The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_007614	Nitrosospira multiformis ATCC 25196, complete sequence	3184243	50135	62150	3184243	transposase	Dickeya_phage(16.67%)	9	NA	NA
WP_041352685.1|50135_53867_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.3	5.3e-12
WP_193363987.1|53990_54744_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.5	4.3e-22
WP_011379412.1|54841_55651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011379413.1|55668_56367_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_011379414.1|56538_58686_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	34.3	9.8e-11
WP_011379415.1|58819_59026_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011379416.1|59208_59841_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	36.1	8.6e-16
WP_011379417.1|60013_60454_-	thioredoxin TrxC	NA	F2WLG3	Lausannevirus	39.8	2.1e-13
WP_148235530.1|60898_62150_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	49.5	7.3e-67
>prophage 2
NC_007614	Nitrosospira multiformis ATCC 25196, complete sequence	3184243	1873694	1933195	3184243	protease,transposase	Paenibacillus_phage(50.0%)	52	NA	NA
WP_146063213.1|1873694_1874021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167535569.1|1874349_1874487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011380965.1|1874669_1875008_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011380966.1|1875026_1878086_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.3	2.3e-82
WP_011380967.1|1878082_1879237_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_104009757.1|1879349_1880729_-	TolC family protein	NA	NA	NA	NA	NA
WP_148235532.1|1881788_1882545_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.5	1.4e-12
WP_080557682.1|1882538_1883072_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_148235532.1|1883102_1883860_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.5	1.4e-12
WP_080557683.1|1883896_1884193_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011380969.1|1884658_1887217_+	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	3.0e-67
WP_080557717.1|1887552_1887861_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011380971.1|1888137_1888920_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_011380974.1|1891996_1892929_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011380975.1|1892976_1894512_-	alternate F1F0 ATPase, F1 subunit alpha	NA	NA	NA	NA	NA
WP_011380976.1|1894619_1895495_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011380977.1|1895498_1895780_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011380978.1|1895789_1896545_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_011380979.1|1896550_1896892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011380980.1|1896888_1897380_-	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_011380981.1|1897411_1897804_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_011380982.1|1897883_1899296_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011380983.1|1899976_1901338_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011380984.1|1901653_1902781_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_011380985.1|1903065_1903302_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_011380986.1|1903294_1903642_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_011380987.1|1903660_1904467_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_011380988.1|1904463_1905621_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_011380989.1|1905706_1908019_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_011380990.1|1908008_1909013_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_041353067.1|1909022_1910816_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_011380992.1|1910812_1911550_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011380993.1|1911539_1912088_+	NADP oxidoreductase	NA	NA	NA	NA	NA
WP_011380994.1|1912153_1913635_+	Ni/Fe hydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_041353068.1|1914023_1914629_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_104009750.1|1914640_1915138_+|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_011380997.1|1915118_1917788_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011380998.1|1918217_1919084_+	HAF repeat-containing PEP-CTERM protein	NA	NA	NA	NA	NA
WP_011380999.1|1919224_1920118_-	universal stress protein	NA	NA	NA	NA	NA
WP_041352502.1|1920151_1921846_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_011381001.1|1921970_1922483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011381002.1|1922672_1923503_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011381003.1|1923506_1924790_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011381004.1|1924882_1925224_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011381006.1|1925736_1926171_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011381007.1|1926343_1927204_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_167535570.1|1927225_1927390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148235532.1|1927593_1928351_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.5	1.4e-12
WP_167535571.1|1929089_1930148_+	Type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_011381009.1|1930426_1931335_-	ion transporter	NA	NA	NA	NA	NA
WP_041352505.1|1931456_1931933_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_011381011.1|1932052_1933195_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	1.1e-42
>prophage 3
NC_007614	Nitrosospira multiformis ATCC 25196, complete sequence	3184243	2310762	2324595	3184243	transposase,integrase	Paenibacillus_phage(33.33%)	15	2322277:2322298	2332855:2332876
WP_011381327.1|2310762_2311752_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	32.4	1.3e-21
WP_011381328.1|2312041_2312329_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_041352554.1|2312578_2312932_-	VOC family protein	NA	NA	NA	NA	NA
WP_011381331.1|2315212_2315692_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011381332.1|2315732_2316035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193363987.1|2316072_2316826_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	43.5	4.3e-22
WP_104009795.1|2316875_2317736_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_104009798.1|2318129_2319211_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.9e-40
WP_011381335.1|2319474_2319711_-	recombinase family protein	NA	F1BUU6	Erwinia_phage	51.9	1.5e-13
WP_167535582.1|2319714_2319879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148235541.1|2320058_2321311_-|transposase	IS3-like element ISNmu3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	49.5	4.3e-67
WP_011381338.1|2321683_2322382_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
2322277:2322298	attL	CACTCCTCCGCAGGAGGATCCG	NA	NA	NA	NA
WP_148235532.1|2322552_2323310_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.5	1.4e-12
WP_041353182.1|2323346_2324015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080557720.1|2324025_2324595_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2332855:2332876	attR	CGGATCCTCCTGCGGAGGAGTG	NA	NA	NA	NA
>prophage 1
NC_007616	Nitrosospira multiformis ATCC 25196 plasmid 2, complete sequence	17036	0	10275	17036	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_011382069.1|672_1593_+	Abi family protein	NA	NA	NA	NA	NA
WP_011382070.1|1652_2528_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_011382071.1|2520_2841_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080557727.1|3205_3430_+	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_104009798.1|3475_4557_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.7	3.9e-40
WP_011382072.1|5107_6079_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	82.2	1.2e-152
WP_104009786.1|6075_7467_-	class I SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	68.5	1.3e-186
WP_011382074.1|7747_8062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011382075.1|8048_8699_-	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	33.0	1.2e-17
WP_041353370.1|9174_10275_+	replication initiator protein A	NA	A0A0K1LLD0	Rhodobacter_phage	40.4	2.5e-66
