The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	566001	614901	3980199	protease,tail,head,terminase,tRNA,integrase,portal	Bacillus_phage(30.95%)	70	574588:574607	618646:618665
WP_013351180.1|566001_567042_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.3	1.2e-62
WP_013351181.1|567266_569195_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.4	5.1e-59
WP_003155986.1|569334_569847_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_013351182.1|569843_570491_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003155981.1|570509_570680_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_088030482.1|570686_571448_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003155975.1|571486_571678_-	YdiK family protein	NA	NA	NA	NA	NA
WP_013351184.1|571674_572409_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013351185.1|572645_572930_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	3.7e-19
WP_013351186.1|572971_574606_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
574588:574607	attL	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
WP_013351187.1|574684_575896_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	41.8	4.0e-78
WP_041481597.1|575907_576381_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_013351188.1|576572_576920_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.1	5.1e-18
WP_013351189.1|576933_577455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351190.1|577722_578103_-	helix-turn-helix domain-containing protein	NA	A8ATJ9	Listeria_phage	41.2	7.8e-12
WP_041481598.1|578272_578515_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041481599.1|578527_578842_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.5	1.6e-15
WP_013351191.1|578838_579609_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	68.0	1.9e-73
WP_003155916.1|579718_580291_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_013351192.1|580287_580545_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.5	3.5e-08
WP_013351193.1|580541_580739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351194.1|580840_581026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351197.1|581967_582807_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	80.9	1.8e-122
WP_013351198.1|582971_583688_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	44.5	2.1e-42
WP_013351199.1|583572_584544_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.2	4.1e-57
WP_013351200.1|584540_584684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351202.1|585268_585727_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	79.3	6.0e-59
WP_013351203.1|585846_585999_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	65.9	1.2e-08
WP_003155894.1|586080_586284_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_013351204.1|586315_586657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351205.1|586653_586908_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	1.1e-06
WP_013351206.1|586912_588289_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	49.3	1.2e-142
WP_013351207.1|588300_588624_+	hypothetical protein	NA	M5ABU9	Bacillus_phage	33.7	7.8e-05
WP_013351208.1|588620_589220_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	38.5	6.0e-27
WP_013351209.1|589219_589582_+	hypothetical protein	NA	H6WU17	Pseudomonas_phage	65.9	1.3e-05
WP_013351210.1|589578_589854_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	47.3	5.2e-18
WP_013351211.1|589850_590264_+	hypothetical protein	NA	M4ZRL6	Bacillus_phage	53.4	1.5e-32
WP_041481602.1|590260_590815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351213.1|590807_591188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351214.1|591184_591376_+	hypothetical protein	NA	A0A217ERD8	Bacillus_phage	67.2	4.6e-13
WP_013351215.1|591421_591640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481603.1|591645_592080_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	1.8e-49
WP_041481604.1|592225_592603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044051884.1|592634_593222_+	VanZ family protein	NA	NA	NA	NA	NA
WP_013351217.1|593486_594002_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.8	4.0e-27
WP_164848964.1|594106_594244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|594541_594754_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_041481605.1|594887_595076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351219.1|595211_595442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351220.1|595486_596242_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	62.0	3.4e-51
WP_013351221.1|596228_597503_+|terminase	PBSX family phage terminase large subunit	terminase	S5MC58	Brevibacillus_phage	72.3	6.5e-180
WP_013351222.1|597524_598976_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	49.4	1.3e-128
WP_013351223.1|598962_599886_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.2	1.0e-81
WP_013351224.1|599889_600159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351225.1|600312_600978_+	phage scaffolding protein	NA	I1TLE1	Bacillus_phage	49.3	4.5e-23
WP_013351226.1|600990_601977_+	hypothetical protein	NA	D2J006	Enterococcus_phage	37.4	2.7e-48
WP_076983707.1|601954_602239_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	65.4	3.3e-23
WP_013351227.1|602239_602431_+	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013351228.1|602435_602732_+|head,tail	phage head-tail connector protein	head,tail	Q4ZBR3	Staphylococcus_phage	40.4	5.6e-10
WP_013351229.1|602728_603067_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_014471518.1|603059_603476_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.2	7.4e-32
WP_013351231.1|603494_603893_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	43.8	2.4e-24
WP_013351232.1|603906_604419_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_013351233.1|604360_604675_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	79.0	5.4e-27
WP_076983168.1|604688_604931_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_003155845.1|604987_605494_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	33.3	6.7e-11
WP_041481705.1|605541_605850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351235.1|605854_610930_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	27.2	1.2e-35
WP_013351236.1|610926_611691_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013351237.1|611703_614901_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	45.9	6.3e-131
618646:618665	attR	TATGGGCGGAATGATGTAAA	NA	NA	NA	NA
>prophage 2
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	659879	669773	3980199		Synechococcus_phage(50.0%)	9	NA	NA
WP_013351276.1|659879_661172_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	1.3e-18
WP_013351277.1|661250_661970_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.3e-47
WP_013351278.1|661969_662224_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	37.0	4.2e-06
WP_013351279.1|662220_662904_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013351280.1|662887_665116_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	7.7e-160
WP_013351281.1|665091_666522_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.8e-54
WP_013351282.1|666613_667654_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
WP_013351283.1|667650_668238_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.9	7.7e-27
WP_013351284.1|668234_669773_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.4	1.5e-77
>prophage 3
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	861637	937498	3980199	protease,tail,holin,head,plate,terminase,capsid,integrase,portal	Bacillus_phage(30.23%)	86	893116:893130	926527:926541
WP_013351438.1|861637_862552_-|protease	serine protease	protease	NA	NA	NA	NA
WP_003155495.1|862688_862841_-	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_013351439.1|862964_863234_+	YfhJ family protein	NA	NA	NA	NA	NA
WP_013351440.1|863365_863893_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_157862696.1|863878_864031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351445.1|865253_866234_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.7	1.5e-59
WP_013351446.1|866270_868856_+	YfhO family protein	NA	NA	NA	NA	NA
WP_013351447.1|868852_869836_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_013351448.1|870056_871205_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	32.7	1.2e-34
WP_013351449.1|871272_871737_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.0	9.1e-39
WP_013351450.1|871751_872057_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	50.5	2.0e-18
WP_013351451.1|872328_872529_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	65.6	3.3e-14
WP_014471597.1|872515_872788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014471598.1|872837_872987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351453.1|872983_873265_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	41.9	8.0e-14
WP_052364749.1|873303_873564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351454.1|873554_874202_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	41.6	1.9e-34
WP_013351455.1|874214_875060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481614.1|875194_875590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351457.1|875601_876375_+	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	46.5	2.6e-38
WP_013351458.1|876367_876724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351459.1|876725_878054_+	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.4	1.2e-136
WP_041481616.1|878530_878731_+	hypothetical protein	NA	A0A1D6X868	Bacillus_phage	53.4	9.0e-12
WP_013351461.1|878727_878955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351462.1|878941_879142_+	XtrA/YqaO family protein	NA	NA	NA	NA	NA
WP_013351463.1|879361_879877_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	1.4e-27
WP_013351464.1|879891_880308_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	57.3	1.4e-38
WP_013351465.1|880334_880520_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	67.8	6.0e-18
WP_013351466.1|880764_881490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351467.1|881495_882074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481617.1|882573_882888_+	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	46.6	1.5e-16
WP_127721078.1|883115_883571_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBQ3	Clostridium_phage	35.2	2.4e-12
WP_013351469.1|883560_885351_+|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	61.1	7.7e-211
WP_013351470.1|885362_886583_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	36.8	1.3e-65
WP_013351471.1|886557_887280_+|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	65.2	2.5e-67
WP_013351472.1|887276_888482_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	49.0	4.8e-100
WP_041481618.1|888495_888810_+|head,tail	phage head-tail connector protein	head,tail	H9A116	Staphylococcus_phage	41.7	9.6e-08
WP_013351473.1|888816_889146_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_013351474.1|889142_889571_+	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	44.3	2.0e-08
WP_013351475.1|889567_889957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351476.1|890014_890590_+|tail	tail protein	tail	A0A1I9KKC4	Lactobacillus_phage	36.4	6.0e-24
WP_013351477.1|890665_890986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351479.1|891168_896925_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	32.7	1.2e-15
893116:893130	attL	TTTGTTGCGAAATCA	NA	NA	NA	NA
WP_013351480.1|896927_897767_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	32.8	9.7e-31
WP_013351481.1|897776_898931_+|tail	phage tail protein	tail	A0A1W6JQ67	Staphylococcus_phage	33.6	1.9e-24
WP_013351482.1|898923_899232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721179.1|899423_900239_+	SGNH/GDSL hydrolase family protein	NA	Q4ZE16	Staphylococcus_virus	44.8	4.3e-60
WP_013351484.1|900254_901541_+|plate	BppU family phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	38.9	4.9e-82
WP_013351485.1|901541_901877_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_013351486.1|901883_902126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351487.1|902162_902378_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	2.0e-12
WP_013351488.1|902389_902656_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.5	4.4e-22
WP_013351489.1|902712_903870_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	1.9e-69
WP_013351490.1|903915_904863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471625.1|904926_905481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164463356.1|906888_907038_+	PhrK family phosphatase-inhibitory pheromone	NA	Q9ZXD2	Bacillus_phage	97.3	2.8e-10
WP_013351494.1|907376_908474_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_013351495.1|908480_908705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351496.1|908787_909540_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_013351497.1|909607_909778_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_003155476.1|909938_910205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155475.1|910340_910871_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_013351498.1|910952_912695_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	9.6e-49
WP_013351499.1|912771_913836_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_013351500.1|914045_915335_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_013351501.1|915491_915965_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013351502.1|916089_916527_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_013351503.1|916561_916915_-	YgzB family protein	NA	NA	NA	NA	NA
WP_013351504.1|917117_918002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351505.1|925110_926076_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	49.4	3.3e-83
WP_029974764.1|926263_926716_+	hypothetical protein	NA	NA	NA	NA	NA
926527:926541	attR	TGATTTCGCAACAAA	NA	NA	NA	NA
WP_013351506.1|926712_927162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481620.1|927177_927597_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
WP_013351507.1|927835_928159_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	33.0	6.0e-05
WP_013351508.1|928373_928709_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	39.0	9.9e-11
WP_041481621.1|928708_928954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721081.1|929078_929321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481622.1|929307_929676_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	47.4	1.1e-23
WP_041056591.1|930904_931084_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	68.8	1.1e-11
WP_013351512.1|931076_931856_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	54.8	1.6e-75
WP_013351513.1|931852_932380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351514.1|932376_933123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351515.1|933122_934517_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.7	2.2e-128
WP_013351516.1|934651_935647_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	47.0	2.1e-72
WP_013351517.1|935663_935903_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.2e-07
WP_013351518.1|936313_937498_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	34.7	5.0e-57
>prophage 4
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	940603	991455	3980199	tail,plate,portal,integrase,holin	Bacillus_phage(46.67%)	67	956946:956963	969019:969036
WP_013351523.1|940603_941866_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	27.1	4.5e-24
WP_157862697.1|942031_942196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351525.1|942230_944516_+	DNA polymerase I-3'-5' exonuclease and polymerase domains	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	37.4	5.9e-123
WP_013351526.1|944516_944813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351527.1|944809_945868_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	52.3	7.3e-76
WP_013351528.1|945867_946182_+	hypothetical protein	NA	A0A0F6YQ61	Sinorhizobium_phage	42.1	1.4e-19
WP_013351529.1|946178_946742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351530.1|946742_947105_+	hypothetical protein	NA	A0A0K2D038	Bacillus_phage	32.5	6.5e-08
WP_013351531.1|947109_947355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481624.1|947351_947537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351532.1|947541_947898_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	53.4	1.6e-27
WP_127721085.1|947887_948676_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A217ER63	Bacillus_phage	82.8	2.9e-122
WP_013351534.1|948827_949559_+	GIY-YIG nuclease family protein	NA	A0A024FSJ1	Bacillus_phage	72.5	1.2e-72
WP_041481714.1|951071_952037_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.6	6.8e-145
WP_157670119.1|952190_952337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041481625.1|952333_952897_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.1	1.6e-42
WP_013351538.1|953228_953924_+	FAD-dependent thymidylate synthase	NA	U5PWA7	Bacillus_virus	65.9	1.1e-83
WP_013351539.1|953950_954517_+	SPBc2 prophage-derived protein YorM	NA	A0A142F1S8	Bacillus_phage	54.9	4.1e-25
WP_052585535.1|954535_955039_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_041481628.1|955022_955946_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	44.0	1.4e-27
WP_013351541.1|955942_956515_+	dephospho-CoA kinase dephosphoCoA kinase	NA	J9Q953	Bacillus_phage	43.5	6.8e-36
WP_162145047.1|956781_957732_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	4.2e-139
956946:956963	attL	TTTCGGCGATTACGTTGA	NA	NA	NA	NA
WP_013351543.1|957704_958094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351544.1|958163_958553_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	44.2	8.8e-19
WP_041481631.1|958545_959034_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	47.0	4.9e-19
WP_013351546.1|959121_959922_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	9.1e-71
WP_157862698.1|960050_960212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351547.1|960251_961064_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.5	6.2e-99
WP_041481632.1|961155_961515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351549.1|961529_961709_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_013351550.1|961839_962277_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.4	2.8e-50
WP_013351551.1|962382_962583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164848956.1|962788_962935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351553.1|963050_963281_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013351554.1|963371_964145_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	57.8	1.5e-73
WP_013351555.1|965360_965642_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	57.5	7.5e-20
WP_013351556.1|965628_965790_+	hypothetical protein	NA	R4JMM6	Bacillus_phage	86.3	5.2e-18
WP_013351557.1|966244_966535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351558.1|966732_967281_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	1.8e-38
WP_041481633.1|967363_969118_+	hypothetical protein	NA	A0A2H4J484	uncultured_Caudovirales_phage	71.6	9.8e-251
969019:969036	attR	TTTCGGCGATTACGTTGA	NA	NA	NA	NA
WP_013351560.1|969134_969566_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	49.6	3.8e-31
WP_013351561.1|969568_971200_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.0	1.8e-166
WP_013351562.1|971199_972024_+	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	51.6	2.9e-72
WP_013351563.1|972114_972786_+	molecular chaperone ClpB	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
WP_013351564.1|972797_973901_+	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.3	2.2e-30
WP_013351566.1|974209_974428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351567.1|974441_974828_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	3.5e-20
WP_080565292.1|974843_975164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351569.1|975160_975568_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	1.8e-30
WP_041481634.1|975574_975964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351570.1|975988_976543_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_013351571.1|976601_976973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351573.1|977305_977914_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_013351574.1|978162_980388_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.7	1.8e-55
WP_013351575.1|980391_981816_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	43.2	2.6e-60
WP_013351576.1|981827_983228_+|tail	phage tail protein	tail	A0A0U4JID8	Exiguobacterium_phage	30.1	1.4e-34
WP_013351577.1|983242_985807_+	peptidase G2	NA	D6R401	Bacillus_phage	74.1	0.0e+00
WP_157862700.1|985822_987256_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.4	3.4e-68
WP_013351579.1|987270_987540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351580.1|987540_987729_+	XkdX family protein	NA	NA	NA	NA	NA
WP_013351581.1|987732_987942_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_013351582.1|988021_988960_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.3	8.1e-95
WP_013351583.1|988981_989239_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_041481635.1|989331_989892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351585.1|989907_990243_-	YolD-like family protein	NA	O64030	Bacillus_phage	35.7	8.9e-12
WP_013351586.1|990302_990509_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013351587.1|990645_991455_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.7	1.3e-16
>prophage 5
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	1240720	1290453	3980199	tRNA,protease,coat,holin	Bacillus_phage(41.67%)	60	NA	NA
WP_012117281.1|1240720_1241713_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013351824.1|1242457_1244092_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013351825.1|1244198_1245134_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351826.1|1245137_1246055_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_013351827.1|1246067_1247144_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_013351828.1|1247136_1248054_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.1	7.6e-05
WP_013351829.1|1248161_1249349_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_013351830.1|1249466_1250045_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003327578.1|1250222_1250618_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_013351831.1|1250675_1251332_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	1.3e-30
WP_014470612.1|1251607_1252264_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_013351833.1|1252415_1253576_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_013351834.1|1253804_1255634_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1255669_1255837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351835.1|1256121_1257024_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_013351836.1|1257020_1257419_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_013351837.1|1257643_1258330_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.3e-38
WP_013351838.1|1258334_1258907_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_013351839.1|1259031_1259397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351840.1|1259424_1260060_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_013351841.1|1260077_1260878_+	NAD kinase	NA	NA	NA	NA	NA
WP_013351842.1|1260892_1261786_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.6	5.7e-05
WP_013351843.1|1261819_1262569_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.0	2.9e-10
WP_013351845.1|1263833_1264544_+	thiaminase II	NA	NA	NA	NA	NA
WP_014470610.1|1264518_1265136_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_013351847.1|1265119_1266229_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_013351848.1|1266225_1266429_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1266425_1267196_+	thiazole synthase	NA	NA	NA	NA	NA
WP_013351849.1|1267192_1268203_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_013351850.1|1268225_1269038_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_013351851.1|1269168_1269945_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_164848957.1|1270036_1270630_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351853.1|1270687_1271131_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351854.1|1271279_1271762_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351855.1|1271911_1272412_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_013351856.1|1272504_1272819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351858.1|1273414_1273771_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_013351859.1|1274059_1274257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610678.1|1274348_1274510_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013351860.1|1274676_1274931_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_013351861.1|1274998_1277284_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	32.9	3.2e-84
WP_013351862.1|1277404_1277659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351863.1|1277724_1278477_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_013351864.1|1278513_1279236_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013351865.1|1279228_1279966_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.7	6.7e-28
WP_013351866.1|1279966_1280200_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013351867.1|1280357_1280789_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351868.1|1280793_1281309_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_013351869.1|1281334_1282057_-	esterase family protein	NA	NA	NA	NA	NA
WP_013351870.1|1282426_1283548_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_013351871.1|1283540_1284716_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_013351872.1|1285236_1285572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471698.1|1285593_1285947_-	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	50.4	2.4e-23
WP_014470527.1|1286554_1286809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351874.1|1286858_1287416_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	81.6	4.0e-89
WP_014470525.1|1287488_1288433_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_014470524.1|1288742_1288964_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	69.4	1.6e-25
WP_013351877.1|1289088_1289550_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013351878.1|1289753_1290089_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.8	3.2e-25
WP_127721184.1|1290372_1290453_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 6
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	1294605	1297611	3980199		Bacillus_phage(100.0%)	6	NA	NA
WP_013351882.1|1294605_1294764_-	hypothetical protein	NA	O64029	Bacillus_phage	61.2	1.7e-05
WP_013351883.1|1294923_1295253_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	69.1	4.6e-37
WP_013351884.1|1295245_1295638_+	DNA polymerase IV	NA	O64031	Bacillus_phage	93.8	2.2e-46
WP_013351885.1|1296287_1296563_-	hypothetical protein	NA	O64122	Bacillus_phage	38.9	7.8e-06
WP_014470521.1|1297013_1297223_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	78.9	2.4e-23
WP_013351886.1|1297236_1297611_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	62.3	2.9e-35
>prophage 7
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	1332959	1354424	3980199	portal,capsid,tail,terminase	Bacillus_phage(45.0%)	30	NA	NA
WP_013351926.1|1332959_1334312_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	6.0e-14
WP_014470507.1|1334738_1334930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351927.1|1335097_1335862_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013351928.1|1336005_1336473_-	DinB family protein	NA	NA	NA	NA	NA
WP_088030497.1|1336677_1337814_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	2.2e-94
WP_003154881.1|1337803_1337938_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_013351930.1|1338081_1339035_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.9	9.9e-64
WP_013351931.1|1339072_1339450_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	37.6	3.3e-15
WP_013351932.1|1339559_1340162_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.3	3.7e-40
WP_013351933.1|1340304_1340895_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.8e-39
WP_013351934.1|1341042_1341381_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.2	9.9e-19
WP_013351935.1|1341571_1341751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470504.1|1341740_1342568_+	hypothetical protein	NA	S6BFM4	Thermus_phage	28.5	4.2e-18
WP_013351937.1|1342467_1343268_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	44.3	2.3e-58
WP_003154863.1|1343267_1343435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351938.1|1343532_1343874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351939.1|1343863_1344067_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	9.2e-12
WP_013351940.1|1344179_1344689_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.3	3.2e-21
WP_013351941.1|1344803_1345601_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.0	1.2e-59
WP_013351942.1|1345597_1346896_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.7	2.3e-148
WP_044051899.1|1346944_1348336_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.0e-138
WP_013351944.1|1348355_1349198_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	5.7e-55
WP_013351945.1|1349224_1350160_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_013351946.1|1350555_1350912_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_013351947.1|1350908_1351412_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_013351948.1|1351408_1351855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351949.1|1351851_1352061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351950.1|1352060_1353458_+|tail	phage tail sheath family protein	tail	A0A0A7RTT5	Clostridium_phage	40.9	3.4e-81
WP_003154837.1|1353459_1353903_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1353977_1354424_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
>prophage 8
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	1359803	1369017	3980199	plate,holin	Clostridium_phage(36.36%)	14	NA	NA
WP_013351953.1|1359803_1360463_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.5	4.5e-23
WP_013351954.1|1360476_1361454_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	29.8	3.7e-34
WP_013351955.1|1361453_1361720_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.6e-06
WP_041481725.1|1361869_1362295_+	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	34.1	5.6e-11
WP_013351957.1|1362287_1363328_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	9.4e-68
WP_013351958.1|1363311_1363890_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	30.3	2.4e-12
WP_013351959.1|1363886_1364159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127721186.1|1365664_1366126_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	47.9	2.2e-32
WP_013351961.1|1366138_1366537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351962.1|1366523_1366721_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	1.5e-14
WP_013351963.1|1366769_1367531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351964.1|1367584_1367848_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.3	4.0e-23
WP_013351965.1|1367861_1368125_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	5.2e-23
WP_013351966.1|1368138_1369017_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.9	2.2e-81
>prophage 9
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	1867006	1873218	3980199		Bacillus_phage(50.0%)	6	NA	NA
WP_013352354.1|1867006_1867399_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	60.0	1.7e-30
WP_013352355.1|1867358_1869461_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.5	0.0e+00
WP_013352356.1|1869478_1870468_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	5.1e-156
WP_013352357.1|1870516_1871137_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.7e-46
WP_013352358.1|1871185_1871944_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	48.7	7.1e-49
WP_038462785.1|1872249_1873218_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 10
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	1926318	1936721	3980199		Bacillus_phage(71.43%)	14	NA	NA
WP_013352403.1|1926318_1926939_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	9.7e-20
WP_016935991.1|1927100_1927190_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352404.1|1927606_1928143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352405.1|1928471_1928639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013352406.1|1928804_1931222_-	peptidase G2	NA	D6R401	Bacillus_phage	50.1	6.5e-221
WP_013352407.1|1931509_1931749_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	63.0	4.5e-18
WP_013352408.1|1931919_1932354_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	87.3	4.6e-69
WP_013352409.1|1932404_1932590_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_013352410.1|1932795_1933617_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	42.6	5.3e-50
WP_013352411.1|1933723_1933873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013352412.1|1933859_1934690_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	72.3	8.5e-104
WP_013352413.1|1934717_1935167_-	YndM family protein	NA	NA	NA	NA	NA
WP_013352414.1|1935323_1935752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611720.1|1936100_1936721_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
>prophage 11
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	2295701	2301954	3980199		Staphylococcus_phage(66.67%)	9	NA	NA
WP_013352726.1|2295701_2296295_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.0e-14
WP_013352727.1|2296284_2297040_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	1.9e-09
WP_076983148.1|2297247_2297337_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_013352728.1|2297424_2297946_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_013352729.1|2298011_2298386_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_013352730.1|2298502_2298967_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	7.2e-44
WP_013352731.1|2298999_2300196_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_013352732.1|2300210_2300858_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.0e-39
WP_013352733.1|2300838_2301954_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.7	2.2e-54
>prophage 12
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	2615046	2674456	3980199	tRNA,coat,protease	uncultured_Mediterranean_phage(25.0%)	58	NA	NA
WP_013353029.1|2615046_2615490_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_013353030.1|2615502_2617707_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_013353031.1|2617865_2618378_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	7.2e-29
WP_013353032.1|2618383_2620741_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	2.8e-91
WP_013353033.1|2620796_2621123_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_013353034.1|2621186_2621684_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_013353035.1|2621814_2624034_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.9	3.5e-27
WP_013353036.1|2624070_2624367_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_013353037.1|2624481_2626038_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_013353038.1|2626045_2626702_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_013353039.1|2626868_2627255_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2627307_2627568_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_013353040.1|2627599_2628745_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	1.3e-89
WP_013353041.1|2628772_2629801_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_013353042.1|2629826_2630027_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_013353043.1|2630019_2631024_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	5.2e-07
WP_003152683.1|2631034_2631640_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_038463270.1|2631774_2632251_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_013353047.1|2633375_2634527_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_013353048.1|2634653_2635757_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_013353049.1|2635756_2636605_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_013353050.1|2636586_2638152_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_013353051.1|2638257_2639409_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.5	5.1e-30
WP_013353052.1|2639405_2639948_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_013353053.1|2639974_2640832_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2640847_2641291_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_013353054.1|2641344_2642631_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013353055.1|2642662_2643241_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_003152662.1|2643557_2643842_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_038462961.1|2643854_2644196_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2644198_2644507_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_013353057.1|2644652_2645519_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_013353058.1|2645511_2646315_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2646443_2647247_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013353059.1|2647249_2647930_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014470782.1|2647983_2648502_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_013353061.1|2648498_2649362_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_013353062.1|2649392_2650406_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_013353063.1|2650497_2651193_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_013353064.1|2651224_2651794_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_013353065.1|2651935_2652937_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_013353066.1|2653063_2653816_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013353067.1|2653955_2655248_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_013353068.1|2655306_2657949_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_013353069.1|2658399_2658591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353070.1|2658605_2659628_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_013353071.1|2659661_2661185_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353072.1|2661317_2662607_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_088030568.1|2662635_2663610_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_013353074.1|2663612_2664395_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_013353075.1|2664384_2665326_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|2665360_2666191_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_013353076.1|2666198_2667566_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_013353077.1|2667762_2668254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353078.1|2668286_2668874_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_013353079.1|2668870_2671195_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.9	8.8e-183
WP_013353080.1|2671393_2673052_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_013353081.1|2673202_2674456_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.6	1.4e-147
>prophage 13
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	2899155	2974875	3980199	protease,tail,portal,head,plate,terminase,capsid,integrase,holin	Bacillus_phage(28.57%)	79	2937280:2937327	2975047:2975094
WP_014470850.1|2899155_2899560_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003152242.1|2899695_2900133_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	6.5e-47
WP_013353276.1|2900257_2900407_+	YtzI protein	NA	NA	NA	NA	NA
WP_013353277.1|2900403_2900847_-	FixH family protein	NA	NA	NA	NA	NA
WP_013353278.1|2900963_2901437_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013353279.1|2901562_2901790_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	64.9	1.2e-23
WP_013353280.1|2901786_2902356_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003152229.1|2902482_2902731_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014470851.1|2902927_2904259_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_013353282.1|2904281_2905322_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014470852.1|2905379_2905538_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_013353285.1|2905710_2906826_-	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	21.6	2.4e-13
WP_013353286.1|2906822_2908286_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	2.4e-77
WP_013353287.1|2908373_2909192_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_013353288.1|2909250_2910075_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_013353289.1|2910062_2911799_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_013353290.1|2911795_2913208_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_013353291.1|2913491_2914211_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_013353292.1|2914354_2914825_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_013353293.1|2922346_2922928_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_013353294.1|2922959_2924489_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_013353295.1|2924508_2925039_-	NfeD family protein	NA	NA	NA	NA	NA
WP_013353296.1|2925185_2925674_+	DinB family protein	NA	NA	NA	NA	NA
WP_013353297.1|2925675_2926257_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_013353298.1|2926327_2927536_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_013353299.1|2927553_2929026_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013353300.1|2929226_2929787_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014470857.1|2929953_2930493_+	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_013353302.1|2930656_2931325_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_013353303.1|2931348_2932194_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	7.2e-26
WP_013353304.1|2932333_2933509_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_013353306.1|2934425_2934749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353308.1|2935441_2936572_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.8	4.7e-65
WP_014470862.1|2936959_2937163_+	hypothetical protein	NA	NA	NA	NA	NA
2937280:2937327	attL	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
WP_013353310.1|2939855_2940251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353311.1|2940240_2940654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470866.1|2940839_2941064_+	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	40.3	1.7e-06
WP_014470867.1|2941186_2941489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470868.1|2941544_2941850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353313.1|2941864_2943280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470869.1|2943330_2943696_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_014470870.1|2943726_2943969_-	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
WP_013353316.1|2944432_2945104_-	M15 family metallopeptidase	NA	F8WPX5	Bacillus_phage	72.5	1.7e-65
WP_013353317.1|2945145_2945553_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	67.2	1.6e-39
WP_013353318.1|2945590_2945764_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	86.0	4.4e-15
WP_013353319.1|2945766_2946048_-	hypothetical protein	NA	O64053	Bacillus_phage	48.4	8.2e-19
WP_038463007.1|2946044_2947322_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	52.9	1.8e-81
WP_013353321.1|2947335_2949924_-	peptidase G2	NA	D6R401	Bacillus_phage	52.0	1.3e-248
WP_013353322.1|2949938_2951819_-|tail	phage tail protein	tail	M5AC19	Bacillus_phage	26.8	8.5e-51
WP_013353323.1|2951833_2952667_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_013353324.1|2952678_2956452_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	56.4	9.5e-110
WP_013353325.1|2956518_2956704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353326.1|2956715_2957066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353327.1|2957153_2957738_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	U3PCW8	Staphylococcus_phage	37.2	1.1e-25
WP_013353328.1|2957770_2958154_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014470873.1|2958150_2958534_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	34.4	8.6e-11
WP_013353329.1|2958533_2958857_-|head	phage head closure protein	head	A0A249XUC8	Enterococcus_phage	41.0	8.0e-10
WP_014470874.1|2958843_2959140_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8T8	uncultured_Caudovirales_phage	37.6	6.2e-09
WP_013353330.1|2959195_2960389_-|capsid	phage major capsid protein	capsid	U5U4N8	Lactobacillus_phage	50.9	2.3e-70
WP_014470875.1|2960426_2961023_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	53.8	2.3e-42
WP_013353331.1|2961015_2962260_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	3.9e-68
WP_014470876.1|2962264_2962468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353332.1|2962479_2964183_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	34.9	1.8e-92
WP_013353333.1|2964179_2964653_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	33.6	4.0e-18
WP_013353334.1|2964924_2965158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353335.1|2965172_2965556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470877.1|2965570_2965861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470878.1|2965854_2966046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353336.1|2966432_2966711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353337.1|2966707_2966887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470882.1|2967309_2967501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470883.1|2967681_2967852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353339.1|2967866_2968616_-	Bro-N domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	39.8	1.6e-21
WP_014470884.1|2971038_2971212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470885.1|2971478_2971613_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_013353340.1|2971657_2972620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470886.1|2972824_2973004_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013353341.1|2973190_2973724_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013353342.1|2973723_2974875_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	29.8	7.8e-31
2975047:2975094	attR	GTATGGAGCCAAGGGGGCTCGAACCCCTGACCTCTACGCTGCCAGCGT	NA	NA	NA	NA
>prophage 14
NC_014551	Bacillus amyloliquefaciens DSM 7 = ATCC 23350, complete genome	3980199	3093862	3185370	3980199	coat,protease,tail,portal,head,plate,terminase,capsid,integrase,holin	Bacillus_phage(39.53%)	102	3129173:3129192	3166639:3166658
WP_014472214.1|3093862_3094879_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_013353454.1|3095032_3095533_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	57.0	5.7e-39
WP_013353455.1|3095559_3096330_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_013353456.1|3096363_3096798_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3096823_3097099_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3097317_3098214_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_013353457.1|3098416_3099394_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_013353458.1|3099431_3100190_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_013353459.1|3100296_3101691_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_013353460.1|3101708_3102530_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_013353461.1|3102549_3103401_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_013353462.1|3103427_3103781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353463.1|3103854_3105219_-	allantoinase	NA	NA	NA	NA	NA
WP_013353464.1|3105399_3106995_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014472216.1|3107190_3107370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470983.1|3107402_3107711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353465.1|3108142_3108586_-	hypothetical protein	NA	A0A1U9WQP1	Geobacillus_phage	58.4	4.0e-28
WP_013353466.1|3109694_3110891_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_013353467.1|3111013_3112267_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_013353468.1|3112285_3113527_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_013353469.1|3113745_3114612_+	endonuclease	NA	NA	NA	NA	NA
WP_013353470.1|3114656_3115763_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.6	3.3e-18
WP_013353471.1|3115916_3116645_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_013353472.1|3116669_3117524_-	fructosamine kinase	NA	NA	NA	NA	NA
WP_013353473.1|3117537_3118422_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_041481667.1|3118425_3119304_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041481740.1|3119340_3120609_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_013353476.1|3120682_3121669_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.2	7.7e-11
WP_013353477.1|3121866_3122793_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013353478.1|3122826_3123417_-	sporulation delaying protein family toxin	NA	NA	NA	NA	NA
WP_013353479.1|3123409_3124354_-	membrane protein	NA	NA	NA	NA	NA
WP_041481668.1|3124350_3124881_-	SdpA family antimicrobial peptide system protein	NA	NA	NA	NA	NA
WP_013353481.1|3125003_3125276_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_013353482.1|3125315_3125690_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_013353483.1|3125757_3126873_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_013353485.1|3127688_3128153_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_013353486.1|3128287_3129124_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.0	3.4e-20
3129173:3129192	attL	CCTTCCATTTCGAATTTGAT	NA	NA	NA	NA
WP_017418248.1|3129583_3129736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353487.1|3129768_3130131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353488.1|3130146_3130626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353489.1|3130789_3131803_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	95.3	5.4e-185
WP_013353490.1|3131851_3132274_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.9	2.7e-58
WP_013353491.1|3132324_3132513_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	5.3e-30
WP_013353492.1|3132509_3132872_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	89.1	5.1e-53
WP_013353493.1|3132868_3134005_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	77.6	3.3e-135
WP_013353494.1|3134017_3136582_-	peptidase G2	NA	D6R401	Bacillus_phage	57.6	2.4e-290
WP_013353495.1|3136614_3138333_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	69.4	2.5e-222
WP_013353496.1|3138345_3139182_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.6	8.0e-110
WP_013353497.1|3139182_3142929_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	58.4	3.1e-113
WP_014472226.1|3142989_3143172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353499.1|3143183_3143546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353500.1|3143603_3144182_-	UDP-N-acetylmuramoylalanine--D-glutamate ligase	NA	J7KKC8	Streptococcus_phage	39.9	9.6e-30
WP_013353501.1|3144201_3144594_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_013353502.1|3144590_3144980_-	HK97 gp10 family phage protein	NA	I7A9A4	Enterococcus_phage	35.0	2.2e-09
WP_013353503.1|3144979_3145306_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_014472232.1|3145295_3145589_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	39.6	8.6e-11
WP_013353505.1|3145640_3146081_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.3	1.7e-10
WP_013353506.1|3146108_3147308_-|capsid	phage major capsid protein	capsid	A0A2H4J3W9	uncultured_Caudovirales_phage	49.8	3.1e-75
WP_013353507.1|3147356_3147953_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	52.2	3.1e-47
WP_013353508.1|3147945_3149172_-|portal	phage portal protein	portal	A0A2H4J331	uncultured_Caudovirales_phage	38.0	1.2e-66
WP_041481669.1|3149176_3149383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353509.1|3149399_3151133_-|terminase	terminase large subunit	terminase	A0A1W6JPU1	Staphylococcus_phage	48.2	8.1e-141
WP_013353510.1|3151122_3151608_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0MG04	Staphylococcus_phage	36.5	4.8e-14
WP_013353512.1|3152692_3153073_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	75.6	1.0e-43
WP_013353513.1|3153069_3154425_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	66.1	5.3e-180
WP_013353514.1|3154971_3157386_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	56.0	7.6e-278
WP_164848961.1|3157408_3157582_-	hypothetical protein	NA	M4ZR07	Bacillus_phage	50.9	9.6e-10
WP_013353515.1|3157697_3159644_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	66.9	5.4e-250
WP_013353516.1|3159640_3160189_-	hypothetical protein	NA	Q38587	Bacillus_phage	62.8	4.8e-23
WP_013353517.1|3160247_3160817_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	74.9	1.3e-76
WP_032864197.1|3160872_3161217_-	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	50.0	5.7e-22
WP_013353518.1|3161216_3162395_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	61.4	1.5e-133
WP_013353519.1|3162391_3162787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353520.1|3162799_3163201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041481670.1|3163391_3163661_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.7	1.3e-18
WP_164848962.1|3163657_3163804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013353523.1|3164047_3164233_-	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	68.9	6.8e-14
WP_013353524.1|3164501_3164930_+	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	58.9	6.9e-41
WP_041481672.1|3164938_3165361_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	60.9	8.0e-42
WP_013353525.1|3165405_3166563_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	67.8	2.6e-151
WP_003151878.1|3166625_3168023_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3166639:3166658	attR	CCTTCCATTTCGAATTTGAT	NA	NA	NA	NA
WP_003151877.1|3168042_3168486_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_013353526.1|3168475_3169696_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.3	1.2e-117
WP_013353527.1|3169695_3171009_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|3171026_3171812_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003151857.1|3171988_3172141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088030652.1|3172333_3172720_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013353529.1|3172803_3173619_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013353530.1|3173632_3174301_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013353531.1|3174293_3175319_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.7e-32
WP_013353532.1|3175641_3175992_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013353533.1|3176089_3176410_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_013353535.1|3176848_3177085_-	YusG family protein	NA	NA	NA	NA	NA
WP_013353536.1|3177139_3177523_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013353537.1|3177582_3177939_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	50.0	1.1e-20
WP_013353538.1|3178052_3179837_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013353539.1|3179855_3181031_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_013353540.1|3181041_3183411_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_013353541.1|3183601_3183742_+	YuzL family protein	NA	NA	NA	NA	NA
WP_013353542.1|3183770_3184679_-	proline dehydrogenase	NA	NA	NA	NA	NA
WP_013353543.1|3184768_3185026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013353544.1|3185037_3185370_+|coat	spore coat protein	coat	NA	NA	NA	NA
