The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	234174	299575	3859257	transposase,protease	Mycobacterium_phage(25.0%)	52	NA	NA
WP_102598715.1|234174_235652_-|transposase	IS3-like element ISAar44 family transposase	transposase	NA	NA	NA	NA
WP_076611951.1|236584_237794_+|transposase	IS3-like element ISAar37 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	6.7e-33
WP_013347620.1|238985_239363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013347621.1|239477_239909_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_049862530.1|239879_240506_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_013347622.1|240508_241813_-	MFS transporter	NA	NA	NA	NA	NA
WP_081461065.1|241940_242117_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013347623.1|242255_243563_+|transposase	ISL3-like element ISAar23 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	61.5	8.5e-151
WP_081461066.1|243499_243676_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013347624.1|243729_245412_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_013347625.1|247408_248386_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_013347626.1|248382_249159_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_013347627.1|249526_250525_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013347628.1|250546_251188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013347629.1|251278_251899_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041648296.1|252130_252400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146041009.1|252686_252884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013347623.1|253765_255073_-|transposase	ISL3-like element ISAar23 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	61.5	8.5e-151
WP_041648300.1|255192_255918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013347632.1|256981_257416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013347633.1|257495_257723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013347634.1|258308_258803_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_013347635.1|258802_260176_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	25.6	3.1e-10
WP_013347636.1|260497_261058_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013347637.1|261178_261676_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013347638.1|261672_262299_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	32.1	2.6e-12
WP_013347639.1|262396_264577_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_013347640.1|264679_265108_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_157867201.1|265843_267661_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.4	9.4e-23
WP_081461068.1|267726_269802_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	34.9	8.4e-68
WP_013347643.1|269752_270580_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	24.0	1.0e-16
WP_013347644.1|270586_271609_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013347645.1|271694_272516_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	7.0e-26
WP_013347646.1|272996_274328_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013347647.1|274381_275785_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013347648.1|275861_277685_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_013347649.1|277899_278763_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_013347650.1|279256_280276_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	2.9e-29
WP_013347651.1|280272_280968_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013347652.1|280997_281909_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041648309.1|282418_284050_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013347654.1|284061_285018_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013347655.1|285032_285920_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013347656.1|285948_287571_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	1.6e-21
WP_013347657.1|287609_288851_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013347658.1|288853_290272_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_013347659.1|291017_294218_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_041648316.1|294330_295839_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_065763541.1|295981_296908_+	class C sortase	NA	NA	NA	NA	NA
WP_013347662.1|296955_297372_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_013347663.1|297376_297700_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013347665.1|298138_299575_+|transposase	IS1380-like element ISAar8 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	40.2	4.6e-81
>prophage 2
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	766061	807022	3859257	transposase,holin,tRNA	Synechococcus_phage(20.0%)	35	NA	NA
WP_013348066.1|766061_767339_-|transposase	ISL3-like element ISAar15 family transposase	transposase	NA	NA	NA	NA
WP_013348067.1|767419_768499_-|transposase	IS110-like element ISAar16 family transposase	transposase	NA	NA	NA	NA
WP_013348068.1|768890_769151_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_041648446.1|769231_769780_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_013348070.1|769766_770807_-	methionine synthase	NA	NA	NA	NA	NA
WP_013348071.1|770825_771818_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_013348073.1|773294_774608_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_013348074.1|774604_775828_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_041649335.1|776415_776934_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_013348076.1|777082_777448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348077.1|777450_778293_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.7	1.1e-10
WP_013348078.1|779556_780420_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_013348079.1|780558_781944_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.0	4.3e-44
WP_013348080.1|782071_782971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013348081.1|783003_783360_+	VOC family protein	NA	NA	NA	NA	NA
WP_013348082.1|783307_783970_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013348083.1|783966_785130_-	signal transduction histidine kinase	NA	NA	NA	NA	NA
WP_157867084.1|785248_786022_+	GAP family protein	NA	NA	NA	NA	NA
WP_013348085.1|786091_786589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348086.1|786691_787531_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_013348087.1|787539_788556_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013348088.1|788555_789068_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_013348089.1|789113_790568_-	catalase	NA	A0A2K9L572	Tupanvirus	42.5	2.0e-87
WP_013348066.1|791661_792939_-|transposase	ISL3-like element ISAar15 family transposase	transposase	NA	NA	NA	NA
WP_013348067.1|793019_794099_-|transposase	IS110-like element ISAar16 family transposase	transposase	NA	NA	NA	NA
WP_041648459.1|794638_795628_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_013347368.1|795610_796918_-|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_157867085.1|797248_798226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041648465.1|798550_799813_+	MFS transporter	NA	NA	NA	NA	NA
WP_013348091.1|799878_800661_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_013348092.1|800660_802448_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_013348093.1|802505_802949_-	succinate dehydrogenase hydrophobic membrane anchor subunit	NA	NA	NA	NA	NA
WP_102598273.1|802952_803366_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_013348095.1|803612_804728_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_013348096.1|804877_807022_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.4	1.6e-16
>prophage 3
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	849700	911127	3859257	transposase,integrase	Mycobacterium_phage(25.0%)	49	849009:849068	895341:896032
849009:849068	attL	ATCCCTCTCGGTCAGGCTGTAAGTGAGTCAACCACGACCCACCACTGACCAGAAGGAACC	NA	NA	NA	NA
WP_157867086.1|849700_850504_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013348133.1|850570_851245_-	DUF4245 domain-containing protein	NA	NA	NA	NA	NA
WP_013348134.1|851401_852436_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_162094117.1|852540_853740_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_102598434.1|853816_855250_-	LCP family protein	NA	NA	NA	NA	NA
WP_013348137.1|855441_855972_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.6	7.7e-18
WP_081461089.1|856045_857206_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_013348139.1|857382_857952_+	GtrA family protein	NA	NA	NA	NA	NA
WP_013348140.1|857948_858677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028268477.1|859236_859500_+	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	67.5	2.1e-24
WP_081461090.1|859445_862970_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013348143.1|862969_865567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162094118.1|865632_866523_+	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_013348145.1|866535_866994_-	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_102598433.1|867094_867487_+	DUF3499 domain-containing protein	NA	NA	NA	NA	NA
WP_013348148.1|867697_869299_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_013348149.1|869368_871210_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.0	8.6e-48
WP_013348150.1|871288_872899_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_013348151.1|872967_873828_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_013348152.1|873966_875454_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013348153.1|875522_877940_-	transglutaminase	NA	NA	NA	NA	NA
WP_013348154.1|877929_879255_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_013348155.1|879265_880228_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_081461092.1|880247_881393_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_157867211.1|881750_882815_+	transglycosylase family protein	NA	A0A1I9SA30	Rhodococcus_phage	54.3	4.8e-19
WP_041648488.1|882915_883800_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_013348159.1|883802_884735_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_013348160.1|884889_886260_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049862712.1|886481_886988_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013348163.1|886974_887253_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_157867212.1|887362_889156_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.1	3.0e-45
WP_041648491.1|889551_891009_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_013348166.1|891081_892062_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.2	4.0e-44
WP_157867087.1|892187_892538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348167.1|892819_893566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867086.1|893904_894708_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_013348132.1|894920_895337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013347368.1|895597_896905_+|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
895341:896032	attR	GGTTCCTTCTGGTCAGTGGTGGGTCGTGGTTGACTCACTTACAGCCTGACCGAGAGGGATGGCTGCAAGAACATCACGAAACTACCTGCTGCTCCTGCGAAAGTCAGCAGGAGTCCTATTGTGGCTCTTCAGGAATAAGAGTGTAACCACCTGAAACCAACACCCCGATTCCCGGGCATGTCGCCGAGCACGAAAAAGTCGAGGTCTTCCAGAAGAATGGAAGTTACTACACTAGCCATTTTCGAAAGACCTCGACGTTGCTCAATCCTACCTTCACCGCACCAGACCTCACCACTTTCACCAATCTTGACGGCTTGGGACTGACCGCAATCGGGCAACACCTGAGCGCAGCGAAAGCCGAAATCCTCTGCCACGTCACCAACCCGATCCCTTGGTGCCAAACCTGCGGAGCAGCAGGCATTCCACGCGATACCGTCACTCGCCGCCTCGCCCACGAACCATTGGGCTGGCGTCCCACTGTCCTAGTCATCAAACACCGCCGCTACCGTTGCGCCAATTGCCAACGAGTCTGGCGTGAAGAGCTGTCCCAAGCAGTAGCGCCACGCCAGAAAATCAGCAGGACCGGGCTACGCTGGGCGCTGGTTGGACTGGTCTGCCACCACTTGTCAGTCTCCCGAATTGCCGAAGGCCTCGGCGTCACCTGGAATACCGCCAATGAGGCTGTGCTGGCT	NA	NA	NA	NA
WP_013348168.1|897228_900018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157867088.1|900014_900677_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.1	1.2e-15
WP_013348170.1|901048_901534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157867089.1|902167_903314_+|transposase	IS3-like element ISAar3 family transposase	transposase	NA	NA	NA	NA
WP_013348173.1|903908_904241_-	hypothetical protein	NA	A0A220NQR3	Corynebacterium_phage	54.7	8.3e-10
WP_013348174.1|904237_904969_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.8	4.5e-32
WP_013348175.1|904965_906429_-|transposase	IS21-like element ISAar7 family transposase	transposase	NA	NA	NA	NA
WP_157867090.1|906710_906962_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	43.9	5.5e-06
WP_013348176.1|907396_908152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348177.1|908234_909416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348178.1|909819_911127_-|transposase	ISL3-like element ISAar20 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	62.0	1.3e-151
>prophage 4
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	1436290	1499548	3859257	transposase,protease	Mycobacterium_phage(36.36%)	53	NA	NA
WP_013348643.1|1436290_1436575_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_013348644.1|1436577_1437156_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_049862592.1|1437142_1438084_+	glutamate racemase	NA	NA	NA	NA	NA
WP_013348646.1|1438080_1439022_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_134780461.1|1439217_1439592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348647.1|1439681_1440416_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_013348648.1|1440412_1441045_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_013348649.1|1441125_1442031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348650.1|1442624_1442984_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013348651.1|1443013_1443931_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-14
WP_013348652.1|1443927_1444623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348653.1|1444813_1445311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348654.1|1445524_1446526_+	exonuclease	NA	A0A1S5SEW3	Streptococcus_phage	29.7	3.5e-27
WP_013348655.1|1446606_1447542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348656.1|1447593_1448760_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_013348657.1|1448756_1451828_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_102597894.1|1451988_1453215_+	MFS transporter	NA	NA	NA	NA	NA
WP_013348659.1|1453320_1454016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013348660.1|1454279_1455620_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.8	9.0e-47
WP_013348661.1|1456545_1457043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348662.1|1457062_1457314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348663.1|1457506_1458514_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041648632.1|1458627_1460316_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_013348665.1|1460582_1461851_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013348666.1|1461967_1463563_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013348667.1|1463562_1464477_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013348668.1|1464578_1465568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348669.1|1465623_1466379_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013348670.1|1466479_1468036_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.3	9.2e-35
WP_013348671.1|1468079_1468496_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_013348672.1|1468518_1469619_-	acyl-CoA desaturase	NA	A6N231	Microbacterium_phage	54.9	7.3e-103
WP_013348673.1|1469746_1471387_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.4	1.8e-33
WP_013348674.1|1471470_1471836_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081461114.1|1471862_1472378_+	MFS transporter	NA	NA	NA	NA	NA
WP_013347743.1|1472329_1473607_-|transposase	ISL3-like element ISAar13 family transposase	transposase	A0A2R2ZGN7	Clostridioides_phage	24.0	4.2e-17
WP_049862594.1|1473721_1474510_+	MFS transporter	NA	NA	NA	NA	NA
WP_013348675.1|1474554_1475217_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_157867113.1|1475909_1476461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041649587.1|1476667_1477765_-	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_013348677.1|1477828_1479322_-	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013348678.1|1479396_1480056_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049862595.1|1480055_1481582_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013348680.1|1481932_1483168_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013348681.1|1483164_1483872_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	3.3e-32
WP_041648644.1|1483861_1484815_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_013347368.1|1484868_1486176_-|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_013348683.1|1487061_1488360_+|transposase	IS1380-like element ISAar10 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	38.6	1.0e-71
WP_049862596.1|1488565_1489150_+	cell wall-binding repeat-containing protein	NA	NA	NA	NA	NA
WP_049862597.1|1489192_1492672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867114.1|1492793_1494641_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013348684.1|1494771_1496217_+|transposase	IS481-like element ISAar22 family transposase	transposase	NA	NA	NA	NA
WP_013348685.1|1496479_1497772_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_013348686.1|1498111_1499548_+|transposase	IS1380-like element ISAar9 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	39.1	4.8e-78
>prophage 5
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	1524301	1583089	3859257	transposase	Streptococcus_phage(28.57%)	44	NA	NA
WP_013348709.1|1524301_1525747_+|transposase	IS481-like element ISAar22 family transposase	transposase	NA	NA	NA	NA
WP_013348710.1|1526693_1526972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348711.1|1527041_1528529_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_013348712.1|1528607_1530452_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013348713.1|1530603_1531536_-	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	25.5	2.4e-06
WP_013348714.1|1532430_1532922_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013348715.1|1533216_1533777_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013348716.1|1533801_1535265_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013348717.1|1535261_1536092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348718.1|1536207_1536693_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157867115.1|1536705_1537809_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_013348720.1|1537814_1538759_+	squalene/phytoene synthase family protein	NA	NA	NA	NA	NA
WP_013348721.1|1538755_1540348_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_013348722.1|1540344_1540707_+	lycopene cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_157867225.1|1540708_1541053_+	lycopene cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_013348724.1|1541049_1541913_+	prenyltransferase	NA	NA	NA	NA	NA
WP_013348725.1|1541939_1542455_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_013348726.1|1542615_1543077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348727.1|1543245_1544316_+|transposase	IS1595-like element ISAar1 family transposase	transposase	NA	NA	NA	NA
WP_041648652.1|1544885_1546769_+	acetolactate synthase large subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	30.1	3.9e-56
WP_013348729.1|1546772_1547291_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_013348730.1|1547415_1548447_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_041649615.1|1548636_1549245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348732.1|1549492_1550194_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	28.4	6.2e-15
WP_157867116.1|1550867_1553306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348734.1|1553302_1555969_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013348736.1|1556575_1557883_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	62.2	7.7e-152
WP_041648661.1|1558383_1558656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013347368.1|1558627_1559935_-|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_157867117.1|1560185_1560929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013348737.1|1561046_1562405_+	sugar transferase	NA	NA	NA	NA	NA
WP_013348738.1|1562948_1564556_+	carbohydrate binding domain-containing protein	NA	NA	NA	NA	NA
WP_013348739.1|1564631_1565600_-	sulfotransferase	NA	NA	NA	NA	NA
WP_013348740.1|1565592_1566123_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_013348741.1|1566119_1567619_-	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_013348742.1|1567732_1568680_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013348743.1|1568821_1570147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348744.1|1570217_1570901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348745.1|1571098_1572655_+	flippase	NA	NA	NA	NA	NA
WP_013348746.1|1572682_1573582_+	sulfotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_013348747.1|1573660_1574947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348748.1|1575227_1579541_+	PKD domain-containing protein	NA	A0A1D8KKY6	Synechococcus_phage	38.4	1.9e-05
WP_013348749.1|1579671_1581435_+	SLC13 family permease	NA	Q6A201	Oenococcus_phage	27.2	1.5e-09
WP_013348066.1|1581811_1583089_+|transposase	ISL3-like element ISAar15 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	1669331	1743521	3859257	transposase,protease,tRNA	Mycobacterium_phage(37.5%)	58	NA	NA
WP_157867122.1|1669331_1670809_-|transposase	IS3-like element ISAar44 family transposase	transposase	NA	NA	NA	NA
WP_013348814.1|1672310_1673984_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_013348815.1|1674377_1674899_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_013348816.1|1674901_1675105_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_041648699.1|1675108_1675807_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	28.8	1.8e-22
WP_013348818.1|1675818_1676742_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	29.7	1.4e-19
WP_013348819.1|1676943_1677756_-	serine hydrolase	NA	NA	NA	NA	NA
WP_013348820.1|1677905_1681478_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_041648701.1|1681552_1682788_-	MFS transporter	NA	NA	NA	NA	NA
WP_013348822.1|1682961_1684143_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	33.8	1.4e-11
WP_013348823.1|1684604_1685252_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_013348824.1|1685590_1686811_+	ammonium transporter	NA	NA	NA	NA	NA
WP_013348825.1|1687045_1689148_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.5	3.4e-133
WP_013348826.1|1689245_1690376_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_013348827.1|1690478_1690955_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_013348828.1|1691083_1691275_-	CsbD family protein	NA	NA	NA	NA	NA
WP_013348829.1|1691506_1693216_-	MFS transporter	NA	NA	NA	NA	NA
WP_013348830.1|1693253_1693919_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013348831.1|1694273_1695335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041648703.1|1695328_1696699_+	bifunctional PIG-L family deacetylase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_049862605.1|1696712_1697426_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013348834.1|1697534_1697978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348835.1|1698303_1699731_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013348836.1|1699727_1700258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049862723.1|1700453_1701164_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013348838.1|1701449_1703015_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_013348840.1|1703982_1704432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348841.1|1704603_1705167_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013348842.1|1705393_1705669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348843.1|1706001_1707195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348844.1|1707339_1708539_+|transposase	IS4-like element ISAar21 family transposase	transposase	NA	NA	NA	NA
WP_013347368.1|1709201_1710509_-|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_081461126.1|1710713_1712102_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013347623.1|1712721_1714029_+|transposase	ISL3-like element ISAar23 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	61.5	8.5e-151
WP_013348847.1|1715571_1716849_+|transposase	ISL3-like element ISAar14 family transposase	transposase	NA	NA	NA	NA
WP_013348844.1|1718676_1719876_+|transposase	IS4-like element ISAar21 family transposase	transposase	NA	NA	NA	NA
WP_013348848.1|1720033_1721746_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.0	4.5e-51
WP_013348849.1|1721983_1723690_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_013348850.1|1723892_1724960_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	35.5	3.2e-10
WP_013348851.1|1725215_1726274_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_013348852.1|1726481_1727351_+	VOC family protein	NA	NA	NA	NA	NA
WP_013348853.1|1727458_1728232_-	CatB-related O-acetyltransferase	NA	NA	NA	NA	NA
WP_013348854.1|1728311_1730120_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157867124.1|1730256_1730370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157867125.1|1730400_1730586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157867126.1|1730601_1730742_-	DUF3237 family protein	NA	NA	NA	NA	NA
WP_013348856.1|1731223_1732234_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013348857.1|1732445_1733435_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_049862724.1|1733446_1734487_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013348859.1|1734551_1736279_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_013348860.1|1736324_1736954_-	LysE family translocator	NA	NA	NA	NA	NA
WP_013348861.1|1737204_1737615_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_013348862.1|1737617_1737860_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_013348863.1|1738014_1738557_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_013348864.1|1738560_1739385_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_013348865.1|1739635_1739995_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_013348866.1|1740008_1740656_+	signal peptidase I	NA	NA	NA	NA	NA
WP_013348867.1|1741079_1743521_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 8
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	2071074	2112667	3859257	transposase,protease,tRNA	Tupanvirus(20.0%)	32	NA	NA
WP_013349172.1|2071074_2074335_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	33.6	2.0e-156
WP_013349173.1|2074784_2075339_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013349174.1|2075389_2076637_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_013349175.1|2076633_2077251_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013349176.1|2077363_2079466_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_041648808.1|2079458_2079902_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
WP_013349178.1|2080079_2081318_+	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	30.8	7.4e-11
WP_013349179.1|2081406_2082861_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013349180.1|2082878_2083658_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_013349181.1|2083650_2084508_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013349182.1|2084479_2085223_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	4.9e-26
WP_013349183.1|2085222_2086320_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013349184.1|2086306_2087602_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	27.4	9.1e-28
WP_013349185.1|2087603_2088527_-	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
WP_013349186.1|2088538_2089261_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_013349187.1|2089257_2090958_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_013349188.1|2091025_2091766_-	CbiX family protein	NA	NA	NA	NA	NA
WP_013349189.1|2091796_2092561_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_013349190.1|2092765_2095384_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	38.4	2.1e-164
WP_013349191.1|2095445_2095634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102598379.1|2095703_2096693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013349193.1|2096901_2097972_-|transposase	IS1595-like element ISAar1 family transposase	transposase	NA	NA	NA	NA
WP_013347368.1|2098400_2099708_-|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_013349194.1|2100250_2100859_-	DsbA family protein	NA	NA	NA	NA	NA
WP_013349195.1|2100904_2102197_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.3	1.3e-130
WP_013349196.1|2102364_2103024_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.3	1.4e-37
WP_013349197.1|2103071_2103692_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.8	1.8e-45
WP_013349198.1|2103915_2105247_-	trigger factor	NA	NA	NA	NA	NA
WP_013349199.1|2106879_2107848_-	DNA glycosylase	NA	NA	NA	NA	NA
WP_013349200.1|2107850_2108324_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_013349201.1|2108613_2111154_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	30.7	4.8e-49
WP_013349202.1|2111311_2112667_-|transposase	IS481-like element ISAar28 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	2521908	2580162	3859257	transposase	Mycobacterium_phage(37.5%)	42	NA	NA
WP_013349578.1|2521908_2522988_-|transposase	IS110-like element ISAar18 family transposase	transposase	NA	NA	NA	NA
WP_013349579.1|2523434_2524631_+|transposase	IS110-like element ISAar17 family transposase	transposase	NA	NA	NA	NA
WP_013349581.1|2524891_2525995_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_013349582.1|2526073_2527159_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_013349583.1|2527364_2528627_+	exodeoxyribonuclease VII large subunit	NA	A0A142K922	Gordonia_phage	41.6	3.9e-68
WP_013349584.1|2528655_2528886_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_013349585.1|2528906_2529770_-	polyphosphate--nucleotide phosphotransferase	NA	NA	NA	NA	NA
WP_013349587.1|2530051_2531272_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_146040892.1|2531364_2532264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013349590.1|2532894_2533401_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013349591.1|2533473_2534307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013349592.1|2534487_2535108_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013349593.1|2535193_2535808_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_013349594.1|2535869_2536580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013349595.1|2536582_2536900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157867141.1|2536899_2541129_-	DNA helicase	NA	NA	NA	NA	NA
WP_157867142.1|2541382_2541934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013349598.1|2542090_2543677_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_013349599.1|2543824_2544289_-	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_013349600.1|2544339_2545149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013349601.1|2545324_2546476_-	GuaB3 family IMP dehydrogenase-related protein	NA	NA	NA	NA	NA
WP_013349602.1|2546650_2547967_-	BtrH N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013349603.1|2548216_2548771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013349604.1|2548967_2550473_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.2	2.0e-90
WP_013349605.1|2550593_2552690_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	28.5	1.0e-52
WP_013349607.1|2553120_2554722_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	52.3	2.0e-146
WP_013349608.1|2554755_2555052_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	47.4	1.3e-17
WP_157867143.1|2555243_2556821_-	amino acid permease	NA	NA	NA	NA	NA
WP_013349610.1|2557269_2558511_+	methyltransferase	NA	NA	NA	NA	NA
WP_013349611.1|2558668_2559811_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_013349612.1|2560243_2560972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013349613.1|2561202_2562015_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_013349614.1|2562052_2564092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013349615.1|2564460_2565135_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157867240.1|2565131_2566400_-	MFS transporter	NA	NA	NA	NA	NA
WP_013347368.1|2567036_2568344_+|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_013347368.1|2570491_2571799_+|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_041648901.1|2573548_2574253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041648904.1|2574504_2575548_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_013347368.1|2575667_2576975_+|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
WP_157867144.1|2577435_2577996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867145.1|2578685_2580162_+|transposase	IS3-like element ISAar44 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	3250901	3354467	3859257	transposase,integrase	Mycobacterium_phage(33.33%)	91	3333348:3333407	3347436:3347504
WP_013348203.1|3250901_3252098_+|transposase	IS110-like element ISAar2 family transposase	transposase	NA	NA	NA	NA
WP_013350216.1|3252491_3253040_+	alternate-type signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_157867169.1|3253078_3253612_+	signal peptidase I	NA	NA	NA	NA	NA
WP_157867170.1|3253629_3254241_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_081461177.1|3254233_3254821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867171.1|3254946_3255381_+	signal peptidase I	NA	NA	NA	NA	NA
WP_013350221.1|3255703_3256216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350222.1|3256634_3257942_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	61.7	1.1e-150
WP_102599017.1|3258007_3259162_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_102599151.1|3259623_3261336_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_013350225.1|3261378_3262503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041649066.1|3262769_3263027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867172.1|3263185_3263329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867173.1|3263398_3263704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049862667.1|3263782_3264052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081461178.1|3264109_3264526_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013348684.1|3264843_3266289_+|transposase	IS481-like element ISAar22 family transposase	transposase	NA	NA	NA	NA
WP_049862669.1|3266449_3267112_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_013350227.1|3267201_3267789_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_157867174.1|3267892_3268060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350228.1|3268149_3268818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350229.1|3269004_3269751_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	33.5	3.3e-22
WP_013350230.1|3269933_3270329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350231.1|3270376_3270919_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096257316.1|3271154_3272304_+|transposase	IS3-like element ISAar43 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	2.3e-38
WP_041649068.1|3272640_3273003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350236.1|3273604_3274549_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_102599150.1|3275148_3276105_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013350238.1|3276152_3278018_-	N-6 DNA methylase	NA	P95687	Staphylococcus_phage	31.2	5.8e-60
WP_013350240.1|3278451_3279060_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013350241.1|3279694_3279997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013348761.1|3280297_3281575_-|transposase	ISL3-like element ISAar13 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.3	1.4e-17
WP_013350242.1|3281806_3283747_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.1	9.2e-93
WP_013350243.1|3283743_3284112_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013350244.1|3284271_3285519_-|transposase	ISL3-like element ISAar30 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.6	2.7e-178
WP_013350245.1|3285684_3286314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350246.1|3286310_3286649_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041649078.1|3286901_3287126_+|transposase	transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	65.5	2.0e-12
WP_013350247.1|3287692_3289156_+|transposase	IS21-like element ISAar7 family transposase	transposase	NA	NA	NA	NA
WP_013348174.1|3289152_3289884_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.8	4.5e-32
WP_013348173.1|3289880_3290213_+	hypothetical protein	NA	A0A220NQR3	Corynebacterium_phage	54.7	8.3e-10
WP_013350248.1|3290346_3291735_+|transposase	IS256-like element ISAar6 family transposase	transposase	A0A218MNI5	uncultured_virus	37.0	8.2e-35
WP_013350249.1|3291769_3292840_-|transposase	IS1595-like element ISAar1 family transposase	transposase	NA	NA	NA	NA
WP_013350250.1|3293276_3293519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350251.1|3293945_3294248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013348199.1|3294338_3295538_-|transposase	IS256-like element ISAar5 family transposase	transposase	NA	NA	NA	NA
WP_096257432.1|3295657_3296305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350252.1|3296468_3297776_-|transposase	ISL3-like element ISAar23 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	61.2	7.2e-150
WP_157867175.1|3298716_3299433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350253.1|3299407_3301168_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013350254.1|3301164_3301782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102599148.1|3301993_3302281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049862673.1|3302559_3303156_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013350257.1|3304201_3304990_+	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	30.6	3.0e-10
WP_013350258.1|3305008_3305251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013347623.1|3305455_3306763_+|transposase	ISL3-like element ISAar23 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	61.5	8.5e-151
WP_102598997.1|3307318_3309037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350259.1|3309072_3310641_+	recombinase family protein	NA	NA	NA	NA	NA
WP_140393397.1|3311856_3312111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041649090.1|3312439_3313129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611950.1|3313845_3315056_-|transposase	IS3-like element ISAar25 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.0	6.1e-34
WP_041650241.1|3318674_3319190_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_157867176.1|3319382_3322031_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_013350266.1|3322631_3323066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350267.1|3323346_3323769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350268.1|3325417_3326329_+	DUF1792 domain-containing protein	NA	NA	NA	NA	NA
WP_157867177.1|3326737_3326908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350270.1|3327322_3328447_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_013350271.1|3328480_3328900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350273.1|3331941_3332673_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	38.3	5.8e-32
WP_013350274.1|3332669_3333002_+	hypothetical protein	NA	A0A220NQR3	Corynebacterium_phage	54.0	3.1e-09
3333348:3333407	attL	GGATGAGTGGGTTAGAGAGAATCAGTTAGCTATCGCATAGCTGCTGGACTGCTTAAAGGG	NA	NA	NA	NA
WP_096256523.1|3333890_3334307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041649099.1|3334593_3334845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350276.1|3335116_3336238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141392956.1|3336289_3336601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350278.1|3336841_3337189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041649103.1|3337541_3338141_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	39.8	9.7e-25
WP_013350280.1|3338405_3338693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350281.1|3339035_3339536_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_013350282.1|3339815_3340859_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	42.6	7.5e-73
WP_013350283.1|3341267_3341765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350285.1|3342786_3343149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162094127.1|3343443_3343842_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_041650260.1|3344203_3344515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041649106.1|3345173_3345743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041649107.1|3346047_3347280_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_157867089.1|3347455_3348603_-|transposase	IS3-like element ISAar3 family transposase	transposase	NA	NA	NA	NA
3347436:3347504	attR	CCCTTTAAGCAGTCCAGCAGCTATGCGATAGCTAACTGATTCTCTCTAACCCACTCATCCCAAAACCGG	NA	NA	NA	NA
WP_162094128.1|3349065_3349557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041648188.1|3351700_3352141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013347371.1|3352382_3352976_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.4	4.0e-23
WP_013347368.1|3353159_3354467_-|transposase	ISL3-like element ISAar19 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	60.1	2.1e-149
>prophage 11
NC_014550	Glutamicibacter arilaitensis Re117, complete genome	3859257	3390282	3431331	3859257	transposase,integrase	Mycobacterium_phage(44.44%)	41	3411257:3411272	3436380:3436395
WP_013350322.1|3390282_3391593_+|transposase	ISL3-like element ISAar39 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	64.8	7.2e-166
WP_013350323.1|3391616_3392393_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.0	4.8e-16
WP_013350324.1|3392389_3393454_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_013350325.1|3393443_3394475_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013350326.1|3394489_3395332_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_096253939.1|3395520_3396685_+|transposase	IS3-like element ISAar24 family transposase	transposase	U5P429	Shigella_phage	37.2	5.5e-40
WP_013350329.1|3397190_3398492_+|transposase	ISL3-like element ISAar42 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.5	3.2e-182
WP_013350331.1|3400226_3400661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049862679.1|3400753_3400954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350333.1|3401105_3402533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350334.1|3402706_3402994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350335.1|3403211_3403595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350336.1|3403642_3403933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350337.1|3404153_3404747_+	ParA family protein	NA	A0A222ZPB1	Mycobacterium_phage	39.3	2.3e-26
WP_013350338.1|3404743_3404980_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_013350339.1|3405440_3405827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350340.1|3405880_3406048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350341.1|3406064_3406289_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	62.5	4.5e-20
WP_013350342.1|3406644_3407646_+	DUF4192 family protein	NA	NA	NA	NA	NA
WP_013350344.1|3408150_3408384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350345.1|3408585_3408912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157867256.1|3409071_3412344_-	N-6 DNA methylase	NA	NA	NA	NA	NA
3411257:3411272	attL	AGGCCTTCAGGGGTGT	NA	NA	NA	NA
WP_013350347.1|3412563_3412890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350348.1|3412974_3414378_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_041649118.1|3414460_3415663_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_013350350.1|3415662_3416235_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_157867180.1|3416641_3417067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350294.1|3418019_3418961_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013350352.1|3418960_3419692_+	metal ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013350353.1|3419694_3420582_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_081461225.1|3420652_3421117_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_041649120.1|3421645_3422305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013350355.1|3422292_3422754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041649121.1|3423053_3423647_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	47.0	2.3e-34
WP_041649122.1|3423773_3425162_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	H7BVK1	unidentified_phage	26.1	2.7e-14
WP_013350357.1|3425161_3425974_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_157867047.1|3426309_3427495_+|transposase	IS3-like element ISAar4 family transposase	transposase	U5P429	Shigella_phage	36.5	1.4e-43
WP_013350358.1|3427592_3428645_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_013350359.1|3428770_3429103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013350360.1|3429417_3430212_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_013350361.1|3430284_3431331_-|transposase	IS110-like element ISAar41 family transposase	transposase	NA	NA	NA	NA
3436380:3436395	attR	AGGCCTTCAGGGGTGT	NA	NA	NA	NA
