The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_014752	Neisseria lactamica 020-06, complete genome	2220606	270596	309207	2220606	transposase,integrase,capsid,plate,tail	Burkholderia_virus(32.35%)	57	280015:280034	313024:313043
WP_013448339.1|270596_271421_+	DNA ligase	NA	A0A1X9VNU1	Mimivirus	30.0	3.5e-25
WP_042508119.1|271489_272053_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	32.9	1.2e-05
WP_013448341.1|272134_272572_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003712909.1|272640_272910_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013448342.1|272909_274685_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	1.1e-10
WP_162467540.1|274891_275074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448343.1|275197_275641_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	35.5	1.9e-14
WP_013448344.1|275643_276546_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.7	4.2e-64
WP_013448345.1|276542_278012_-	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	46.3	1.4e-109
WP_042508120.1|278027_278303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013448346.1|278304_279801_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	68.2	4.2e-202
280015:280034	attL	CTTCAGACGGCATTTCGCCG	NA	NA	NA	NA
WP_013448348.1|280343_280661_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	63.9	1.9e-27
WP_013448349.1|280657_280978_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	43.9	1.0e-12
WP_013448350.1|280981_281194_-	TraR/DksA family transcriptional regulator	NA	A0A0U4IIN4	Pseudomonas_phage	44.1	6.7e-05
WP_013448351.1|281186_281405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013448352.1|281385_281781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013448353.1|281764_282094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013448354.1|282205_282709_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	60.1	4.6e-52
WP_013448355.1|282802_283390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013448356.1|283403_284069_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	40.5	7.4e-34
WP_013448357.1|284211_284400_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_013448358.1|284408_284693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448359.1|284729_285605_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	41.9	5.7e-50
WP_013448360.1|285597_287364_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	46.2	3.0e-138
WP_013448361.1|287388_288534_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	49.8	2.4e-101
WP_013448362.1|288535_288676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448363.1|288781_289051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448365.1|289150_289486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448366.1|289482_289983_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	44.0	2.5e-26
WP_013448367.1|289966_290476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448369.1|290602_291226_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	52.7	1.4e-55
WP_013448370.1|291228_291387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042508122.1|291379_291574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158305286.1|291616_291925_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	52.7	1.7e-17
WP_042508123.1|292094_292571_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.5	2.3e-21
WP_013448374.1|292563_292890_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	43.9	8.7e-20
WP_013448375.1|293112_293475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448376.1|293899_294931_+	2-oxoacid:acceptor oxidoreductase	NA	Q6QIB7	Burkholderia_phage	40.9	6.3e-56
WP_013448377.1|294988_295927_+|capsid	major capsid protein	capsid	A4JWK0	Burkholderia_virus	42.7	4.5e-53
WP_003753466.1|295975_296314_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_013448378.1|296316_296604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013448379.1|296607_297033_+	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	29.8	2.4e-09
WP_013448380.1|297032_297530_+	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	36.0	2.6e-23
WP_013448381.1|297541_298936_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	45.8	1.0e-101
WP_013448382.1|298964_299480_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	50.3	4.4e-42
WP_042508124.1|299573_299870_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	41.6	2.9e-06
WP_042508297.1|299904_300048_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_013448385.1|300044_300398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013448386.1|300398_302804_+|tail	phage tail tape measure protein	tail	A0A1B2LRQ0	Wolbachia_phage	37.3	2.1e-86
WP_013448387.1|302803_303700_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	35.7	2.8e-20
WP_013448388.1|303696_303918_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	38.2	4.6e-09
WP_013448389.1|303905_305000_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	44.9	4.6e-73
WP_042508125.1|304962_305598_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	41.1	9.9e-28
WP_013448391.1|305670_306048_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_013448392.1|306038_307172_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	37.7	4.0e-56
WP_013448393.1|307174_307753_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	49.7	5.6e-46
WP_115178371.1|308271_309207_+|tail	tail fiber protein	tail	NA	NA	NA	NA
313024:313043	attR	CTTCAGACGGCATTTCGCCG	NA	NA	NA	NA
>prophage 2
NC_014752	Neisseria lactamica 020-06, complete genome	2220606	1199638	1207607	2220606		Cafeteria_roenbergensis_virus(16.67%)	8	NA	NA
WP_013448985.1|1199638_1200481_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.6	1.5e-47
WP_013448986.1|1200495_1200936_+	DUF4149 domain-containing protein	NA	NA	NA	NA	NA
WP_042508201.1|1200980_1202267_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	62.8	1.0e-148
WP_003708585.1|1202281_1202560_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_013448988.1|1202599_1202890_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.5	9.7e-15
WP_042508202.1|1203020_1204175_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	75.1	1.4e-165
WP_003713114.1|1204368_1205325_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.7	3.9e-28
WP_013448990.1|1205327_1207607_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.0	2.9e-311
>prophage 3
NC_014752	Neisseria lactamica 020-06, complete genome	2220606	1627922	1638688	2220606	tRNA	Geobacillus_virus(12.5%)	10	NA	NA
WP_003675494.1|1627922_1628225_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	37.4	6.8e-11
WP_013449273.1|1628297_1630661_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.6	5.2e-05
WP_013449274.1|1630957_1632046_-	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	48.3	3.0e-72
WP_013449275.1|1632023_1632461_-	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	50.9	1.5e-27
WP_013449276.1|1632779_1633772_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.1	2.0e-30
WP_013449277.1|1634021_1634381_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003675505.1|1634393_1634591_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_162849214.1|1634736_1635270_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.0	2.0e-13
WP_013449278.1|1635275_1637189_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.3e-126
WP_013449279.1|1637572_1638688_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.3	2.2e-86
