The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	694081	764453	4085304	plate,transposase	Xanthomonas_phage(16.67%)	54	NA	NA
WP_041394637.1|694081_694696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041393894.1|694971_695937_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_011217405.1|696111_698463_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011217406.1|698609_699989_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011217407.1|700196_701189_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	40.7	9.4e-17
WP_011217408.1|701205_701586_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011217409.1|701866_703534_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	27.1	1.5e-38
WP_011217410.1|703666_705601_+	murein transglycosylase	NA	K4NWI2	Pseudomonas_phage	41.0	4.8e-17
WP_011217411.1|705721_706033_+	trp operon repressor	NA	NA	NA	NA	NA
WP_011217412.1|706145_706670_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_041393895.1|707121_707760_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011217414.1|708539_709352_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011217415.1|709409_710447_-	histidine kinase	NA	NA	NA	NA	NA
WP_041393896.1|710446_711862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394639.1|711864_712635_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_011217418.1|712681_714016_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011217419.1|714003_714702_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	3.1e-38
WP_011217420.1|714788_715487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041393897.1|715722_716688_+	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_011217422.1|716759_717380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011217423.1|717588_718539_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	48.7	1.2e-21
WP_011217424.1|718442_718889_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_011217425.1|719069_719549_+	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	36.3	2.1e-14
WP_049788903.1|719612_721679_-	serine/threonine protein kinase	NA	A0A2I2L576	Orpheovirus	30.4	1.6e-13
WP_011217427.1|721944_723255_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011217428.1|723257_723725_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011217429.1|723880_725206_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011217430.1|725232_726552_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011217431.1|726551_730097_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_041393899.1|730078_730765_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_041394643.1|730764_731589_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_041394644.1|731618_732722_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011217435.1|732757_733291_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011217436.1|733290_734781_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011217437.1|734841_736383_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011217438.1|736387_737182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041393900.1|737204_737672_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011217440.1|737673_739503_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_172635950.1|739499_740471_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_041393902.1|740491_743080_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.2	2.2e-89
WP_011217443.1|743311_743791_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011217444.1|743849_745700_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.1	3.0e-32
WP_011217445.1|745738_746029_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_041393903.1|746035_747007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011217447.1|746997_751056_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.9	8.6e-32
WP_041393904.1|751062_751689_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011217449.1|751806_753405_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	56.5	8.3e-31
WP_011217450.1|753397_753751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049788905.1|754800_755766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011217453.1|755771_756992_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_157134281.1|757014_757287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011217454.1|757276_759340_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.6	1.6e-10
WP_011217455.1|759399_761112_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_076612114.1|763166_764453_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	830880	839010	4085304		Mycoplasma_phage(33.33%)	9	NA	NA
WP_011217506.1|830880_832095_+	IscS subfamily cysteine desulfurase	NA	H7BUW1	unidentified_phage	40.2	1.8e-33
WP_006230804.1|832141_832528_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	1.2e-52
WP_011217507.1|832546_832870_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	1.4e-22
WP_011217508.1|832955_833471_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_011217509.1|833509_835363_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.1	1.2e-102
WP_011217510.1|835365_835704_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011217511.1|835803_836004_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011217512.1|836330_837617_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	5.1e-31
WP_011217513.1|837732_839010_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.5	1.1e-33
>prophage 3
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	1492517	1512574	4085304	transposase,integrase	Leptospira_phage(57.14%)	26	1492496:1492555	1512537:1514937
1492496:1492555	attL	GTAAGCGTCTGGGCAACGACACCTAGCTATGCTTAATATTCCATGGCAGCAACGCGTCAA	NA	NA	NA	NA
WP_011218058.1|1492517_1494062_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.3	6.5e-65
WP_011218059.1|1494170_1494518_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_011218060.1|1494517_1494814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134295.1|1494950_1495145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218062.1|1495305_1495557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218063.1|1495656_1496862_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_041394016.1|1496865_1497132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218608.1|1497258_1498545_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_157134296.1|1498549_1498915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134297.1|1499361_1499556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218068.1|1500093_1500444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218069.1|1500789_1501041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218070.1|1501081_1501642_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7RHK5	Vibrio_phage	77.2	2.4e-78
WP_011218071.1|1501638_1502115_+	hypothetical protein	NA	A0A2I7RHR1	Vibrio_phage	85.3	1.9e-71
WP_011218072.1|1502597_1503158_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_041394020.1|1503459_1503666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218608.1|1503706_1504993_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_049788922.1|1505018_1505711_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_011218074.1|1505988_1507041_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011218075.1|1507037_1507925_-|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	26.2	2.1e-20
WP_157134299.1|1507983_1508124_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_041394022.1|1508326_1508872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218077.1|1508921_1509374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218060.1|1510277_1510574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218059.1|1510573_1510921_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_011218058.1|1511029_1512574_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.3	6.5e-65
1512537:1514937	attR	TTGACGCGTTGCTGCCATGGAATATTAAGCATAGCTAGGTGTCGTTGCCCAGACGCTTACTTTAATCCCTGTTAAAACGTTTGTTTGACATTGATTCCTTGAGCTTCCTCCCTCTCGATACGTTTGGTGGATGGTATTCATATGAAAGTTAATTGTTATTGAGTCTTTGCTTTTTTGTGTACAACCATCAGCAAAAATAACACAGCTGTATAAAACGTCGTACAATAGTGATGCAAAAAGTTATATTTCATATATGAGCACTATTCGACATCTATCGTTAATAATTCCCCCTCATGTGATAACCCGAAAGAAGCTTATCGATGACAGTGTGCAGAGATGCGTACTCTCCGGCCACTTGCCCAGCCTAATCACTGGGCTTTTTTGTTTCTCAGTGTTGCATTTTATGCTCCTGATAAGGTAGTGGTTGCGATTGGTGCAACTAAGGGGGTAATAATGAAAACGCTCAAGCCGAGGATCACGAAGACGTTAGATCCTTCAGTCACACGAAAGAATGGGAACCGTTCAGCGACTGCCCGTACTTATGGTGGTAAATGGCAACGGATACGCAAGGCGGTATTAACGGATGAACCACTGTGCAGGTTATGCCTAGCTGCAGGGATCACACAGCAAGCCGTGGAGGTTGACCACATTATCCCACTGCACTTGGGTGGTACTGATGAGAAGTCAAACTTACAACCGTTATGTTTTCTTTGTCACCAATTCAAAACGACAACTGAAAACACCTTGCGTAATCGTGGCCGTAAACGCGACTGAGAGATGCAATAAGTCAGTGATGTCATGCTCGACTGTATAGCTTTTGTCTCCAGGTAACCCTGCACGATGCGTGTGGATAGGCAAGGGGGGGCGGTCATAGTGGTACGGGTTGGGTCGGTAACCTCACCTTGCTCTCATGCAGAGAAAAAAAAGAACAGGTAATGGGGTGCGTATGAATAATTATGGCGAAAATGGCTAGGATAACGATGGGCTACAAGTAAAGGTAATAATGATCGGGGAAGTGCTGGTTTTAGAAATAAATTATCTACGTTAGGAGTTAATTTTTGTTACTGGTCATTCAGTAACAAAGATGGTTAATATTAAAACGTCATACGTTAAATTTTTCTGTATATATATTAAGTTGTTAGGCATGGATATATGGATTTAATTACACTTTGGTTTGTTGTTTTATTATTGATAACCTTAAAACTAAACAATAACTCTATAATGTAACAATTTGTAAATTGATGAAAATAACGTTTGATTAATATTTCAGAGTGGAGTAAATATTAACTTCCACTTCATTTAATATATCTATCAAGGAGAGAGAGATGTTGAAAACTTGTCACTTTTTTTTCTCATCCATTCCAGCTGTTTTCTACTGGTTTACTGCTGATCCTTCTATTAAAGACCTATCAAAGACAAGCTTGATTTAATTCGGTTTTATTTTTTATGAAAATAATATATCCAATGTTTTAAATGCCTAAATATTTTTAATATTAGGCTGAAAAATTATTGTTATAAAACTGAAGATATCACTATATCAGTGAAAAAGGCATGTTTATGATGAACTTACCCCAATCCTTTAAGAGAAAATCTGTAGCGTTAATGAACTTACCCCAACCCTATAAGATAAAATCTGTAGAGCCAATTAATTTGCTCTCAAAAGAAGAGCGTTTTAAAGCACTTGAGAGAGTTGGATTTAATCCATTTCTGTTAAAAAGTAATGAAGTTTTTATTGATTTATTAACAGACTCCGGCACCGGAGCGATGAGCCAAGATCAGTGGTCGGCCCTGATGAAAGGAGATGAATCCTATGCCGGTAGTAGCAGCTTTTATAAGTTAGAAGAAGCAGTTACCGATATTTTTGATTACCAATATACGATCCCAACCCATCAAGGCCGGGGAGCCGAACAAATATTATTCCCTATTTTAATTCAGAAAATGGAAAAAGAACGTGGAGGGAAGGCGCCTGTTTTTCTCTCTAATTATCATTTCGATACCACCGCCGCACATATTGAACTTAATGGTGCAAAAGCCGTGAATGTCGTGGTCGAAGAAGCTTATAAAATAAAAGATTATTATAATTGGAAAGGTAACTTTGATTTACCTTTATTAGTCGGGAATATTGAAAAGTATGGTTCTGAAAATATAGCGGCTATTATTATTACCATCACGTGTAATAGTATGGGGGGGCAGCCTGTTTCACTTGATAATATGAAGGCCGTTTATGATATTGCGAAAGAATTTAATATTCCAGTCGTGATGGACGCTGCGCGTTTCTCCGAAAATGCGTACTTTATTCTTCAACGAGATCCAATATATTTCAATGCCAGTATCGGTGATATTGTCAAAAAAATGTTTGAATATGCAGATATATTTACGATGTCTGCAAAAAAAGACGCGA	NA	NA	NA	NA
>prophage 4
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	1519575	1561864	4085304	tail,capsid,transposase,protease,terminase,head	Burkholderia_phage(20.0%)	35	NA	NA
WP_041394026.1|1519575_1520790_+	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	35.7	4.0e-78
WP_081470330.1|1520789_1521419_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.2	6.5e-40
WP_011218087.1|1521564_1521933_-	VOC family protein	NA	NA	NA	NA	NA
WP_011218089.1|1522503_1522824_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	47.2	5.5e-11
WP_041394028.1|1522996_1523425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041394030.1|1523427_1525095_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	52.0	2.0e-160
WP_041394032.1|1526380_1527160_+|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	46.8	3.8e-45
WP_011218094.1|1527173_1528436_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	48.3	3.0e-100
WP_041394034.1|1528453_1528657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218095.1|1528662_1528980_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_041394037.1|1528979_1529300_+|head	phage head closure protein	head	A0A088F713	Idiomarinaceae_phage	28.4	5.9e-05
WP_011218097.1|1530439_1530790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218098.1|1531249_1531879_+	LysE family translocator	NA	NA	NA	NA	NA
WP_172635948.1|1532345_1533380_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	66.0	9.5e-12
WP_011218099.1|1533579_1534059_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_011218100.1|1534155_1534443_+	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_011218101.1|1534583_1535951_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_011218102.1|1536540_1537413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041394695.1|1537547_1538771_+	MFS transporter	NA	NA	NA	NA	NA
WP_011218104.1|1538793_1540734_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	1.2e-31
WP_011218105.1|1541347_1542559_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_011218106.1|1542555_1543884_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_011218107.1|1543880_1545581_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_011218108.1|1545843_1546455_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_172635969.1|1546568_1547603_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011218111.1|1548408_1549080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218112.1|1549217_1549406_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_011218113.1|1549495_1550407_-	HTH-type transcriptional regulator MetR	NA	NA	NA	NA	NA
WP_011218114.1|1550661_1552962_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011218115.1|1553113_1553551_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011218116.1|1553908_1555552_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011218117.1|1555973_1556351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394047.1|1556910_1557762_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157134301.1|1558283_1558943_+	DUF2974 domain-containing protein	NA	A0A2P0VP29	Tetraselmis_virus	31.7	3.3e-10
WP_011220614.1|1560253_1561864_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	1728122	1817142	4085304	transposase,tRNA	Sulfolobus_monocaudavirus(14.29%)	57	NA	NA
WP_011218258.1|1728122_1728719_-|tRNA	tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY	tRNA	NA	NA	NA	NA
WP_011218259.1|1729068_1730538_-	peptide MFS transporter	NA	NA	NA	NA	NA
WP_041393917.1|1730863_1731292_+|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011218261.1|1731485_1732973_-	MFS transporter	NA	NA	NA	NA	NA
WP_011218262.1|1733360_1734134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041394707.1|1734169_1736548_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.2	2.1e-38
WP_011218264.1|1736701_1737013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394134.1|1737290_1737542_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_011218266.1|1737644_1737923_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_011218267.1|1738245_1740393_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_011218268.1|1740501_1741668_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_011218428.1|1743511_1744543_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041394709.1|1744988_1746752_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.5	1.5e-97
WP_011218272.1|1747056_1748124_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_011218273.1|1748134_1748509_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_011218274.1|1748525_1750298_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011218275.1|1750420_1750915_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011218276.1|1751223_1751922_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_041394138.1|1752199_1753390_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011218278.1|1753483_1754143_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_157134308.1|1754348_1754519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218279.1|1754518_1755067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218281.1|1756241_1756895_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011218282.1|1757232_1758825_+	BCCT family transporter	NA	NA	NA	NA	NA
WP_041394141.1|1759025_1760486_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_011218284.1|1760715_1762083_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_041394144.1|1762367_1763039_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.4e-26
WP_011218286.1|1763019_1765479_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011218287.1|1765478_1766570_+	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_011218288.1|1766604_1767900_+	amidohydrolase	NA	NA	NA	NA	NA
WP_172635972.1|1768318_1770559_+	FUSC family protein	NA	NA	NA	NA	NA
WP_041394147.1|1770570_1772229_+	TolC family protein	NA	NA	NA	NA	NA
WP_086000062.1|1772234_1772438_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_041394710.1|1772455_1773337_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_049788924.1|1773385_1774093_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_011218294.1|1774094_1775216_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_041394149.1|1775336_1777304_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_011218297.1|1778249_1779035_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.5	2.0e-14
WP_011218298.1|1779119_1781219_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_041394151.1|1781651_1783478_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.6e-32
WP_011220614.1|1783747_1785358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011218302.1|1788070_1789684_+	dynamin family protein	NA	NA	NA	NA	NA
WP_011218303.1|1789748_1790732_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_011218304.1|1791072_1792191_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_086000047.1|1792190_1793222_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_011218306.1|1793243_1794983_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011218307.1|1795431_1795827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218308.1|1795930_1797337_-	amino acid permease	NA	NA	NA	NA	NA
WP_011218309.1|1797537_1798008_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011218310.1|1799170_1800142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081470334.1|1800146_1801433_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_081470335.1|1801872_1803159_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086000048.1|1803172_1803583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218314.1|1803579_1805532_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_011218315.1|1805868_1810845_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011218316.1|1810841_1812263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218058.1|1815597_1817142_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.3	6.5e-65
>prophage 6
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	1840161	1881802	4085304	transposase,integrase,tRNA	Leptospira_phage(33.33%)	39	1840129:1840142	1864197:1864210
1840129:1840142	attL	GTTTCATTTTGATA	NA	NA	NA	NA
WP_011219045.1|1840161_1841706_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.5	2.9e-65
WP_041394173.1|1842527_1842740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218337.1|1842754_1843621_-	radical SAM protein	NA	NA	NA	NA	NA
WP_011218338.1|1843769_1844474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218339.1|1844464_1844809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218340.1|1844805_1845300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394177.1|1845609_1846410_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011218342.1|1846886_1847345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218343.1|1847489_1847921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218344.1|1848094_1850014_-	flagellin	NA	NA	NA	NA	NA
WP_157134310.1|1850091_1850292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218346.1|1850540_1851158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218347.1|1851154_1851715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218348.1|1851714_1853085_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011218349.1|1853090_1854014_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_011218350.1|1854010_1855744_+	TniQ family protein	NA	NA	NA	NA	NA
WP_081470336.1|1859284_1860571_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_041393917.1|1862235_1862664_+|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011218357.1|1862895_1863465_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_041394718.1|1863724_1864084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218359.1|1864203_1864557_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
1864197:1864210	attR	TATCAAAATGAAAC	NA	NA	NA	NA
WP_157134366.1|1864666_1865128_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157134311.1|1865299_1865806_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011218362.1|1866097_1866811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220284.1|1867375_1868662_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_041394182.1|1868971_1869220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394184.1|1869202_1869730_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	25.0	9.1e-11
WP_041394186.1|1869876_1870119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011217584.1|1870173_1871124_-|transposase	IS1595-like element ISPpr6 family transposase	transposase	NA	NA	NA	NA
WP_081470338.1|1871642_1872929_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_081470339.1|1873011_1873623_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011218367.1|1874052_1874385_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011218369.1|1874782_1875406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218370.1|1875678_1876620_-	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011218371.1|1876738_1877068_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_049788928.1|1878849_1879578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218375.1|1879599_1879881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218376.1|1880242_1880686_+	CopD family protein	NA	NA	NA	NA	NA
WP_011218377.1|1880785_1881802_+|transposase	IS110-like element ISPpr8 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	1923001	1957826	4085304	lysis,transposase,integrase	Sulfolobus_monocaudavirus(33.33%)	32	1896140:1896155	1955108:1955123
1896140:1896155	attL	TATTAGCTGATCAATA	NA	NA	NA	NA
WP_041393917.1|1923001_1923430_+|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011218397.1|1923648_1924122_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011218398.1|1924382_1925891_+	peptide MFS transporter	NA	NA	NA	NA	NA
WP_011218399.1|1925983_1927474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218400.1|1927751_1928123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218401.1|1928127_1928565_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_006231697.1|1928826_1929120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218403.1|1929358_1930000_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_011218404.1|1930186_1931362_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_041394194.1|1931774_1932182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218406.1|1932304_1933276_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_011218407.1|1933614_1934511_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011218408.1|1934680_1935568_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_011218409.1|1935779_1936463_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_011218410.1|1936462_1936801_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_011218411.1|1936944_1937469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218412.1|1937768_1939193_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011218413.1|1939370_1940546_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	48.2	3.6e-100
WP_011218414.1|1940779_1941061_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011218415.1|1941057_1941357_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011218074.1|1941597_1942650_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157134313.1|1943533_1943725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172635954.1|1944297_1944888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041394200.1|1945083_1946694_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172635969.1|1947211_1948246_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086000049.1|1948719_1950293_-|transposase	IS3-like element ISPpr7 family transposase	transposase	U5P429	Shigella_phage	30.8	9.4e-11
WP_011218423.1|1951526_1951832_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_011218424.1|1951854_1952730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081470341.1|1953603_1954890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011218426.1|1955048_1956059_+	hypothetical protein	NA	NA	NA	NA	NA
1955108:1955123	attR	TATTGATCAGCTAATA	NA	NA	NA	NA
WP_011218427.1|1956065_1956422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218428.1|1956794_1957826_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	2011743	2088471	4085304	transposase,protease,integrase	Catovirus(14.29%)	57	2013485:2013507	2099557:2099579
WP_011220614.1|2011743_2013354_-|transposase	transposase	transposase	NA	NA	NA	NA
2013485:2013507	attL	CTTATTGAGAAGTTACCAATCTT	NA	NA	NA	NA
WP_081470342.1|2014910_2018825_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.7	2.0e-54
WP_041394229.1|2019052_2021296_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.4	5.4e-20
WP_157134369.1|2021572_2021977_+	biphenyl 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_041394232.1|2022009_2022198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218475.1|2022423_2023812_-	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	9.1e-10
WP_011218478.1|2025356_2026574_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011218479.1|2026906_2029534_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_081470343.1|2029651_2029870_+	DUF2835 domain-containing protein	NA	NA	NA	NA	NA
WP_011218481.1|2030253_2035083_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011218482.1|2035404_2036415_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011218483.1|2036658_2037198_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_011218484.1|2038188_2040327_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_041394732.1|2040330_2040651_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_011218486.1|2040637_2042566_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.2	4.2e-53
WP_011218487.1|2042565_2044626_+	DUF3466 family protein	NA	NA	NA	NA	NA
WP_041394235.1|2044794_2044968_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_011218488.1|2045255_2045771_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_011218489.1|2045839_2047588_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_011218490.1|2047782_2048229_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_011218491.1|2048323_2048629_+	DUF3634 family protein	NA	NA	NA	NA	NA
WP_011218492.1|2048715_2049111_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011218493.1|2049541_2049787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218494.1|2050077_2050800_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_041394237.1|2051026_2051473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394239.1|2051465_2052230_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157134370.1|2052331_2052886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394240.1|2053062_2053407_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_011218499.1|2053491_2054778_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011218500.1|2054979_2055660_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_041394241.1|2055944_2056160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394242.1|2056386_2056623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218501.1|2056874_2058044_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011218502.1|2058108_2058555_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011220284.1|2058654_2059941_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_041394243.1|2060092_2061112_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011218505.1|2061448_2061739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041394244.1|2062369_2062579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394248.1|2063369_2063951_+	hypothetical protein	NA	A0A0K1LMN3	Citrobacter_phage	27.3	5.2e-07
WP_157134317.1|2063962_2064601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218509.1|2066201_2068055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218510.1|2068141_2068954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218511.1|2068971_2069655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218512.1|2069798_2071712_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011218513.1|2071701_2073045_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_011218514.1|2073200_2075102_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041394255.1|2075104_2076886_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011218516.1|2076885_2078388_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.4	7.0e-32
WP_157134371.1|2078557_2080960_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	24.0	7.1e-10
WP_011218518.1|2081163_2082540_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011218519.1|2082536_2083088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218520.1|2083238_2083544_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011218521.1|2083940_2084273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041394257.1|2084384_2085404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218523.1|2085393_2086962_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041394258.1|2086961_2087144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218608.1|2087184_2088471_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
2099557:2099579	attR	CTTATTGAGAAGTTACCAATCTT	NA	NA	NA	NA
>prophage 9
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	2673836	2740311	4085304	transposase,protease,tRNA	Sulfolobus_monocaudavirus(18.18%)	57	NA	NA
WP_041394384.1|2673836_2674718_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_041394385.1|2677818_2677983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041394386.1|2678066_2678297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218999.1|2678675_2679338_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011219000.1|2679330_2680170_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_041394387.1|2680159_2681338_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_011219002.1|2681324_2682377_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_041394778.1|2682550_2683816_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.4	1.8e-20
WP_041394779.1|2683996_2684560_+	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011219005.1|2684634_2685849_-	ROK family protein	NA	NA	NA	NA	NA
WP_011219006.1|2686130_2686799_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2P1JXY9	Rhodococcus_phage	33.1	8.3e-09
WP_011219007.1|2687095_2689936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011219008.1|2690271_2691672_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	39.3	2.9e-88
WP_011219009.1|2691936_2693112_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011219010.1|2694008_2694833_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_011219011.1|2695059_2695530_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	46.9	1.1e-31
WP_011219012.1|2695891_2696668_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_041394389.1|2696790_2698173_-	MFS transporter	NA	NA	NA	NA	NA
WP_011219014.1|2698702_2699893_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011219015.1|2700019_2700325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011219016.1|2700646_2701057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049788938.1|2701612_2702227_+	DUF2982 domain-containing protein	NA	NA	NA	NA	NA
WP_011219018.1|2702269_2703607_-	MFS transporter	NA	NA	NA	NA	NA
WP_011219019.1|2703672_2705268_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_041394390.1|2705267_2705876_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_011219021.1|2706095_2707496_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_041394391.1|2707937_2708591_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011219023.1|2708831_2709380_-	YcbK family protein	NA	NA	NA	NA	NA
WP_011219024.1|2709533_2711252_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011219025.1|2711765_2712260_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041394392.1|2712474_2713320_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011219027.1|2713279_2714050_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_041394393.1|2714240_2715125_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041394394.1|2715318_2716029_+	amino acid racemase	NA	NA	NA	NA	NA
WP_011219030.1|2716526_2718110_+	L-lactate permease	NA	NA	NA	NA	NA
WP_011219031.1|2718261_2718981_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_011219032.1|2718993_2720403_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_011219033.1|2720420_2721167_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_011219034.1|2721305_2722211_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011219035.1|2722283_2722766_-	group II truncated hemoglobin	NA	NA	NA	NA	NA
WP_011219036.1|2722900_2725378_-	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_011219037.1|2725449_2726634_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_006233652.1|2726670_2726844_-	trimethylamine N-oxide reductase system protein TorE	NA	NA	NA	NA	NA
WP_011219038.1|2727280_2728585_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9J3H9	Clostridium_phage	35.3	1.2e-16
WP_157134333.1|2728744_2729563_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_011219040.1|2729899_2730934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011219041.1|2731476_2732046_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_157134334.1|2732020_2732419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041393917.1|2732489_2732918_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_041393917.1|2733416_2733845_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011219042.1|2734239_2735256_-|transposase	IS110-like element ISPpr8 family transposase	transposase	NA	NA	NA	NA
WP_086000054.1|2735422_2736995_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.8	1.2e-10
WP_011216905.1|2737061_2737532_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011219044.1|2737533_2737971_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	71.4	1.3e-10
WP_011218334.1|2738013_2738310_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011218059.1|2738309_2738657_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_011219045.1|2738766_2740311_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.5	2.9e-65
>prophage 10
NC_006370	Photobacterium profundum SS9 chromosome 1, complete sequence	4085304	3502315	3517461	4085304	tRNA	Klosneuvirus(22.22%)	13	NA	NA
WP_041394510.1|3502315_3504937_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.6	8.4e-81
WP_041394511.1|3505386_3506445_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.2	3.1e-111
WP_011219645.1|3506570_3507062_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	47.8	1.5e-28
WP_011219646.1|3507284_3509855_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.4	3.4e-34
WP_041394512.1|3509985_3510987_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.9	5.9e-35
WP_011219648.1|3511039_3511948_-	murein hydrolase activator NlpD	NA	A0A1P8CWQ1	Bacillus_phage	34.9	1.0e-09
WP_011219649.1|3511964_3512594_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.1	2.2e-35
WP_041394514.1|3512596_3513346_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.7	1.7e-74
WP_041394817.1|3513326_3514385_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_006232582.1|3514410_3514884_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011219652.1|3514889_3515594_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_041394515.1|3515627_3515903_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_011219654.1|3516159_3517461_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.3	3.8e-135
>prophage 1
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	327196	392067	2237943	transposase	Escherichia_phage(33.33%)	57	NA	NA
WP_011220374.1|327196_328642_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.2	2.0e-92
WP_011220375.1|328947_329715_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.1	5.7e-38
WP_011220376.1|329835_330441_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_086000069.1|330412_331985_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.8	9.4e-11
WP_041395644.1|332677_332998_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	45.7	1.3e-15
WP_086000070.1|332991_333270_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	47.6	1.3e-11
WP_011218334.1|333365_333662_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011218059.1|333661_334009_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_041394898.1|334117_335662_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.4	2.9e-65
WP_011220382.1|336126_336423_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_041394899.1|336415_336625_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_011220383.1|336675_338064_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.2	2.9e-48
WP_011220384.1|338112_338424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081470391.1|338454_339048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220388.1|340269_342105_+	MOSC domain-containing protein	NA	R9TNA0	Synechococcus_phage	35.1	6.2e-06
WP_011220389.1|342190_343639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220390.1|343635_344661_-	endoglucanase	NA	NA	NA	NA	NA
WP_011220391.1|344657_346736_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_011220392.1|346732_348964_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_011220393.1|348965_349493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220394.1|349834_350779_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011220395.1|350957_352478_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011220396.1|352728_354540_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011220397.1|354774_355116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394900.1|355112_355322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172635999.1|355699_357163_+	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	31.6	1.8e-16
WP_011220399.1|357253_357790_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_006230542.1|358261_358507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006230540.1|358525_358894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041394903.1|359006_360617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011220402.1|360962_361628_+	carboxylesterase	NA	NA	NA	NA	NA
WP_011220403.1|361682_363053_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_011220404.1|363478_363688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220405.1|363808_366778_-	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_041394905.1|367103_368471_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011220407.1|368635_369250_+	LysE family translocator	NA	NA	NA	NA	NA
WP_041394907.1|369449_370763_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_157134383.1|371411_371558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220409.1|372420_373785_-	Ktr system potassium transporter B	NA	NA	NA	NA	NA
WP_011220410.1|373786_374440_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_041394911.1|374522_375215_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011220412.1|375204_376248_-	DUF4118 domain-containing protein	NA	NA	NA	NA	NA
WP_041394913.1|376785_377631_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_172636000.1|377632_378250_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	61.5	3.7e-80
WP_011220414.1|378257_380702_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.7	3.5e-214
WP_011220415.1|381065_381650_+	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	34.5	5.0e-26
WP_011220416.1|381649_382207_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	38.8	2.8e-26
WP_011220417.1|382545_382923_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_011220418.1|383100_383841_+	porin family protein	NA	NA	NA	NA	NA
WP_011220419.1|383988_384864_+	6-carboxytetrahydropterin synthase	NA	A0A140B3G6	Vibrio_phage	27.5	5.9e-15
WP_011220420.1|385002_385905_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011220421.1|386035_386692_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011220422.1|386979_387723_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011220423.1|387792_388527_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011220425.1|388962_389427_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_081470392.1|389530_390004_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041394917.1|390456_392067_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	618539	668214	2237943	terminase,protease,integrase,transposase,tail,head	Enterobacteria_phage(20.0%)	43	614312:614328	657487:657503
614312:614328	attL	ATAAAATAAAGAAATAA	NA	NA	NA	NA
WP_011220614.1|618539_620150_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011220618.1|624873_625632_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011220621.1|628329_628608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011218608.1|628614_629901_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_041394989.1|630434_632786_+	chitinase	NA	Q9PYU0	Xestia_c-nigrum_granulosis_virus	30.7	3.3e-28
WP_011220623.1|633177_634014_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.4	3.7e-14
WP_006229276.1|634010_634877_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_041394991.1|634893_635886_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041394992.1|636031_637159_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_157134458.1|637163_637769_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_011220627.1|638106_638502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220628.1|638743_639367_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011220631.1|641434_642676_+|integrase	integrase family protein	integrase	A5LH57	Enterobacteria_phage	38.8	3.7e-79
WP_011220632.1|642717_643005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220633.1|643030_643633_-	porin family protein	NA	NA	NA	NA	NA
WP_041395679.1|644007_644508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220636.1|644913_645123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220637.1|645429_646380_-	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	30.5	2.1e-29
WP_011220639.1|647148_647403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220640.1|647883_648039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220641.1|648078_648384_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	45.7	8.4e-17
WP_011220642.1|648364_649321_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_011220643.1|649589_649823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220644.1|649825_650002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086000087.1|650012_650954_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	44.9	1.7e-55
WP_011220646.1|651070_654517_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	40.3	1.3e-33
WP_011220648.1|654997_655327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220649.1|655455_655677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220650.1|655682_656573_+	hypothetical protein	NA	A0A2I7S3S2	Vibrio_phage	35.2	1.7e-41
WP_172635984.1|656580_656760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220652.1|656905_657187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220653.1|657292_657484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220654.1|657669_658149_+|terminase	terminase small subunit	terminase	A0A088C409	Shewanella_sp._phage	41.1	6.5e-16
657487:657503	attR	ATAAAATAAAGAAATAA	NA	NA	NA	NA
WP_011220655.1|658148_659690_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	49.1	1.6e-135
WP_011220656.1|659705_659915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220657.1|659917_661576_+|head,tail	head-tail connector protein	head,tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	42.3	7.8e-117
WP_011220658.1|661575_661899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220659.1|661888_662722_+|protease	endoprotease	protease	Q775C6	Bordetella_phage	34.1	4.8e-14
WP_011220660.1|662736_663726_+	hypothetical protein	NA	Q775C7	Bordetella_phage	37.8	2.9e-50
WP_011220661.1|663792_664224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220662.1|664235_664721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220663.1|664831_665455_+	hypothetical protein	NA	W6MVD9	Pseudomonas_phage	29.2	1.0e-16
WP_011220664.1|665454_668214_+	hypothetical protein	NA	Q858G3	Salmonella_phage	31.8	2.7e-138
>prophage 3
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	911169	1024516	2237943	protease,tRNA,integrase,transposase	Leptospira_phage(33.33%)	87	969785:969802	1016185:1016202
WP_011220861.1|911169_911583_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011220863.1|912336_913221_+	aspartoacylase	NA	NA	NA	NA	NA
WP_011220864.1|913548_913983_+	VOC family protein	NA	NA	NA	NA	NA
WP_041395734.1|913997_914864_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011220866.1|914901_915219_-	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_041395054.1|915425_916700_+	membrane protein	NA	NA	NA	NA	NA
WP_157134463.1|917006_917642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220869.1|918257_918770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220870.1|918864_919617_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_049789000.1|919904_920552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220872.1|921012_922713_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_011220873.1|922849_924034_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	41.4	1.8e-78
WP_011220874.1|924123_924582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395058.1|924830_926261_+	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_041395060.1|926494_927142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065814500.1|927197_928202_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_011220878.1|928689_928992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220882.1|931435_932275_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011220885.1|933982_935320_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041395063.1|935827_936514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220889.1|937333_938599_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_011220890.1|938718_939396_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_041395067.1|940395_941505_+	serine hydrolase	NA	NA	NA	NA	NA
WP_081470446.1|941631_941871_+	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
WP_081470331.1|944010_945297_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011220898.1|948365_950012_+	ABC-ATPase domain-containing protein	NA	NA	NA	NA	NA
WP_011220899.1|950188_951025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172635986.1|951295_951454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395068.1|951454_951892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220902.1|951922_952186_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011218608.1|952169_953456_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_041395070.1|953951_954407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395742.1|954502_954937_+	thioredoxin TrxC	NA	NA	NA	NA	NA
WP_011220906.1|955137_956052_+	cation diffusion facilitator family transporter	NA	M1Q1N9	Streptococcus_phage	25.9	2.4e-06
WP_011217584.1|956318_957269_+|transposase	IS1595-like element ISPpr6 family transposase	transposase	NA	NA	NA	NA
WP_041395071.1|958381_959926_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011220909.1|960074_961079_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011220910.1|961470_961956_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_157134464.1|963243_964278_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_041395073.1|965326_965590_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157134393.1|965642_965891_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011218334.1|966613_966910_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011218059.1|966909_967257_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_011220811.1|967366_968911_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.4	2.2e-65
969785:969802	attL	TTGTAACTTCTCAATAAG	NA	NA	NA	NA
WP_011220917.1|969794_971405_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011220919.1|972714_973176_+	YdiL family protein	NA	H9C180	Pectobacterium_phage	43.2	1.8e-18
WP_172635969.1|973129_974164_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011220920.1|974468_974711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220921.1|974827_976165_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011220923.1|976812_977163_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_157134394.1|977460_979593_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011220925.1|979714_981619_+	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_011220926.1|981803_983123_+	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_041395075.1|983133_984126_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	3.0e-31
WP_011220928.1|984122_984941_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011220929.1|985017_985518_+	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_006230017.1|985709_985988_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011220931.1|986066_986309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220932.1|986579_987470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011220933.1|987472_987751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134395.1|987856_988231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220935.1|988368_989670_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011220936.1|989942_990482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220937.1|990631_991369_-	GMP synthase	NA	NA	NA	NA	NA
WP_011220938.1|991433_992591_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_011220939.1|992645_994055_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011220940.1|994112_995480_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011220941.1|995800_996619_+	cytochrome c	NA	NA	NA	NA	NA
WP_049789004.1|996700_997651_+|transposase	IS1595-like element ISPpr6 family transposase	transposase	NA	NA	NA	NA
WP_011220944.1|998700_1000563_+	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_011218608.1|1001023_1002310_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011220946.1|1003079_1004015_-	siroheme synthase	NA	NA	NA	NA	NA
WP_011220947.1|1004187_1004919_+|integrase	site-specific integrase	integrase	A0A1B3B212	Gordonia_phage	25.2	1.7e-07
WP_011220948.1|1004915_1005968_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011220949.1|1006423_1007548_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011220950.1|1007547_1010703_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.6	3.7e-67
WP_041395078.1|1010878_1011982_-|protease	trypsin-like serine protease	protease	Q6JKF3	Neodiprion_sertifer_nucleopolyhedrovirus	25.4	5.2e-08
WP_011220952.1|1012227_1013052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395758.1|1013156_1013744_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_011220954.1|1013829_1014819_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_065814487.1|1015209_1015710_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041395079.1|1015706_1015979_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_011220614.1|1016332_1017943_+|transposase	transposase	transposase	NA	NA	NA	NA
1016185:1016202	attR	TTGTAACTTCTCAATAAG	NA	NA	NA	NA
WP_011220957.1|1018016_1018862_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_041395081.1|1019225_1020053_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011218608.1|1020964_1022251_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011220614.1|1022905_1024516_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1050744	1100005	2237943	protease,integrase,transposase	Vibrio_phage(25.0%)	58	1045269:1045287	1109027:1109045
1045269:1045287	attL	AGTTTTGCAGATGTGCAAA	NA	NA	NA	NA
WP_011220983.1|1050744_1052130_+|transposase	IS4-like element ISPpr3 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.4	6.2e-51
WP_011220984.1|1052204_1053041_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	47.4	1.3e-56
WP_011220985.1|1053254_1053779_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011220986.1|1053803_1054340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220987.1|1054380_1055058_-	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_011220988.1|1055330_1056443_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011220989.1|1056552_1057179_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011218608.1|1057415_1058702_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011220991.1|1059827_1060142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134465.1|1060389_1061151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220993.1|1061491_1062385_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011220994.1|1062532_1065262_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172635948.1|1065767_1066803_-|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	66.0	9.5e-12
WP_011220995.1|1067236_1067776_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011220996.1|1067862_1068426_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_011220997.1|1068647_1069640_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_041395096.1|1069872_1070097_+	DUF2559 family protein	NA	NA	NA	NA	NA
WP_011220998.1|1070086_1070722_+	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_041395775.1|1070761_1071733_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	24.4	4.0e-20
WP_041395099.1|1071982_1072348_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_011221001.1|1072468_1072981_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_011221002.1|1073092_1073698_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_041395101.1|1073817_1074141_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_011221004.1|1074737_1075187_+	phage protein	NA	NA	NA	NA	NA
WP_011221005.1|1075338_1076031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221006.1|1076061_1077018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395105.1|1077334_1077547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395777.1|1077626_1078052_-	virion protein	NA	A0A2P1CKV1	Pseudoalteromonas_phage	43.7	3.6e-18
WP_041395107.1|1078231_1078825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134397.1|1078821_1079529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221010.1|1079528_1080041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221012.1|1081215_1081566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395109.1|1081565_1081775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134399.1|1081771_1081921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221013.1|1081921_1082194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221014.1|1082203_1083037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134400.1|1083574_1083970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395781.1|1084102_1084738_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011221017.1|1084764_1085238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221018.1|1085262_1085754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172635987.1|1085746_1085923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395111.1|1085937_1087653_-	hypothetical protein	NA	A0A2I7RNF8	Vibrio_phage	40.7	2.9e-122
WP_157134401.1|1087639_1087807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221020.1|1087806_1088097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134402.1|1088093_1088270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221021.1|1088411_1088675_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157134403.1|1090160_1090328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221024.1|1090379_1090652_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_006229719.1|1090644_1090908_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_011221026.1|1091549_1092206_+	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_011221027.1|1092381_1092777_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011221028.1|1093120_1093444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006229715.1|1093647_1094523_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	34.8	3.2e-29
WP_041395114.1|1094756_1095296_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_011221030.1|1095343_1095640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221031.1|1095855_1097022_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	44.3	1.9e-08
WP_006229711.1|1097500_1098427_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081470403.1|1098718_1100005_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
1109027:1109045	attR	AGTTTTGCAGATGTGCAAA	NA	NA	NA	NA
>prophage 5
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1282414	1339551	2237943	transposase	Streptococcus_phage(11.11%)	51	NA	NA
WP_041395171.1|1282414_1284025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011221199.1|1284106_1284565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157134407.1|1284725_1285427_-	methyltransferase domain-containing protein	NA	A0A1X9I669	Streptococcus_phage	23.9	1.6e-07
WP_041395173.1|1285636_1285843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221201.1|1286039_1286579_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_172635988.1|1287144_1287564_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011218608.1|1287697_1288984_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011221203.1|1289114_1289363_-	hypothetical protein	NA	U3PFK6	Vibrio_phage	49.1	3.1e-09
WP_011221204.1|1289683_1290271_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	34.3	1.4e-23
WP_086000076.1|1290364_1291938_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.8	9.4e-11
WP_011221207.1|1291949_1292657_-	CHASE3 domain-containing protein	NA	NA	NA	NA	NA
WP_011221208.1|1292832_1293177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086000077.1|1293173_1294608_+|transposase	IS66-like element ISPpr14 family transposase	transposase	NA	NA	NA	NA
WP_041395818.1|1295113_1296061_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_011221211.1|1296740_1297901_+	MFS transporter	NA	NA	NA	NA	NA
WP_081470447.1|1298631_1300167_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	2.7e-47
WP_011221213.1|1300342_1301335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221214.1|1301438_1301924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221215.1|1301928_1302975_+	porin	NA	A0A1C3NFI8	Phage_NCTB	33.2	8.4e-16
WP_041395823.1|1303253_1304159_-	ROK family protein	NA	NA	NA	NA	NA
WP_011221217.1|1304502_1304718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221218.1|1304881_1305304_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221219.1|1305638_1306634_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011221220.1|1306733_1307327_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011221221.1|1307326_1308973_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_011221222.1|1308965_1310354_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_011221223.1|1310683_1312069_-|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.4	1.4e-50
WP_011221224.1|1312210_1312549_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011221225.1|1312541_1313354_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_041395827.1|1313901_1315056_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011221227.1|1315145_1316168_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011221228.1|1316189_1316849_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011221229.1|1316937_1318944_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_011221230.1|1319120_1320113_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_041395177.1|1320205_1321591_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_011221232.1|1321590_1322934_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_011221233.1|1323279_1323774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221235.1|1325578_1326643_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_011221236.1|1326902_1327154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221237.1|1327545_1328022_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221238.1|1328154_1328577_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011221239.1|1328709_1329162_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_041395181.1|1329638_1330658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395183.1|1330815_1331886_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011221242.1|1332249_1333227_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_041395829.1|1333316_1333799_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.4	2.8e-22
WP_011221244.1|1333944_1334505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395185.1|1334685_1335705_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_011221246.1|1335904_1337002_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_041395186.1|1337190_1337718_+	DUF3087 domain-containing protein	NA	NA	NA	NA	NA
WP_041395831.1|1338573_1339551_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	28.3	3.9e-31
>prophage 6
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1348084	1394264	2237943	protease,tRNA,integrase,transposase	uncultured_Caudovirales_phage(14.29%)	45	1348543:1348557	1376293:1376307
WP_011221259.1|1348084_1349209_-|transposase	ISAs1-like element ISPpr12 family transposase	transposase	NA	NA	NA	NA
1348543:1348557	attL	TATCACCGCTGAATT	NA	NA	NA	NA
WP_011221260.1|1349927_1350176_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011221261.1|1350165_1350456_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.7	1.9e-18
WP_011218608.1|1351008_1352295_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_157134408.1|1354298_1354472_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_011221264.1|1354595_1355495_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006229498.1|1355501_1356377_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_172636005.1|1356376_1357138_-	metal ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.8	2.4e-12
WP_011221266.1|1357137_1358097_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011221267.1|1358163_1358748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221268.1|1358744_1359077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395838.1|1359203_1360040_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_011221270.1|1360148_1360685_-	DUF2271 domain-containing protein	NA	NA	NA	NA	NA
WP_011221271.1|1360724_1361351_-	PepSY-associated TM helix domain-containing protein	NA	NA	NA	NA	NA
WP_049789014.1|1361672_1362098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395193.1|1362225_1362879_+	DedA family protein	NA	NA	NA	NA	NA
WP_011221274.1|1362950_1364117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395842.1|1364122_1364737_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011221276.1|1364805_1365210_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011221277.1|1365206_1365740_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011221278.1|1365739_1367104_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011221279.1|1367106_1367889_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_011221280.1|1368283_1370380_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011218428.1|1370662_1371694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011221281.1|1372075_1372996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041395843.1|1373846_1375292_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011221283.1|1375703_1377077_+|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	31.7	2.3e-37
1376293:1376307	attR	AATTCAGCGGTGATA	NA	NA	NA	NA
WP_006230040.1|1377373_1377754_+	PH domain-containing protein	NA	A5GZ63	Lactococcus_phage	45.3	1.3e-06
WP_011221284.1|1377862_1378411_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_041395845.1|1378630_1379260_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	38.0	2.3e-24
WP_041395847.1|1379339_1379723_-	DoxX family protein	NA	NA	NA	NA	NA
WP_049789060.1|1380033_1381056_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_041395196.1|1381324_1382722_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.5	3.9e-53
WP_172635989.1|1382953_1383175_-	DUF2986 domain-containing protein	NA	NA	NA	NA	NA
WP_011221290.1|1383614_1385525_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_011221291.1|1385908_1386382_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_081470408.1|1386495_1387503_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_049789015.1|1387650_1388151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221294.1|1388143_1388467_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_011221296.1|1389400_1389715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395197.1|1391426_1392044_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_011221300.1|1392070_1392409_-	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_041395199.1|1392465_1393047_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_081470448.1|1393333_1393726_+	DoxX family protein	NA	NA	NA	NA	NA
WP_041393917.1|1393835_1394264_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
>prophage 7
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1416976	1450153	2237943	terminase,capsid,portal,protease,integrase,transposase,tail,head	Burkholderia_phage(18.75%)	37	1408451:1408466	1431184:1431199
1408451:1408466	attL	GAAGGTGAGATTGTTG	NA	NA	NA	NA
WP_011221325.1|1416976_1418218_+|integrase	integrase family protein	integrase	A5LH57	Enterobacteria_phage	35.8	2.6e-72
WP_011221326.1|1418387_1419437_-	hypothetical protein	NA	R9TG40	Synechococcus_phage	48.5	2.2e-08
WP_041395210.1|1419433_1419865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221328.1|1419867_1423752_-	hypothetical protein	NA	C4ML20	Xanthomonas_virus	25.1	3.3e-57
WP_049789019.1|1423739_1424132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221329.1|1424131_1424608_-	DUF1833 domain-containing protein	NA	Q52PL0	Xanthomonas_phage	27.9	1.1e-10
WP_011221330.1|1424608_1424968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221331.1|1424964_1427370_-|tail	phage tail length tape measure family protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	26.6	3.3e-47
WP_011221332.1|1427366_1427675_-	DUF1799 domain-containing protein	NA	A0A1S5R1G7	Pseudomonas_phage	41.1	5.5e-08
WP_011221333.1|1427692_1428067_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_011221334.1|1428076_1428715_-|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	47.7	2.5e-47
WP_157134412.1|1428724_1429084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395212.1|1429080_1429578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221337.1|1429574_1429895_-|head	phage head closure protein	head	A0A088F713	Idiomarinaceae_phage	26.5	3.5e-05
WP_011221338.1|1429894_1430212_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_049789020.1|1430217_1430421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221340.1|1430479_1431742_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	47.7	1.9e-99
1431184:1431199	attR	CAACAATCTCACCTTC	NA	NA	NA	NA
WP_157134413.1|1431755_1432553_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	C7BGG9	Burkholderia_phage	46.1	6.6e-45
WP_041395215.1|1432539_1433805_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	34.0	5.2e-52
WP_041395216.1|1433805_1435473_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	52.2	4.7e-162
WP_011221344.1|1435475_1435904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221345.1|1436078_1436393_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	47.2	1.6e-10
WP_041395218.1|1436611_1437013_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011221347.1|1437003_1437675_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011221348.1|1437939_1438479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395220.1|1438592_1439054_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011221350.1|1439199_1439673_-	GrpB family protein	NA	NA	NA	NA	NA
WP_041393917.1|1440362_1440791_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_041395222.1|1442110_1442590_-	hypothetical protein	NA	A0A2I7RHR1	Vibrio_phage	85.9	4.2e-71
WP_011221353.1|1442586_1443147_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7RHK5	Vibrio_phage	73.9	1.2e-74
WP_011221354.1|1443188_1443440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221355.1|1443812_1444307_-	YcxB family protein	NA	NA	NA	NA	NA
WP_011221356.1|1445114_1445912_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221357.1|1445990_1446299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221358.1|1446724_1447063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170107630.1|1447430_1447583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220284.1|1448866_1450153_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1509245	1541676	2237943	protease,transposase	Emiliania_huxleyi_virus(100.0%)	25	NA	NA
WP_011218608.1|1509245_1510532_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011221405.1|1510644_1512321_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_041395245.1|1512464_1513475_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_041395877.1|1513694_1514612_-	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_011220284.1|1515256_1516543_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_041395246.1|1518021_1519632_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011221411.1|1521384_1522437_-	alkene reductase	NA	NA	NA	NA	NA
WP_041395248.1|1522594_1523176_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157134415.1|1523298_1523475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221413.1|1523516_1523780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221414.1|1523928_1524501_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221415.1|1524952_1525720_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_041395249.1|1525732_1526446_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_011221417.1|1526433_1529496_+	tetrathionate reductase subunit TtrA	NA	NA	NA	NA	NA
WP_157134473.1|1530120_1531113_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_011221419.1|1531857_1533099_+	cytosine permease	NA	NA	NA	NA	NA
WP_011221420.1|1533119_1534409_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_011221421.1|1534551_1535757_-|protease	serine protease	protease	V5LQ56	Emiliania_huxleyi_virus	26.8	1.2e-13
WP_011221422.1|1535980_1536466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395251.1|1536507_1537392_-|transposase	IS1595-like element ISPpr5 family transposase	transposase	NA	NA	NA	NA
WP_011221424.1|1537713_1538718_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_157134416.1|1538984_1539236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221426.1|1539557_1540106_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_011221427.1|1540115_1540340_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011218608.1|1540389_1541676_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1545027	1600165	2237943	integrase,transposase	Sulfolobus_monocaudavirus(18.18%)	56	1540378:1540396	1606401:1606419
1540378:1540396	attL	AACCATAGGTATCTACACA	NA	NA	NA	NA
WP_086000079.1|1545027_1546601_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.8	1.2e-10
WP_011221432.1|1546838_1547102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221433.1|1547112_1547442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081470413.1|1548085_1548589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041395255.1|1548547_1549432_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011221436.1|1550469_1550850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221437.1|1550980_1551406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221438.1|1551407_1551836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134417.1|1552672_1552885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221439.1|1552884_1553772_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	25.6	1.9e-21
WP_011221440.1|1553768_1554821_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011221444.1|1557257_1557557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221445.1|1558195_1558573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221446.1|1558666_1560004_-	GTPase HflX	NA	NA	NA	NA	NA
WP_011221447.1|1560175_1560649_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_011221448.1|1560652_1560943_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_011221449.1|1561193_1563005_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	31.8	1.1e-63
WP_011221450.1|1563234_1564632_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011221451.1|1564922_1566254_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_172635969.1|1567371_1568406_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011221454.1|1568983_1570060_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011221455.1|1570158_1571271_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_086000081.1|1571506_1571764_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011221457.1|1572172_1573441_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	23.3	3.8e-10
WP_011221458.1|1573585_1574764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221459.1|1575476_1576445_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_041395264.1|1576503_1577385_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221461.1|1577478_1577901_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_041395889.1|1577987_1578470_+	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_011221463.1|1578640_1579627_-	arginase family protein	NA	NA	NA	NA	NA
WP_086000092.1|1579657_1580170_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041393917.1|1580303_1580732_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_006230267.1|1581333_1581723_+	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_011221465.1|1581954_1582716_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011221466.1|1582841_1583168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221467.1|1583188_1583650_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157134418.1|1583940_1584978_-	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_041395267.1|1585007_1586060_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011221470.1|1586337_1587231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221471.1|1587264_1588161_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041395269.1|1588365_1588677_+	monooxygenase	NA	NA	NA	NA	NA
WP_011221473.1|1588681_1589053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221474.1|1589312_1589813_+	DUF917 family protein	NA	NA	NA	NA	NA
WP_041395273.1|1590650_1590869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221475.1|1590921_1591470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172635990.1|1591742_1591892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221476.1|1591996_1592362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221477.1|1592387_1592750_-	VRR-NUC domain-containing protein	NA	A0A1B1IMH1	Lactococcus_phage	38.5	5.9e-09
WP_011221478.1|1593334_1594897_-	AAA family ATPase	NA	A0A2I7R721	Vibrio_phage	39.0	5.2e-78
WP_065814494.1|1594893_1595748_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	44.7	4.7e-49
WP_041395275.1|1595734_1595947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221480.1|1595960_1596743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221482.1|1597023_1597554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395277.1|1597550_1598354_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	34.9	1.1e-31
WP_041393917.1|1598560_1598989_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_172635948.1|1599130_1600165_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	66.0	9.5e-12
1606401:1606419	attR	AACCATAGGTATCTACACA	NA	NA	NA	NA
>prophage 10
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1606939	1644287	2237943	transposase	Leptospira_phage(42.86%)	29	NA	NA
WP_011221488.1|1606939_1608550_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157134474.1|1608837_1609872_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_086000049.1|1610873_1612446_+|transposase	IS3-like element ISPpr7 family transposase	transposase	U5P429	Shigella_phage	30.8	9.4e-11
WP_011221491.1|1612758_1613967_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_011221493.1|1614502_1615012_-	porin family protein	NA	NA	NA	NA	NA
WP_011221494.1|1615461_1616514_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	2.1e-43
WP_011221495.1|1616772_1617456_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_011221496.1|1617847_1619143_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011221497.1|1619588_1620896_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_041395292.1|1621526_1621706_-	ATPase	NA	NA	NA	NA	NA
WP_157134421.1|1621842_1622148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221500.1|1622428_1623571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218058.1|1623589_1625134_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.3	6.5e-65
WP_011218059.1|1625242_1625590_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_011218334.1|1626753_1627050_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041395294.1|1627124_1627367_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011221502.1|1627517_1628540_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.6	3.8e-37
WP_011221503.1|1628660_1629467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221504.1|1629715_1630804_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_011217183.1|1631240_1632464_-|transposase	IS4-like element ISPpr1 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	50.9	2.4e-102
WP_011221506.1|1632515_1632902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221508.1|1633660_1635643_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_041395296.1|1635626_1636655_-	glutathione synthase	NA	NA	NA	NA	NA
WP_011221510.1|1636778_1637129_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_011221511.1|1637294_1638155_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_172635992.1|1638471_1638633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011218334.1|1638817_1639114_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_011218059.1|1639113_1639461_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.1	1.7e-21
WP_157134464.1|1643252_1644287_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1672297	1719532	2237943	tRNA,transposase	Sulfolobus_monocaudavirus(28.57%)	40	NA	NA
WP_172635969.1|1672297_1673332_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081470418.1|1673360_1674647_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011221548.1|1675367_1676318_+|transposase	IS1595-like element ISPpr6 family transposase	transposase	NA	NA	NA	NA
WP_041395319.1|1676774_1677482_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221550.1|1677520_1678306_+	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_011221551.1|1678315_1679494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221552.1|1679514_1679796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041393917.1|1679874_1680303_+|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011221553.1|1680834_1681602_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	24.7	2.4e-12
WP_011221554.1|1681614_1682529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221555.1|1682534_1684844_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011221557.1|1685644_1686130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011221558.1|1686383_1687247_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041395324.1|1688009_1688567_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041395326.1|1688614_1690450_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.2	1.1e-13
WP_011221562.1|1690446_1691862_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_011221563.1|1692629_1693052_+	GrdX family protein	NA	NA	NA	NA	NA
WP_081470419.1|1693155_1694454_-	glycine/betaine/sarcosine/D-proline family reductase selenoprotein B	NA	NA	NA	NA	NA
WP_041395331.1|1694467_1695760_-	glycine/sarcosine/betaine reductase component B subunit	NA	NA	NA	NA	NA
WP_081470420.1|1695832_1696879_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_011221567.1|1697014_1698211_-	glycine/sarcosine/betaine reductase complex protein C subunit alpha	NA	NA	NA	NA	NA
WP_011221568.1|1698223_1699759_-	ketoacyl-ACP synthase III family protein	NA	NA	NA	NA	NA
WP_081470449.1|1699864_1700329_-	glycine/sarcosine/betaine reductase complex selenoprotein A	NA	NA	NA	NA	NA
WP_081450071.1|1700343_1700829_-	glycine/sarcosine/betaine reductase complex selenoprotein A	NA	NA	NA	NA	NA
WP_011221570.1|1700930_1701257_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011221571.1|1701266_1702478_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	43.7	3.8e-68
WP_011221572.1|1703459_1704872_+	aminopeptidase	NA	NA	NA	NA	NA
WP_011221573.1|1705097_1705454_-	DsrE family protein	NA	NA	NA	NA	NA
WP_011221574.1|1705589_1706381_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_172635994.1|1706415_1706652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221576.1|1707133_1707553_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_011221577.1|1707588_1709103_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	4.9e-17
WP_011221578.1|1709099_1710089_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_011221579.1|1710188_1711067_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.9	2.3e-06
WP_011221580.1|1711222_1712143_+	ribokinase	NA	NA	NA	NA	NA
WP_011221581.1|1712286_1713288_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041395337.1|1713408_1714143_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_011221584.1|1715456_1716689_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041393917.1|1716870_1717299_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_081470421.1|1718245_1719532_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1788665	1918963	2237943	holin,integrase,transposase	uncultured_marine_virus(19.05%)	101	1806709:1806724	1876459:1876478
WP_011221656.1|1788665_1789694_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011221658.1|1790354_1790921_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_041395368.1|1791059_1791368_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011221660.1|1791475_1792816_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011221661.1|1792825_1793593_+	oxidoreductase	NA	M1PY53	Moumouvirus	37.5	5.8e-06
WP_011221662.1|1793608_1794757_+	radical SAM protein	NA	NA	NA	NA	NA
WP_011221663.1|1794885_1795506_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011221666.1|1797647_1798739_-	alkene reductase	NA	NA	NA	NA	NA
WP_041395370.1|1798741_1799845_-	alkene reductase	NA	NA	NA	NA	NA
WP_041395372.1|1799971_1800853_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221670.1|1801779_1802310_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049789033.1|1802937_1803459_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	41.8	9.3e-32
WP_011221673.1|1803743_1804112_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041395375.1|1804345_1804909_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011221675.1|1804921_1805506_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011221676.1|1806248_1806599_+	DUF3316 domain-containing protein	NA	NA	NA	NA	NA
1806709:1806724	attL	GTTGTTCAAAAAGAGT	NA	NA	NA	NA
WP_081470427.1|1806901_1807603_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	9.5e-40
1806709:1806724	attL	GTTGTTCAAAAAGAGT	NA	NA	NA	NA
WP_011221679.1|1807937_1808231_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_011221681.1|1809666_1810092_-	riboflavin-specific deaminase	NA	A0A2I2L4R9	Orpheovirus	35.9	1.6e-18
WP_011221682.1|1810675_1810972_-	Dabb family protein	NA	NA	NA	NA	NA
WP_041395378.1|1811050_1811803_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_081470428.1|1811814_1812207_-	heme-binding protein	NA	NA	NA	NA	NA
WP_011221685.1|1812313_1813009_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041395380.1|1814271_1814910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221687.1|1815105_1815474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134428.1|1815473_1815740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395386.1|1816113_1816359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789034.1|1816355_1816631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395388.1|1816726_1817026_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.5	1.5e-18
WP_041395390.1|1817098_1818073_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	48.8	1.0e-87
WP_041395392.1|1818252_1819425_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011221693.1|1819584_1822656_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	23.8	3.4e-17
WP_011221694.1|1822652_1823738_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011221695.1|1823740_1824808_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011221696.1|1825422_1826646_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011221697.1|1826638_1827016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395395.1|1827214_1828228_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221699.1|1828237_1828750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221700.1|1829042_1829978_+	universal stress protein	NA	NA	NA	NA	NA
WP_011221701.1|1830304_1831792_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.7	3.1e-24
WP_011217183.1|1834045_1835269_-|transposase	IS4-like element ISPpr1 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	50.9	2.4e-102
1833970:1833985	attR	ACTCTTTTTGAACAAC	NA	NA	NA	NA
WP_011220747.1|1835300_1836566_+|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
1833970:1833985	attR	ACTCTTTTTGAACAAC	NA	NA	NA	NA
WP_041395397.1|1836572_1837187_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_011221704.1|1837720_1838518_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221357.1|1838596_1838905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221705.1|1839385_1840273_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	25.6	1.9e-21
WP_011220948.1|1840269_1841322_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_041395399.1|1841544_1843155_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157134429.1|1844035_1844203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395402.1|1844256_1844790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221711.1|1844930_1846154_+|transposase	IS4-like element ISPpr1 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	50.9	3.1e-102
WP_011221710.1|1846267_1846774_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011221711.1|1846839_1848063_+|transposase	IS4-like element ISPpr1 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	50.9	3.1e-102
WP_011221713.1|1849987_1850524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221714.1|1850535_1851036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157134430.1|1852578_1852851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011220284.1|1853073_1854360_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
WP_011221717.1|1855125_1855512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081470432.1|1856727_1857951_+|transposase	IS4-like element ISPpr1 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	50.7	4.0e-102
WP_041395406.1|1859755_1861366_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011221723.1|1863330_1863750_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011221724.1|1863914_1865357_+	cytochrome P450	NA	A0A0B5JAC4	Pandoravirus	29.7	4.4e-07
WP_011221726.1|1866310_1867354_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	54.1	3.2e-100
WP_011221727.1|1867720_1868050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157134431.1|1868366_1869374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086000053.1|1869420_1870856_-|transposase	IS66-like element ISPpr14 family transposase	transposase	NA	NA	NA	NA
WP_157134432.1|1870956_1871952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221730.1|1872236_1873403_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_041395410.1|1873454_1875224_-	Na+:solute symporter	NA	NA	NA	NA	NA
WP_011217584.1|1875393_1876344_-|transposase	IS1595-like element ISPpr6 family transposase	transposase	NA	NA	NA	NA
WP_041395413.1|1876685_1878917_-	exopolygalacturonate lyase	NA	NA	NA	NA	NA
WP_041395415.1|1878931_1879630_-	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_041395417.1|1879919_1880684_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221735.1|1880819_1882127_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_041395965.1|1882139_1882634_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_041395420.1|1882737_1883727_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011221738.1|1883764_1884604_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_011221739.1|1884871_1885495_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011221740.1|1885506_1886436_-	sugar kinase	NA	NA	NA	NA	NA
WP_041395422.1|1886624_1887260_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_011221742.1|1887302_1887623_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041395424.1|1887641_1888157_-	YgjV family protein	NA	NA	NA	NA	NA
WP_011221744.1|1888191_1888953_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.8	2.6e-19
WP_011221745.1|1889211_1889997_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_011221746.1|1890074_1891943_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011221747.1|1891945_1892656_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_157134433.1|1892741_1894520_-|holin	choline/carnitine O-acyltransferase	holin	NA	NA	NA	NA
WP_011221749.1|1894726_1895929_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.7	3.0e-25
WP_011221750.1|1895931_1896780_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_011221751.1|1896924_1897875_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_011221752.1|1898021_1899728_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	1.1e-57
WP_041395426.1|1901331_1901925_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_011221755.1|1902620_1904669_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	30.4	1.1e-06
WP_011221756.1|1904722_1905904_-	quorum-sensing autoinducer synthase	NA	NA	NA	NA	NA
WP_041395429.1|1906307_1908137_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	81.0	7.3e-15
WP_172635995.1|1908253_1908682_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011221758.1|1909132_1909504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221759.1|1909518_1910181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065814495.1|1910344_1916866_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_157134434.1|1917196_1917400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011220917.1|1917352_1918963_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NC_006371	Photobacterium profundum SS9 chromosome 2, complete sequence	2237943	1932285	1964598	2237943	transposase	Streptococcus_phage(14.29%)	28	NA	NA
WP_049789038.1|1932285_1932981_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.8	2.8e-36
WP_041395435.1|1934522_1934720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221774.1|1934816_1936400_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041395437.1|1936389_1936584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011221775.1|1936947_1937388_+	thioredoxin TrxC	NA	A0A191VYQ9	Roseobacter_phage	27.8	1.5e-06
WP_011221776.1|1937661_1938897_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_041395439.1|1939428_1940289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011221778.1|1940303_1940750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011221779.1|1940837_1941539_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041395442.1|1941790_1942702_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_065814496.1|1942802_1944011_-|transposase	IS4-like element ISPpr2 family transposase	transposase	NA	NA	NA	NA
WP_157134478.1|1944255_1944681_+	DUF3429 family protein	NA	NA	NA	NA	NA
WP_011218617.1|1945144_1945354_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	65.7	1.2e-17
WP_011221784.1|1945695_1947081_-|transposase	IS4-like element ISPpr3 family transposase	transposase	Q9JMP3	Wolbachia_phage	29.4	4.8e-51
WP_172635948.1|1947256_1948291_+|transposase	IS630 family transposase	transposase	M4M9P8	Vibrio_phage	66.0	9.5e-12
WP_041393917.1|1948662_1949091_-|transposase	IS200/IS605-like element ISPpr13 family transposase	transposase	A0A0N9PD00	Sulfolobus_monocaudavirus	35.0	1.6e-18
WP_011221785.1|1949258_1950188_-	carbamate kinase	NA	NA	NA	NA	NA
WP_041395977.1|1952429_1953284_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011221789.1|1953384_1954668_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	5.8e-27
WP_011221790.1|1954669_1955560_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_011221791.1|1955620_1956619_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011221792.1|1957012_1957822_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_011221793.1|1957953_1959126_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011221794.1|1959115_1960183_+	DUF2955 domain-containing protein	NA	NA	NA	NA	NA
WP_041395445.1|1960274_1961165_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041395447.1|1961223_1961433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041395448.1|1961432_1962671_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011220284.1|1963311_1964598_-|transposase	IS4-like element ISPpr4 family transposase	transposase	NA	NA	NA	NA
