The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_015312	Pseudonocardia dioxanivorans CB1190, complete sequence	7096571	12527	73442	7096571	transposase,integrase	Staphylococcus_phage(30.0%)	48	7792:7812	82618:82638
7792:7812	attL	GATGGCCGACGCCGACGTCGA	NA	NA	NA	NA
WP_063821878.1|12527_13814_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.3	6.3e-13
WP_013672238.1|14976_15759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672240.1|16047_16314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672241.1|16334_17228_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_158511275.1|17324_17561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672242.1|17716_19462_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_049803572.1|19512_20271_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.6	1.1e-28
WP_173400073.1|20288_21545_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.4	7.7e-24
WP_158511276.1|22457_22604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013672246.1|22894_23455_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_013672247.1|23457_24651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083845041.1|24732_25083_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041760217.1|25302_25554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049803265.1|25550_25784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158511277.1|25780_26491_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_013672251.1|26617_27409_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.1	9.4e-28
WP_013672252.1|27405_28992_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_143770721.1|29116_29545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672254.1|29541_29904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672255.1|29900_31760_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_013672256.1|31851_32511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672257.1|32507_32909_+	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_013672258.1|32905_33823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672259.1|34055_38453_+	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	25.0	2.4e-19
WP_013672260.1|38991_40461_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	5.3e-48
WP_041759128.1|40457_41255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013672262.1|41441_41780_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013672263.1|41884_43894_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	28.5	2.9e-33
WP_143770300.1|44366_45707_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013672265.1|45777_47082_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_013672266.1|47851_48400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013672267.1|49080_50421_+	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
WP_083845383.1|50456_51206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041759132.1|51368_51734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013672270.1|52456_52735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083845042.1|52685_53549_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_086002792.1|53681_54872_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_143770725.1|55088_56279_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_173400073.1|56480_57737_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.4	7.7e-24
WP_143770727.1|57936_59388_-	LCP family protein	NA	NA	NA	NA	NA
WP_013672274.1|59564_59984_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_083845043.1|59996_60254_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_013672275.1|60330_61167_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_143770729.1|61787_65753_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.3	4.0e-26
WP_173400075.1|66342_67650_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_013672278.1|67659_68691_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_143770731.1|70694_71753_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.5	3.2e-31
WP_013672282.1|72239_73442_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
82618:82638	attR	GATGGCCGACGCCGACGTCGA	NA	NA	NA	NA
>prophage 2
NC_015312	Pseudonocardia dioxanivorans CB1190, complete sequence	7096571	6141275	6174520	7096571	transposase,tail,head,integrase,protease	Gordonia_phage(42.86%)	46	6153354:6153370	6177422:6177438
WP_143770660.1|6141275_6141548_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_013677800.1|6141646_6141925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677802.1|6142147_6142933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158511345.1|6143058_6143229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677804.1|6143192_6145211_+	DUF3631 domain-containing protein	NA	A0A127AW94	Bacillus_phage	21.8	1.9e-08
WP_013677805.1|6145207_6145465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677806.1|6145566_6145971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677807.1|6145967_6146162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041760124.1|6146418_6146703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677808.1|6146835_6147840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677809.1|6147839_6148406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677810.1|6148405_6148720_+	hypothetical protein	NA	A0A142KA59	Gordonia_phage	40.8	1.3e-09
WP_049803788.1|6149285_6149621_+	hypothetical protein	NA	A0A2D1GPT4	Mycobacterium_phage	38.4	4.7e-05
WP_143770662.1|6149571_6151134_+	hypothetical protein	NA	M1PFG2	Streptococcus_phage	24.3	2.4e-22
WP_013677813.1|6151153_6152407_+	hypothetical protein	NA	A0A142K8P5	Gordonia_phage	63.7	3.2e-139
WP_013677814.1|6152403_6153705_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2K9VH82	Gordonia_phage	44.0	7.9e-80
6153354:6153370	attL	CGAGCGCGCCGAGCCCA	NA	NA	NA	NA
WP_013677815.1|6153708_6154080_+	DUF2190 family protein	NA	A0A142K8P7	Gordonia_phage	50.8	1.2e-22
WP_013677816.1|6154092_6155016_+	hypothetical protein	NA	A0A1C9EHT7	Gordonia_phage	55.7	8.9e-94
WP_013677817.1|6155015_6155330_+	hypothetical protein	NA	A0A1J0MC79	Streptomyces_phage	61.4	9.0e-06
WP_013677818.1|6155339_6155786_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_041760128.1|6155803_6156262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677820.1|6156331_6156517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677821.1|6156520_6157015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677822.1|6157016_6157391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677823.1|6157417_6157723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041760129.1|6157823_6158234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677825.1|6158239_6158635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677826.1|6158754_6163197_+	hypothetical protein	NA	I4AZE0	Saccharomonospora_phage	29.3	3.4e-26
WP_013677827.1|6163242_6163659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677828.1|6163662_6165327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677829.1|6165358_6165703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677830.1|6165705_6166113_+	hypothetical protein	NA	G1BNF9	Mycobacterium_phage	68.1	3.7e-44
WP_013677831.1|6166160_6168647_+	hypothetical protein	NA	A0A2H5BLE2	Streptomyces_phage	28.5	2.5e-10
WP_143770665.1|6168698_6169337_+|tail	tail fiber protein	tail	A0A068Q5X6	Ralstonia_phage	38.5	3.3e-07
WP_041760132.1|6169333_6169633_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_013677832.1|6169647_6169965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677834.1|6170059_6170224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677835.1|6170287_6170572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041760133.1|6170598_6171255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677837.1|6171251_6171518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677838.1|6171504_6172299_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_013677839.1|6172301_6172556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013677840.1|6172634_6172934_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_013677842.1|6173164_6173362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143771075.1|6173486_6173729_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_013677844.1|6173734_6174520_-|integrase	site-specific integrase	integrase	A0A1C9EI13	Gordonia_phage	32.3	8.5e-21
6177422:6177438	attR	TGGGCTCGGCGCGCTCG	NA	NA	NA	NA
>prophage 3
NC_015312	Pseudonocardia dioxanivorans CB1190, complete sequence	7096571	6398930	6437201	7096571	transposase,integrase	Enterobacteria_phage(25.0%)	34	6411115:6411132	6444580:6444597
WP_013678050.1|6398930_6400163_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158511347.1|6400408_6400549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672251.1|6400642_6401434_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.1	9.4e-28
WP_013676029.1|6404133_6404451_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173400107.1|6404447_6405518_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_143770731.1|6406112_6407171_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.5	3.2e-31
WP_049803540.1|6407233_6407497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013672518.1|6407912_6409157_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.2	8.0e-106
WP_013678051.1|6409831_6411250_-	amidase	NA	NA	NA	NA	NA
6411115:6411132	attL	CGGCCACAAGGTCGCCGT	NA	NA	NA	NA
WP_013678052.1|6411489_6412344_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_013678053.1|6412370_6412853_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_143770675.1|6412849_6413842_-	cytidyltransferase	NA	NA	NA	NA	NA
WP_013678056.1|6413864_6415163_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013678057.1|6415175_6416240_-	Zn-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	24.0	2.3e-08
WP_013678058.1|6416254_6417277_-	toluene hydroxylase	NA	NA	NA	NA	NA
WP_013678059.1|6417279_6417582_-	MmoB/DmpM family protein	NA	NA	NA	NA	NA
WP_013678060.1|6417578_6417977_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_013678061.1|6417987_6418233_-	Toluene-4-monooxygenase system B	NA	NA	NA	NA	NA
WP_013678062.1|6418268_6419786_-	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_013678063.1|6419936_6420224_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_013678064.1|6420229_6421351_-	chloromuconate cycloisomerase	NA	NA	NA	NA	NA
WP_013678065.1|6421394_6422249_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_013678066.1|6422277_6423873_-	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_013678067.1|6423914_6424487_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_013678068.1|6424596_6425415_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143770679.1|6425513_6425777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013678069.1|6425773_6426274_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_041760152.1|6427189_6427681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086002828.1|6427953_6428970_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_013678072.1|6428971_6430096_+	heparin lyase I family protein	NA	NA	NA	NA	NA
WP_013678073.1|6430097_6431351_+	glycoside hydrolase family 16 protein	NA	NA	NA	NA	NA
WP_143770681.1|6431611_6433270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678075.1|6433770_6434721_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_013678076.1|6434717_6437201_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
6444580:6444597	attR	ACGGCGACCTTGTGGCCG	NA	NA	NA	NA
>prophage 4
NC_015312	Pseudonocardia dioxanivorans CB1190, complete sequence	7096571	6712952	6746561	7096571	transposase,protease	Staphylococcus_phage(33.33%)	36	NA	NA
WP_143770793.1|6712952_6714113_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.4	4.8e-28
WP_013678329.1|6714368_6715568_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_041762980.1|6715753_6716422_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_013678331.1|6716720_6717158_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_041760175.1|6717567_6717789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678333.1|6717972_6718620_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013678334.1|6718607_6719492_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_041760176.1|6719628_6720468_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143771128.1|6720515_6721094_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.7	2.1e-21
WP_086002792.1|6721264_6722455_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013673969.1|6722705_6723749_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049803555.1|6724208_6724436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678337.1|6724594_6725413_-	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_013678338.1|6725419_6725758_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_013678339.1|6725801_6726860_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_013678340.1|6727072_6727600_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_013678341.1|6727734_6728706_+	hydrogenase	NA	NA	NA	NA	NA
WP_013678342.1|6728775_6730383_+	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_173400122.1|6730388_6731219_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_143770694.1|6731224_6731545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678345.1|6731555_6732815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678346.1|6732818_6733172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678347.1|6733182_6734103_+	NifU family protein	NA	NA	NA	NA	NA
WP_143770696.1|6734018_6735302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678349.1|6735298_6737638_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_013678350.1|6737639_6737900_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_013678351.1|6737896_6738622_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_013678352.1|6738621_6739296_+	SIS domain-containing protein	NA	A0A067XQR2	Caulobacter_phage	28.7	4.2e-08
WP_013678353.1|6739292_6740402_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_013678354.1|6740413_6740686_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_013678355.1|6740723_6741854_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_013678356.1|6741850_6742597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143770698.1|6742614_6743460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678359.1|6744364_6745225_-	6-chlorohydroxyquinol-1,2-dioxygenase	NA	NA	NA	NA	NA
WP_013678360.1|6745237_6745537_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_041760176.1|6745721_6746561_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NC_015314	Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence	192355	93250	119886	192355	integrase,transposase	Mycobacterium_phage(33.33%)	24	115729:115747	121704:121722
WP_013678750.1|93250_93541_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013678751.1|93537_94428_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	27.2	1.8e-19
WP_013678752.1|94532_94709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013678753.1|95455_96754_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_083845521.1|96813_97875_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	32.1	2.0e-12
WP_013678754.1|98120_99746_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_158511367.1|99796_99967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083845522.1|100005_101148_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_013678755.1|101356_102130_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049803824.1|102185_103358_+	CoA transferase	NA	NA	NA	NA	NA
WP_013678757.1|103877_104399_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_143771205.1|104607_104982_-	hypothetical protein	NA	A0A0M5M147	Mycobacterium_phage	46.2	7.4e-07
WP_013678758.1|105440_105689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013678761.1|109020_110250_-	CoA transferase	NA	NA	NA	NA	NA
WP_013678762.1|110246_111305_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_158511368.1|111399_111900_-	CoA transferase	NA	NA	NA	NA	NA
WP_083845524.1|111877_112549_-	CoA transferase	NA	NA	NA	NA	NA
WP_041763336.1|112726_113056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041763338.1|113076_113526_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_158511369.1|113719_114565_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.8	1.4e-16
WP_013678763.1|114671_116084_-|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	45.6	7.9e-94
115729:115747	attL	GCCCGCGCCCGGGCCGCCG	NA	NA	NA	NA
WP_013678764.1|116325_117927_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_049803818.1|117956_118418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041763341.1|118998_119886_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1A0S4	Gordonia_phage	35.8	3.3e-37
121704:121722	attR	GCCCGCGCCCGGGCCGCCG	NA	NA	NA	NA
