The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014355	Candidatus Nitrospira defluvii chromosome, complete genome	4317083	54468	59037	4317083		Acidithiobacillus_phage(83.33%)	10	NA	NA
WP_012213846.1|54468_54804_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.2	5.8e-27
WP_013246682.1|54806_55214_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012213848.1|55256_55628_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_012213849.1|55640_55925_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_013246683.1|55921_56143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246684.1|56143_56620_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	46.4	4.3e-28
WP_013246685.1|56616_56988_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	67.5	2.0e-41
WP_013246686.1|56987_58376_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	85.8	6.4e-229
WP_013246687.1|58372_58825_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	81.0	6.7e-63
WP_083817227.1|58824_59037_-	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	73.0	2.9e-16
>prophage 2
NC_014355	Candidatus Nitrospira defluvii chromosome, complete genome	4317083	62832	101950	4317083	portal,tRNA,capsid,terminase,head,tail	Acidithiobacillus_phage(35.29%)	49	NA	NA
WP_013246693.1|62832_63096_+	hypothetical protein	NA	K4I3X3	Acidithiobacillus_phage	59.8	3.0e-23
WP_013246694.1|63107_63590_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	63.6	1.7e-51
WP_013246695.1|63586_64432_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.4	8.9e-109
WP_013246696.1|64437_65082_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	65.9	2.1e-73
WP_013246697.1|65092_65947_+	hypothetical protein	NA	I6S1R0	Salmonella_phage	38.7	1.2e-17
WP_013246698.1|65943_66444_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	73.6	8.5e-67
WP_013246699.1|66440_67178_+|tRNA	isoleucyl-tRNA synthetase	tRNA	K4HZA0	Acidithiobacillus_phage	74.6	9.5e-107
WP_013246700.1|67174_67429_+	hypothetical protein	NA	K4I1D6	Acidithiobacillus_phage	64.0	4.4e-19
WP_013246701.1|67425_69717_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.8	9.3e-294
WP_013246702.1|69844_70309_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	69.8	4.8e-56
WP_041186295.1|70310_70514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246703.1|70506_70935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246705.1|71253_72663_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	58.5	3.2e-159
WP_013246706.1|72659_73901_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	90.6	1.2e-218
WP_013246707.1|73860_74085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246708.1|74084_74450_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	86.6	4.5e-57
WP_013246709.1|74547_75069_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	85.0	9.2e-40
WP_013246710.1|75163_75370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246711.1|75489_76026_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	86.0	1.8e-78
WP_013246712.1|76025_77984_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	89.8	0.0e+00
WP_013246713.1|78002_78494_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	48.8	1.9e-26
WP_013246714.1|78493_78886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246715.1|78885_79107_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	56.2	3.1e-13
WP_013246716.1|79106_80594_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.2	2.0e-148
WP_013246717.1|80604_81819_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	39.9	3.9e-65
WP_013246718.1|81820_82198_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	54.0	1.0e-27
WP_013246719.1|82200_83205_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	71.4	5.6e-142
WP_041186787.1|83207_83486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246721.1|83496_83922_+	hypothetical protein	NA	F4YCS3	Synechococcus_phage	30.9	6.9e-09
WP_013246722.1|83926_84130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246723.1|84132_84885_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	49.6	6.0e-56
WP_013246724.1|84884_85286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246725.1|85474_86116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246726.1|86115_88821_+|tail	tail protein	tail	A0A0U2BXT9	Paracoccus_phage	30.9	6.5e-20
WP_013246727.1|88840_89899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246728.1|89895_91470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246729.1|91472_92261_+	DUF2163 domain-containing protein	NA	A0A0S0MV27	Pseudomonas_phage	33.1	5.5e-28
WP_013246730.1|92279_92507_+	hypothetical protein	NA	A0A0K1LL31	Rhodobacter_phage	63.6	1.9e-10
WP_041186296.1|92503_92710_+	hypothetical protein	NA	A0A1P8VVG8	Erythrobacter_phage	54.0	6.0e-11
WP_013246731.1|92709_94983_+|tail	tail assembly protein	tail	A0A1L2C8W7	Pseudomonas_phage	38.5	2.2e-133
WP_013246732.1|94982_95579_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_013246733.1|95582_95933_+	DUF2793 domain-containing protein	NA	A0A1X9IAR6	Xanthomonas_phage	62.9	3.8e-37
WP_013246734.1|95999_96308_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	67.9	4.2e-24
WP_013246735.1|96304_96532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013246736.1|96528_97029_+	lysozyme	NA	A0A1I9L2C4	Xanthomonas_phage	37.2	3.3e-18
WP_013246737.1|97025_97523_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	54.5	5.0e-27
WP_013246738.1|97572_98430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246739.1|98455_99025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246740.1|99211_101950_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	23.7	5.4e-22
>prophage 3
NC_014355	Candidatus Nitrospira defluvii chromosome, complete genome	4317083	1880684	1925676	4317083	plate,transposase	Enterobacteria_phage(33.33%)	39	NA	NA
WP_013248519.1|1880684_1882025_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_013248520.1|1882031_1882730_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_083817348.1|1882696_1886356_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_013248522.1|1886361_1887312_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_013248523.1|1887495_1888296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248524.1|1888311_1889430_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_013248525.1|1889453_1889987_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013248526.1|1889989_1891483_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013248527.1|1891973_1892429_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_083817349.1|1892617_1893430_+	lysozyme	NA	A0A2I7S753	Vibrio_phage	43.9	2.6e-12
WP_083817350.1|1893471_1893915_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_013248530.1|1893972_1894809_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_013248531.1|1894808_1896623_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013248532.1|1896586_1897651_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_013248533.1|1897675_1900405_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.1	2.7e-82
WP_041186507.1|1900451_1901123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248535.1|1901359_1903612_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.2	1.1e-47
WP_049787281.1|1903613_1904150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049787282.1|1904167_1905493_+	TIGR02270 family protein	NA	NA	NA	NA	NA
WP_013248538.1|1905480_1906605_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_013248539.1|1906604_1907642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248540.1|1907644_1908652_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_041186508.1|1909089_1909446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083817351.1|1910174_1911167_+	OmpA family protein	NA	NA	NA	NA	NA
WP_013248545.1|1911482_1911665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049787284.1|1911811_1912033_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_013248029.1|1912070_1913408_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	28.6	1.8e-31
WP_013248030.1|1913404_1914184_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	52.0	2.7e-67
WP_013248546.1|1914285_1914516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013248547.1|1914599_1915835_+	TIGR02270 family protein	NA	NA	NA	NA	NA
WP_013248548.1|1915894_1916158_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_013248549.1|1916154_1916397_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_013248550.1|1916733_1917432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041186509.1|1917541_1918036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248552.1|1918205_1918844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248553.1|1919173_1920565_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_013248554.1|1920678_1922685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248555.1|1922706_1924278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085951612.1|1924548_1925676_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	27.5	1.4e-16
>prophage 4
NC_014355	Candidatus Nitrospira defluvii chromosome, complete genome	4317083	2035846	2051453	4317083	integrase,transposase	Leptospira_phage(25.0%)	18	2029047:2029062	2064730:2064745
2029047:2029062	attL	CGCCGGCCACTCCGGC	NA	NA	NA	NA
WP_085951613.1|2035846_2036972_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.6	7.7e-15
WP_013248666.1|2038230_2038692_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013248668.1|2039183_2039801_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049787289.1|2039916_2040822_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013248670.1|2040803_2041271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041186525.1|2041301_2041685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248672.1|2041735_2042296_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013248673.1|2042388_2043156_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.7	1.9e-09
WP_085951614.1|2043507_2044613_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	1.9e-42
WP_085951615.1|2044691_2045000_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	55.4	4.6e-15
WP_013248679.1|2045094_2046309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013248029.1|2046068_2047406_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	28.6	1.8e-31
WP_013248680.1|2047402_2048182_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	52.0	2.7e-67
WP_083817361.1|2048786_2049497_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013248683.1|2049642_2049948_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	38.0	1.1e-05
WP_013248684.1|2050028_2050391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013248685.1|2050393_2050750_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083817362.1|2050943_2051453_-|integrase	tyrosine-type recombinase/integrase	integrase	F1C5B2	Cronobacter_phage	44.9	8.2e-09
2064730:2064745	attR	GCCGGAGTGGCCGGCG	NA	NA	NA	NA
>prophage 5
NC_014355	Candidatus Nitrospira defluvii chromosome, complete genome	4317083	2854523	2865526	4317083	tRNA	Paramecium_bursaria_Chlorella_virus(14.29%)	8	NA	NA
WP_013249442.1|2854523_2856356_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	42.8	1.4e-119
WP_013249443.1|2856365_2857985_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A2K9L821	Tupanvirus	31.4	2.5e-19
WP_049787332.1|2858036_2858711_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	7.1e-16
WP_013249445.1|2858842_2859568_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	44.3	6.4e-39
WP_013249446.1|2859554_2860586_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	26.7	5.6e-12
WP_013249447.1|2860779_2862771_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.7	3.3e-93
WP_013249448.1|2862767_2863634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013249449.1|2863741_2865526_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	41.7	9.4e-108
>prophage 6
NC_014355	Candidatus Nitrospira defluvii chromosome, complete genome	4317083	3552030	3563782	4317083	integrase	Shigella_phage(12.5%)	12	3548466:3548510	3553132:3553176
3548466:3548510	attL	TGGTGAGTCGGCTGGGATTCGAACCCAGGACCCTCGCCTTAAAAG	NA	NA	NA	NA
WP_013250051.1|3552030_3553116_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	29.1	2.5e-31
WP_013250052.1|3553322_3554645_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	2.8e-72
3553132:3553176	attR	TGGTGAGTCGGCTGGGATTCGAACCCAGGACCCTCGCCTTAAAAG	NA	NA	NA	NA
WP_013250055.1|3555237_3557079_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.1	3.6e-54
WP_013250056.1|3557075_3557453_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_013250057.1|3557515_3558805_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.4	1.2e-83
WP_013250058.1|3558957_3559761_+	alpha/beta fold hydrolase	NA	A0A2R8FDA5	Brazilian_cedratvirus	27.4	5.5e-07
WP_013250059.1|3559757_3560393_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	50.6	8.1e-46
WP_049787423.1|3560385_3560820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013250062.1|3560967_3561288_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	47.1	3.5e-21
WP_013250063.1|3561351_3561708_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_013250064.1|3561720_3562998_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_083817581.1|3563275_3563782_-	hypothetical protein	NA	A0A1B1IVR4	uncultured_Mediterranean_phage	39.3	4.2e-21
