR73	Mannheimia_phage	60.3	2.3e-14
WP_005651123.1|847472_847925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006995067.1|847968_848175_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	48.3	8.7e-10
WP_013527466.1|848308_849277_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	30.5	9.2e-17
WP_171034551.1|849527_849689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525603.1|849699_850026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525602.1|850012_850417_+	M15 family metallopeptidase	NA	W0LI70	Edwardsiella_phage	68.7	3.9e-46
WP_013527467.1|850413_850803_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_013525600.1|850777_851008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054986.1|851019_852375_+	ParB N-terminal domain-containing protein	NA	A0A0E3U266	Fusobacterium_phage	44.8	1.8e-98
WP_005692583.1|852371_852593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005651145.1|852650_853019_+	LuxR family transcriptional regulator	NA	A0A0R6PHW5	Moraxella_phage	39.3	3.4e-12
WP_013525599.1|852999_854349_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	58.2	5.5e-145
WP_013525598.1|854350_855667_+	DUF1073 domain-containing protein	NA	A0A2K9V3H1	Faecalibacterium_phage	32.0	1.8e-47
WP_041174890.1|855647_856865_+|capsid	minor capsid protein	capsid	A0A2D2W1Z9	Sinorhizobium_phage	38.0	2.6e-24
WP_005692574.1|856990_858064_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.2	1.2e-54
WP_013525596.1|858076_858496_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013525595.1|858503_859505_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	36.2	2.9e-50
WP_005692571.1|859507_859696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525594.1|859699_860050_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_013525593.1|860042_860501_+	hypothetical protein	NA	A0A2I7R754	Vibrio_phage	34.5	4.1e-15
WP_013525592.1|860500_860860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527469.1|860861_861371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525590.1|861357_862431_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	41.0	4.8e-59
WP_005643344.1|862476_862902_+	DUF3277 family protein	NA	A0A0A1IUI2	Pseudomonas_phage	36.9	2.6e-16
WP_013525589.1|862901_863384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005643340.1|863419_863572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013525588.1|863568_865986_+	tape measure protein	NA	H9EB42	Vibrio_phage	28.0	1.6e-33
WP_013527470.1|866060_866783_-	hypothetical protein	NA	A6XMM0	Bacillus_virus	46.4	5.8e-24
WP_005688900.1|866944_867526_+	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	27.7	5.7e-06
WP_005643334.1|867522_867837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005692555.1|867833_868796_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	29.9	5.9e-32
WP_005692552.1|868792_869464_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	33.5	9.8e-18
WP_005651178.1|869460_869826_+	hypothetical protein	NA	A0A1J0MEY0	Pectobacterium_phage	34.5	1.8e-10
WP_005651180.1|869818_871255_+|plate	baseplate J/gp47 family protein	plate	A0A0N9SH53	Pseudomonas_phage	28.4	4.8e-46
WP_012054979.1|871263_871878_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	37.4	1.0e-21
WP_013527471.1|871887_874257_+|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	59.8	6.4e-213
WP_013525580.1|874268_874871_+	hypothetical protein	NA	Q94MX9	Haemophilus_virus	94.5	5.0e-98
WP_013525579.1|874867_875326_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	55.8	4.9e-45
WP_005691741.1|875973_876699_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_005662648.1|876751_877204_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005656383.1|877271_878486_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.5	1.5e-32
WP_013527472.1|878545_878929_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	80.6	1.4e-53
WP_013527473.1|878982_879306_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	3.4e-24
WP_013527474.1|879318_879843_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005649159.1|879893_880580_+	DUF2625 domain-containing protein	NA	NA	NA	NA	NA
WP_013527475.1|880598_882458_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.3	4.0e-109
>prophage 4
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	1379296	1411835	2007018	holin	Mannheimia_phage(40.91%)	38	NA	NA
WP_005652248.1|1379296_1379476_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_013527619.1|1379535_1379970_-	single-stranded DNA-binding protein	NA	A0A059WRL7	Vibrio_phage	36.2	1.3e-18
WP_041175171.1|1379969_1380620_-	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	70.2	3.8e-83
WP_011272494.1|1380594_1381515_-	recombinase RecT	NA	A0A0M3LNU3	Mannheimia_phage	71.5	4.8e-116
WP_041175172.1|1381527_1381821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527621.1|1381817_1382162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527622.1|1382212_1383238_-	HNH endonuclease	NA	A0A0M3LQ72	Mannheimia_phage	47.0	1.7e-24
WP_005688811.1|1383227_1383479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005687157.1|1383660_1383927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083304313.1|1383912_1384206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041175173.1|1384478_1384700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085024748.1|1384714_1384885_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_013527624.1|1385238_1385658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527625.1|1385647_1386121_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_013527626.1|1386132_1386387_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	41.7	1.4e-09
WP_013527627.1|1386544_1387204_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	43.0	1.3e-38
WP_041175174.1|1387308_1387491_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	60.0	4.1e-11
WP_013527628.1|1387545_1387986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527629.1|1388034_1388709_+	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	67.9	3.4e-79
WP_013527630.1|1388705_1389452_+	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	66.0	2.3e-68
WP_013527631.1|1389448_1390096_+	replication P	NA	D0UIL4	Aggregatibacter_phage	47.6	7.0e-37
WP_013527632.1|1390092_1390674_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	56.0	2.2e-50
WP_013527633.1|1390670_1391594_+	N-6 DNA methylase	NA	A0A0M3LQ47	Mannheimia_phage	58.2	1.0e-97
WP_013527634.1|1391594_1392020_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	75.9	2.8e-58
WP_041175226.1|1392592_1392883_+	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	88.0	7.6e-44
WP_013527636.1|1392879_1393245_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	61.7	1.7e-40
WP_013527637.1|1393237_1393963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527638.1|1394047_1394743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175175.1|1395106_1395976_+	antirepressor	NA	D0UIK6	Aggregatibacter_phage	68.3	7.0e-109
WP_005643389.1|1396156_1396330_+	hypothetical protein	NA	D0UIH9	Aggregatibacter_phage	53.7	8.9e-08
WP_005650535.1|1396523_1396880_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_013527639.1|1396848_1397451_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.4	2.3e-58
WP_041175176.1|1397443_1397767_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_080474426.1|1397672_1397954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527640.1|1398041_1398794_+	hypothetical protein	NA	A0A2R2Z334	Escherichia_phage	25.4	4.8e-13
WP_041175177.1|1398783_1400331_+	hypothetical protein	NA	A0A1B1IVN4	uncultured_Mediterranean_phage	42.9	1.3e-97
WP_114892208.1|1400453_1402529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013527643.1|1402586_1411835_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	29.8	5.7e-31
>prophage 5
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	1616944	1682542	2007018	terminase,plate,tail,holin	Haemophilus_phage(40.74%)	81	NA	NA
WP_013527718.1|1616944_1617823_+|holin	choline transport protein LicB	holin	NA	NA	NA	NA
WP_012054405.1|1617819_1618521_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_013527719.1|1618520_1619318_+	LicD family protein	NA	A0A1V0SD50	Indivirus	35.5	9.3e-07
WP_013527720.1|1619355_1621203_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_013527721.1|1621300_1621855_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_013527722.1|1621901_1622456_-	molecular chaperone	NA	NA	NA	NA	NA
WP_013527723.1|1622448_1623063_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013527724.1|1623183_1624428_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_005656849.1|1624712_1625153_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_165590136.1|1625222_1626290_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.0	4.5e-81
WP_013527725.1|1626528_1627779_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_013527726.1|1627778_1628462_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.1	7.4e-37
WP_013527727.1|1628543_1629185_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_013527728.1|1629194_1629977_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_006996100.1|1629964_1630612_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_005688496.1|1630621_1631764_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_013527729.1|1631772_1633062_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	7.7e-19
WP_013527730.1|1633076_1634243_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013527731.1|1634242_1635190_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	28.1	5.8e-24
WP_013527732.1|1635249_1636104_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.9	1.7e-46
WP_006996106.1|1636118_1636922_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006996107.1|1636921_1637800_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013527733.1|1637799_1638240_-	RDD family protein	NA	NA	NA	NA	NA
WP_032826329.1|1638292_1639375_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.2	1.3e-08
WP_013527734.1|1639653_1640421_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_006996114.1|1640619_1641156_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_032826285.1|1641222_1641351_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013527735.1|1641655_1642636_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_013527718.1|1642635_1643514_+|holin	choline transport protein LicB	holin	NA	NA	NA	NA
WP_012054405.1|1643510_1644212_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_013527736.1|1644211_1645009_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	46.7	1.0e-05
WP_013527737.1|1645383_1645800_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	71.0	1.9e-51
WP_013527738.1|1645942_1646659_-	hypothetical protein	NA	A0A0M3LSH7	Mannheimia_phage	57.7	6.9e-70
WP_011961987.1|1646670_1646904_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	68.9	2.1e-20
WP_006996123.1|1646903_1647374_+	hypothetical protein	NA	Q94N00	Haemophilus_virus	39.0	6.6e-21
WP_006996122.1|1647428_1647587_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	81.4	3.4e-14
WP_013527740.1|1649094_1649586_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	62.3	9.9e-52
WP_005661624.1|1649582_1650185_-	hypothetical protein	NA	Q94MX9	Haemophilus_virus	91.0	2.6e-94
WP_013527741.1|1650196_1652440_-|tail	tail fiber protein	tail	Q94MY0	Haemophilus_virus	65.5	2.3e-220
WP_006996360.1|1652449_1653025_-	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	80.1	2.4e-89
WP_006996361.1|1653024_1654167_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	86.3	6.7e-184
WP_006996362.1|1654262_1654616_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	89.6	2.5e-57
WP_006996363.1|1654612_1655257_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	85.0	1.8e-85
WP_006996364.1|1655253_1656138_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	89.5	1.9e-141
WP_013527742.1|1656392_1656701_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	82.4	7.8e-47
WP_006996366.1|1656706_1657489_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	65.5	1.0e-82
WP_006996369.1|1659733_1660144_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	70.8	5.9e-50
WP_006996370.1|1660143_1660575_-	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	93.0	2.9e-71
WP_006996371.1|1660584_1660743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996372.1|1660819_1662328_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	86.9	4.6e-249
WP_013525927.1|1662332_1662695_-	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	73.9	6.6e-45
WP_006996374.1|1662759_1663131_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	70.7	6.8e-45
WP_006996375.1|1663127_1663574_-	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	72.3	6.7e-55
WP_006996376.1|1663574_1663937_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	67.3	1.5e-33
WP_006996377.1|1663946_1664861_-	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	89.5	1.7e-150
WP_006996378.1|1664870_1665311_-	hypothetical protein	NA	D0UIJ1	Aggregatibacter_phage	71.1	2.3e-47
WP_006996379.1|1665323_1666424_-	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	87.0	4.4e-140
WP_006996380.1|1666489_1666846_-	DUF2513 domain-containing protein	NA	A0A1W6JNL0	Staphylococcus_phage	31.7	7.8e-06
WP_006996384.1|1669919_1671263_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	53.7	3.1e-124
WP_005693952.1|1671249_1671765_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	40.9	5.6e-21
WP_006996385.1|1671841_1672093_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	50.6	6.4e-15
WP_006996386.1|1672076_1672424_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	56.1	4.4e-22
WP_013527746.1|1672425_1672707_-	hypothetical protein	NA	Q776X1	Haemophilus_phage	74.4	2.5e-31
WP_006996388.1|1672618_1672942_-	DUF2570 family protein	NA	Q7Y5U9	Haemophilus_phage	56.5	4.5e-21
WP_006996389.1|1672934_1673537_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	53.9	5.6e-57
WP_005650535.1|1673505_1673862_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_006996390.1|1674077_1674947_-	phage repressor protein/antirepressor Ant	NA	D0UIK6	Aggregatibacter_phage	66.9	4.6e-108
WP_005687174.1|1675544_1675727_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	45.5	1.2e-05
WP_006996391.1|1675771_1676221_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	38.3	1.8e-23
WP_005653907.1|1676252_1676435_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_006996392.1|1676535_1676904_-	hypothetical protein	NA	Q7Y5V5	Haemophilus_phage	63.4	6.1e-38
WP_006996393.1|1676905_1677454_-	recombination protein NinG	NA	D0UIK8	Aggregatibacter_phage	62.6	1.8e-57
WP_005656663.1|1677542_1677962_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	76.1	5.1e-57
WP_005633909.1|1677998_1678223_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	47.9	1.1e-10
WP_013527748.1|1678219_1678855_-	replication P	NA	NA	NA	NA	NA
WP_013527749.1|1678839_1679556_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	62.0	2.4e-62
WP_006996396.1|1679552_1680221_-	phage antirepressor KilAC domain-containing protein	NA	D0UIL6	Aggregatibacter_phage	52.1	2.0e-55
WP_006996397.1|1680268_1680565_-	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	69.4	3.8e-30
WP_005687166.1|1680585_1680792_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	67.7	1.9e-17
WP_006996398.1|1680922_1681579_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	57.9	1.6e-65
WP_005692469.1|1681696_1682542_+	DNA damage-inducible protein DnaD	NA	F5A3D6	Riemerella_phage	41.9	9.4e-50
>prophage 6
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	1686007	1692711	2007018		Aggregatibacter_phage(50.0%)	10	NA	NA
WP_041175197.1|1686007_1686859_+	ORF6C domain-containing protein	NA	D0UIK6	Aggregatibacter_phage	42.5	1.2e-55
WP_041175198.1|1687063_1687708_+	translocation protein TolB precursor	NA	A0A0M3LP90	Mannheimia_phage	71.4	1.5e-84
WP_013525952.1|1687707_1688142_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	35.1	1.3e-18
WP_005652248.1|1688201_1688381_-	hypothetical protein	NA	Q19US2	Mannheimia_phage	62.1	1.8e-11
WP_041174939.1|1688701_1688938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175199.1|1688934_1689285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005684834.1|1689428_1689869_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	65.8	1.9e-49
WP_006996405.1|1689855_1690209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006996406.1|1690412_1690586_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_013527750.1|1691856_1692711_+	ORF6C domain-containing protein	NA	D0UIK6	Aggregatibacter_phage	42.4	2.6e-55
>prophage 7
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	1803717	1812231	2007018		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_006996495.1|1803717_1804401_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	6.6e-54
WP_005663812.1|1804393_1804819_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	42.7	1.3e-20
WP_086935178.1|1804819_1805455_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	35.2	3.8e-11
WP_041175009.1|1806069_1808250_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	8.7e-116
WP_006996497.1|1808339_1809341_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013527806.1|1809355_1810243_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013527807.1|1810252_1811245_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	3.6e-16
WP_013527808.1|1811247_1812231_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	3.2e-17
>prophage 8
NC_014922	Haemophilus influenzae F3047, complete genome	2007018	1953338	1971643	2007018	terminase,capsid,protease,head,transposase	Haemophilus_phage(66.67%)	31	NA	NA
WP_013527853.1|1953338_1953770_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	61.6	7.1e-38
WP_013527854.1|1953779_1954085_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	51.0	1.1e-19
WP_013527855.1|1954147_1955071_-|head	Mu-like prophage major head subunit gpT family protein	head	B7SDP1	Haemophilus_phage	74.3	7.4e-133
WP_086935179.1|1955070_1955877_-|protease	phage protease	protease	B7SDN9	Haemophilus_phage	43.1	1.1e-44
WP_013526157.1|1955764_1956118_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	67.9	3.1e-23
WP_013527857.1|1956260_1957577_-|capsid	minor capsid protein	capsid	A0A0M3LSH7	Mannheimia_phage	67.7	1.6e-168
WP_013527858.1|1957560_1959183_-	DUF935 domain-containing protein	NA	B7SDN1	Haemophilus_phage	68.0	2.9e-201
WP_013527859.1|1959262_1960903_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	78.5	9.1e-251
WP_173341730.1|1960892_1961036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527860.1|1961032_1961536_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	51.8	4.1e-45
WP_006995441.1|1961537_1961804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005684166.1|1961803_1962061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527861.1|1962184_1962442_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_041174960.1|1962441_1962732_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	61.4	3.3e-15
WP_171034543.1|1962728_1962896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527862.1|1962885_1963389_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	64.4	5.8e-55
WP_006995448.1|1963470_1963899_-	hypothetical protein	NA	F6MIJ8	Haemophilus_phage	42.3	3.3e-27
WP_005641522.1|1964004_1964223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527863.1|1964233_1964875_-	antA/AntB antirepressor family protein	NA	A0A059T6E7	Listeria_phage	43.2	2.5e-10
WP_006996626.1|1965347_1965551_-	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_006996625.1|1965577_1965976_-	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	42.9	3.4e-18
WP_006996624.1|1966216_1966465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996623.1|1966469_1966643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996622.1|1966639_1966804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006996621.1|1966814_1967012_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013526168.1|1967198_1967816_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	58.8	6.8e-66
WP_005647090.1|1967816_1968008_-	HTH domain-containing protein	NA	F6MII8	Haemophilus_phage	57.6	9.5e-11
WP_013527864.1|1968016_1968313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527865.1|1968324_1969206_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	60.4	6.7e-91
WP_006996357.1|1969257_1969674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013527866.1|1969666_1971643_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A0M3LPN5	Mannheimia_phage	53.0	3.4e-191
