The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	241499	306428	4809037	tRNA,protease,plate,transposase	uncultured_Mediterranean_phage(11.11%)	52	NA	NA
WP_000753959.1|241499_242927_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.1e-25
WP_000929458.1|243079_244237_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272193.1|244325_244712_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186669.1|246297_247122_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094518.1|247151_249824_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018214.1|249936_250731_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246886.1|251180_251906_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000808106.1|252163_253015_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224567.1|253159_253885_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622423.1|254031_254589_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811892.1|254730_255927_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000947409.1|256239_256998_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	2.5e-25
WP_000922422.1|257010_257868_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000949016.1|257879_259232_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240921.1|259263_261675_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758966.1|261797_262283_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139265.1|262286_263312_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|263417_263873_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000566033.1|263876_264665_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000741216.1|264664_265813_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569412.1|265809_266406_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_001294828.1|266429_269912_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	4.8e-209
WP_000055753.1|269924_270884_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000502118.1|271075_271534_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_001021059.1|273612_275754_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901086.1|275809_276199_+	VOC family protein	NA	NA	NA	NA	NA
WP_000210062.1|276261_277554_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062330.1|277637_277898_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000955207.1|277884_278103_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185319.1|278282_278828_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000560526.1|278824_279247_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000252574.1|279278_279980_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000502118.1|280087_280546_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_001260683.1|280764_282483_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000093978.1|282593_283301_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202315.1|283297_283702_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874217.1|283820_284636_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287483.1|284674_285328_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594016.1|285320_286352_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
WP_001140158.1|286541_287108_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000154870.1|292893_293697_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.7e-38
WP_000648539.1|293717_294632_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127546.1|294736_295912_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230964.1|296043_296844_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207227.1|296921_297692_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|297747_299115_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052766.1|299186_299942_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801233.1|299976_300699_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|300695_301163_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|301226_301958_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000145233.1|303552_304548_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371495.1|304544_306428_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	930309	937621	4809037	protease,integrase	Dickeya_phage(16.67%)	7	931560:931574	942739:942753
WP_001201759.1|930309_931428_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|931424_933371_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931560:931574	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|933500_933722_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|934045_934366_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|934396_936673_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|936884_937082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|937243_937621_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942739:942753	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 3
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	1008746	1085795	4809037	protease,holin,tail,terminase,transposase,integrase	Salmonella_phage(76.67%)	92	990825:990844	1061156:1061175
990825:990844	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_001262313.1|1008746_1010039_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|1010083_1010332_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|1010372_1010612_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|1010617_1011499_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|1011495_1012560_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|1012637_1013318_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|1013314_1014100_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|1014105_1014402_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|1014492_1014693_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|1014981_1015386_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|1015515_1015752_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|1015717_1016092_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|1016176_1017160_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|1017162_1017912_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1017922_1018270_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1018266_1018791_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1018790_1019264_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|1019267_1019840_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000509711.1|1020685_1020865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|1020875_1021373_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|1021557_1021797_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001804676.1|1021852_1022092_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929790.1|1022131_1022734_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|1022942_1023554_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|1023550_1023697_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|1023686_1024484_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|1024882_1025008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|1025143_1025593_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|1025809_1026199_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|1026185_1026467_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|1026466_1027081_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_001050879.1|1027077_1027617_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	38.4	2.5e-08
WP_000495544.1|1027659_1028037_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|1028133_1028361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|1028450_1029203_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|1029168_1030572_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113512.1|1030571_1032038_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	96.7	6.4e-272
WP_000184964.1|1031928_1032663_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.6	2.3e-100
WP_000873168.1|1032677_1033898_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	1.2e-199
WP_001066732.1|1033901_1034408_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
WP_000627487.1|1034419_1035361_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	3.2e-155
WP_001040696.1|1035401_1035770_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	87.7	8.8e-53
WP_000042171.1|1035735_1036143_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	9.7e-69
WP_000008731.1|1036139_1036694_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.7	8.0e-66
WP_001142480.1|1036680_1037070_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_000503648.1|1037044_1037608_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.7e-79
WP_000046938.1|1037611_1038757_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
WP_000109249.1|1038767_1039208_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393954.1|1039211_1039664_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_000990884.1|1039841_1041830_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
WP_010989141.1|1041829_1042417_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	1.5e-83
WP_000155119.1|1042416_1042719_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_000081737.1|1042721_1043789_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.8	7.7e-158
WP_000758867.1|1043788_1044142_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.5	1.0e-29
WP_000050470.1|1044291_1045023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110002.1|1045022_1045451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301087.1|1045515_1046268_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.5	3.2e-86
WP_001270632.1|1046267_1046621_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197078.1|1046620_1047820_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	93.0	3.2e-205
WP_000049938.1|1047816_1048497_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|1048496_1050008_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|1050022_1050541_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_000480169.1|1051462_1052164_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000193884.1|1053180_1055793_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000291724.1|1056000_1057011_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1057176_1057719_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224084.1|1057715_1058825_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086472.1|1058923_1061032_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000053045.1|1061044_1062952_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061156:1061175	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1062966_1064220_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1064224_1065865_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1065861_1066425_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001764860.1|1066678_1066846_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1066945_1067464_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156455.1|1067532_1069293_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877174.1|1069478_1069931_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_010989142.1|1070002_1071055_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1071409_1071919_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202371.1|1072135_1072741_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950867.1|1072727_1074881_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1074899_1075346_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420526.1|1075469_1077524_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1077559_1078018_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1078112_1078775_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1078948_1079362_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1079406_1079724_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140485.1|1079781_1080993_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000502118.1|1082124_1082583_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000072884.1|1083319_1083601_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1083597_1083927_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1084013_1084673_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000502118.1|1085336_1085795_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	1529646	1603243	4809037	tRNA,protease,plate,tail,transposase,capsid,integrase	Burkholderia_virus(39.02%)	89	1519976:1519991	1575848:1575863
1519976:1519991	attL	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000502119.1|1529646_1530105_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000431187.1|1530061_1530244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001766314.1|1530637_1530889_+	acid shock protein	NA	NA	NA	NA	NA
WP_000549642.1|1531157_1531979_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|1532013_1532343_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|1532329_1532692_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118268.1|1533108_1534143_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|1534317_1535706_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|1535716_1537246_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|1537772_1538717_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|1538898_1539288_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988475.1|1539259_1539712_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
WP_010989166.1|1539701_1539917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|1539906_1540137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|1540133_1540817_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_153781233.1|1540813_1541014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|1541021_1541405_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|1541401_1541704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|1541713_1541986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|1542274_1542805_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|1542832_1543102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|1543104_1544271_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000990529.1|1544281_1546051_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_000567456.1|1546054_1546219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001765083.1|1546228_1546660_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
WP_100208317.1|1546655_1547252_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|1547495_1547846_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_000264664.1|1548560_1549211_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|1549207_1549534_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|1549533_1549845_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|1549844_1550390_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_029246253.1|1550449_1551982_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000090679.1|1551981_1553478_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|1553458_1554280_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135515.1|1554282_1554741_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.2e-30
WP_001273072.1|1554955_1556071_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|1556085_1557039_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000537457.1|1557048_1557387_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|1557388_1557835_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|1557834_1558299_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_001789770.1|1558295_1558550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|1558539_1559967_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_162828734.1|1559963_1560488_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000110118.1|1560490_1560772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|1560869_1561205_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|1561149_1561287_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|1561380_1563846_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|1563845_1564730_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_010989167.1|1564726_1564942_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|1564929_1566084_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|1566080_1566608_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|1566664_1567012_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|1567002_1568106_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|1568098_1568677_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_000002046.1|1568679_1569705_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
WP_001802272.1|1569715_1570219_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	2.3e-43
WP_001057643.1|1570218_1570836_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_024131174.1|1570842_1571319_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	1.9e-44
WP_024134057.1|1571329_1571791_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	53.9	5.9e-38
WP_024131173.1|1571801_1572275_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.0	4.3e-36
WP_001165548.1|1572346_1572919_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|1573198_1574581_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|1574642_1574978_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|1575104_1575836_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000924582.1|1575900_1576200_-	hypothetical protein	NA	NA	NA	NA	NA
1575848:1575863	attR	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000824321.1|1576316_1577468_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|1577620_1579327_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001681605.1|1579437_1580739_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|1580814_1581744_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|1581740_1583144_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|1583311_1584958_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|1585157_1586333_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|1586435_1587944_+	YdgA family protein	NA	NA	NA	NA	NA
WP_077949083.1|1588064_1588283_+	PTS maltose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000565566.1|1588649_1589651_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_000998242.1|1589724_1590765_-	oxidoreductase	NA	NA	NA	NA	NA
WP_031608772.1|1590972_1591098_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|1591396_1591612_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|1591700_1592141_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|1592217_1592799_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|1592798_1593377_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915582.1|1593369_1595391_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|1595391_1596450_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|1596453_1597074_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|1597076_1597769_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|1597768_1598404_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|1599004_1600510_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|1600614_1601220_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|1601968_1603243_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 5
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	1784275	1788687	4809037		Escherichia_phage(50.0%)	7	NA	NA
WP_000497451.1|1784275_1784515_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036668.1|1784726_1784891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|1785387_1786197_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|1786269_1786647_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|1786794_1787337_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|1787528_1788257_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|1788273_1788687_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	1887875	1935921	4809037	holin,tail,terminase,transposase,integrase	Salmonella_phage(33.93%)	67	1889181:1889196	1940034:1940049
WP_072073163.1|1887875_1888220_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	38.6	2.2e-13
1889181:1889196	attL	GCAAAAACCAGCGCTA	NA	NA	NA	NA
WP_000421106.1|1889470_1889989_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_001681975.1|1890003_1891515_-	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000049938.1|1891514_1892195_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001197093.1|1892191_1893391_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.2	2.5e-213
WP_001270647.1|1893391_1893745_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001685627.1|1893985_1894741_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001144794.1|1894799_1895228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050472.1|1895227_1895959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826019.1|1896153_1896489_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000042301.1|1896485_1897517_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000388505.1|1897519_1897822_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000346974.1|1897825_1898476_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000990867.1|1898475_1900428_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000389047.1|1900605_1901058_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000257259.1|1901061_1901502_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_001135544.1|1901513_1902659_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000389379.1|1902662_1903226_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001142488.1|1903200_1903590_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000008737.1|1903576_1904131_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001125675.1|1904127_1904535_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_001040702.1|1904500_1904869_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_000627464.1|1904910_1905852_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_000128060.1|1905863_1906361_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873166.1|1906365_1907598_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	98.5	3.4e-226
WP_000184960.1|1907612_1908347_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	84.7	4.4e-96
WP_000113484.1|1908237_1909704_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.4	1.8e-261
WP_000204763.1|1909703_1911107_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	3.2e-188
WP_001118116.1|1911072_1911822_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	73.3	5.8e-11
WP_000113284.1|1911879_1912065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001688324.1|1912208_1912601_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	83.7	7.4e-50
WP_001194115.1|1912584_1913061_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	1.0e-85
WP_049800165.1|1913064_1913400_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	89.2	4.0e-52
WP_129545669.1|1913569_1913785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208722.1|1913753_1914323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989188.1|1914556_1915114_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	77.9	3.9e-52
WP_000640149.1|1915386_1915941_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.0	1.3e-71
WP_000228038.1|1915937_1916228_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940304.1|1916227_1916827_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
WP_010989190.1|1916898_1917150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882663.1|1917388_1917601_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	9.6e-28
WP_001352368.1|1917992_1919201_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000556392.1|1919307_1920240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033794.1|1920236_1920791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000403774.1|1920889_1921246_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	2.0e-57
WP_001141111.1|1921303_1921726_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.7e-63
WP_000450685.1|1921741_1922503_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	1.2e-117
WP_000788994.1|1922525_1923272_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	2.0e-112
WP_000157974.1|1923278_1924067_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	3.9e-42
WP_000702025.1|1924144_1924567_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001033914.1|1924563_1924806_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|1924902_1925322_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_061450975.1|1925564_1925783_+	YdaF family protein	NA	M4QQ57	Salicola_phage	53.2	2.5e-07
WP_001005966.1|1925784_1925988_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	85.0	2.7e-11
WP_000560226.1|1926655_1926877_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245528.1|1926870_1927047_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_001452559.1|1927121_1927397_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_000102217.1|1927496_1930625_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	79.5	0.0e+00
WP_001004417.1|1930636_1931689_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	62.5	2.3e-114
WP_010989194.1|1931752_1931947_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_001356607.1|1931939_1932128_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001311878.1|1932234_1932516_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189090.1|1932481_1933558_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	6.9e-98
WP_000722366.1|1933932_1934286_-	YebY family protein	NA	NA	NA	NA	NA
WP_000979693.1|1934302_1935178_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_001681742.1|1935178_1935553_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1935690_1935921_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
1940034:1940049	attR	GCAAAAACCAGCGCTA	NA	NA	NA	NA
>prophage 7
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	2037937	2045171	4809037		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|2037937_2039368_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|2039441_2040137_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|2040216_2040528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|2041178_2042363_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|2042623_2042812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|2042822_2043035_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|2043480_2044749_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|2044751_2045171_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 8
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	2128913	2139420	4809037		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|2128913_2130227_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|2130253_2131333_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|2131337_2132111_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|2132126_2133101_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|2133106_2133658_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|2133658_2134537_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|2134584_2135484_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|2135483_2136569_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2136945_2137839_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|2138016_2139420_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 9
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	2215320	2224491	4809037	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|2215320_2217354_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|2217594_2218053_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2218224_2218755_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2218811_2219279_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|2219325_2220045_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272839.1|2220041_2221727_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.9	3.1e-278
WP_001240415.1|2221949_2222681_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2222740_2222848_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2222828_2223560_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2223543_2224491_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 10
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	2459775	2465806	4809037		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|2459775_2460717_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|2461959_2462349_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|2462317_2462572_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400611.1|2462588_2464511_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_106417236.1|2465500_2465644_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|2465659_2465806_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 11
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	2697637	2774301	4809037	tRNA,tail	Salmonella_phage(33.33%)	57	NA	NA
WP_000083348.1|2697637_2698375_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219176.1|2698504_2699839_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000188410.1|2700856_2701444_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2701505_2701889_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2702207_2702897_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2703012_2704050_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098738.1|2704253_2704673_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	2.6e-16
WP_000183640.1|2704745_2705426_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082656.1|2705479_2708140_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2708254_2709610_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2709654_2709978_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807800.1|2709974_2711276_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.9	2.2e-42
WP_000985648.1|2711379_2711835_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	1.9e-33
WP_001235094.1|2717995_2720569_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992642.1|2720698_2721430_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2721426_2722407_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197667.1|2722538_2723276_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2723547_2723886_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2723989_2724037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200079.1|2724136_2725297_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210976.1|2725257_2726166_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2726223_2727345_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2727354_2728425_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|2728864_2729383_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|2729375_2730596_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|2730752_2731100_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|2731140_2731908_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2731952_2732501_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2732519_2732768_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2733111_2734473_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2734638_2735430_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2735449_2736736_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001688360.1|2736856_2737414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2737495_2738086_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2738208_2739087_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880973.1|2739172_2740834_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2740982_2741321_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2741486_2741777_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2741766_2742243_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2742392_2742875_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237656.1|2743494_2754369_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533850.1|2754432_2755842_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196137.1|2755838_2757995_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989217.1|2758026_2759190_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010989218.1|2759732_2760506_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000380485.1|2760474_2760648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972389.1|2760909_2761128_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_001011760.1|2761218_2762319_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980381.1|2762315_2762801_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001282796.1|2762797_2765875_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|2765867_2765987_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001280897.1|2766001_2766304_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001207656.1|2766358_2766874_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046142.1|2766883_2768056_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_000905027.1|2768198_2768765_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_001221113.1|2769448_2770564_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111827.1|2770644_2774301_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 12
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	3092098	3135801	4809037	tRNA,protease,transposase,bacteriocin	Bacillus_virus(25.0%)	48	NA	NA
WP_001204111.1|3092098_3092557_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000034386.1|3092746_3093826_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000111274.1|3093927_3095091_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000218338.1|3095112_3096159_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000218564.1|3096532_3096958_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000124001.1|3096983_3097562_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000553254.1|3097562_3098270_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001775599.1|3098257_3098935_+	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000956919.1|3098928_3099585_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000502119.1|3099689_3100148_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000098658.1|3100336_3102328_-	transketolase	NA	NA	NA	NA	NA
WP_000701830.1|3102603_3103362_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000105550.1|3103462_3104383_-	agmatinase	NA	NA	NA	NA	NA
WP_001278580.1|3104610_3106587_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000729109.1|3106595_3106727_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_077905074.1|3106860_3107025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001803086.1|3107021_3107321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062140.1|3107376_3108531_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001113171.1|3109023_3110418_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000856775.1|3110496_3110994_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286121.1|3111089_3111797_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001800534.1|3111873_3112605_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593242.1|3112624_3113572_+	glutathione synthase	NA	NA	NA	NA	NA
WP_023888922.1|3113715_3114351_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_001285491.1|3114350_3114767_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000098333.1|3114813_3115500_-	global regulatory protein	NA	NA	NA	NA	NA
WP_001055657.1|3115629_3116610_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997790.1|3116627_3117332_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001094848.1|3117350_3117917_+	YggT family protein	NA	NA	NA	NA	NA
WP_001277205.1|3117913_3118204_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174773.1|3118211_3118805_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001096530.1|3118797_3119934_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000252198.1|3120024_3121032_-	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_000394189.1|3121164_3122211_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000502119.1|3122529_3122988_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000984827.1|3123110_3123830_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107559.1|3123879_3124206_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786887.1|3124205_3124925_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001148958.1|3125079_3126132_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091706.1|3126159_3126435_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000976287.1|3126547_3127633_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_001049802.1|3127849_3129106_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000234466.1|3131716_3132424_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001681938.1|3132765_3133050_+	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_071525158.1|3133399_3133579_+	type VI secretion system protein	NA	NA	NA	NA	NA
WP_001141622.1|3134699_3135017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000768134.1|3135013_3135280_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000421096.1|3135522_3135801_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 13
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	3512959	3550970	4809037	lysis,plate,head,terminase,tail,transposase,portal,capsid,integrase	Salmonella_phage(76.74%)	49	3507923:3507937	3520089:3520103
3507923:3507937	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|3512959_3514606_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|3514745_3514844_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|3515469_3516522_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|3516710_3516902_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|3516917_3517487_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|3517612_3517834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|3517866_3518376_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|3518383_3518680_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|3518797_3519139_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|3519206_3519440_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|3519439_3519667_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|3519663_3520521_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3520089:3520103	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|3520517_3522932_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|3523083_3523272_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|3523339_3523639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251693.1|3523747_3524626_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|3525239_3526154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|3526150_3526891_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|3526925_3527963_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|3527962_3529729_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|3529871_3530705_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|3530721_3531780_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|3531783_3532434_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|3532529_3532994_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|3532993_3533197_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3533200_3533416_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|3533396_3533909_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|3533910_3534288_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|3534284_3534713_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|3534808_3535240_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|3535232_3535679_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|3535747_3536326_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|3536322_3536682_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|3536668_3537577_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|3537569_3538175_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104804.1|3538171_3539686_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
WP_000805568.1|3539685_3540279_+|tail	tail assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|3540250_3540691_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_072075000.1|3540693_3541092_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.5	1.3e-12
WP_000905027.1|3541119_3541686_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|3541828_3543001_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|3543010_3543526_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|3543580_3543883_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|3543897_3544017_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282796.1|3544009_3547087_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980381.1|3547083_3547569_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|3547565_3548666_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|3548756_3548975_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000502113.1|3550556_3550970_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	4435338	4529794	4809037	lysis,plate,tail,head,terminase,portal,capsid,integrase	Salmonella_phage(82.0%)	106	4436511:4436527	4535024:4535040
WP_000089603.1|4435338_4436490_+|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	44.8	6.3e-49
4436511:4436527	attL	GTCATTTACGTGATTTA	NA	NA	NA	NA
WP_000455463.1|4436586_4437054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994659.1|4437265_4438141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001149494.1|4438328_4438691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214158.1|4438647_4439562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001768408.1|4439580_4440321_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000013624.1|4440299_4440986_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000253629.1|4441021_4441522_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000626967.1|4441531_4442101_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000071290.1|4442120_4444211_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_010989289.1|4444207_4444966_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_000252871.1|4445202_4445457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251281.1|4445456_4445696_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000949576.1|4445725_4446088_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_000848326.1|4446097_4446472_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_000086082.1|4446468_4447122_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001240640.1|4447121_4448021_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001165843.1|4448010_4449489_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000244536.1|4449475_4449925_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_000054770.1|4452915_4453302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000821941.1|4453456_4453849_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000838927.1|4453845_4454814_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_010989292.1|4454828_4456259_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000213770.1|4456591_4458097_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000993574.1|4458132_4458522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000623988.1|4458745_4458988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283067.1|4459392_4460640_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	6.0e-61
WP_000502502.1|4460624_4461266_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	1.1e-55
WP_010989295.1|4461476_4462019_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_000907593.1|4463284_4464205_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001020123.1|4464928_4465231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001103837.1|4465326_4465707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018145.1|4466077_4466287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979718.1|4466304_4466757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968700.1|4466753_4467050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000115421.1|4467127_4467586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4467674_4469624_+	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
WP_000881183.1|4469695_4470604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000022217.1|4470677_4471577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|4471651_4471978_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001222413.1|4472077_4472347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4472478_4473753_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001039750.1|4473972_4474350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|4474436_4474655_-	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011750.1|4474722_4475823_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_000980405.1|4475819_4476305_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_161976233.1|4476304_4478851_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000763315.1|4479077_4479197_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|4479211_4479514_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|4479568_4480084_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|4480093_4481266_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|4481368_4481587_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161708.1|4481800_4482523_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|4482720_4483128_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000104806.1|4483134_4484754_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_001086816.1|4484750_4485356_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000268327.1|4485348_4486257_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_000177408.1|4486243_4486603_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993749.1|4486599_4487178_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000343944.1|4487246_4487693_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039961.1|4487685_4488117_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_024131238.1|4488212_4488641_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|4488637_4489015_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001097942.1|4489019_4489529_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000171566.1|4489509_4489725_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_000868184.1|4489728_4489932_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673543.1|4489931_4490396_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	97.4	7.1e-84
WP_000059175.1|4490489_4491140_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|4491143_4492208_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|4492224_4493058_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098452.1|4493200_4494967_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.8	0.0e+00
WP_001681813.1|4494966_4496010_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_000080839.1|4496058_4496754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4496773_4497838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4497834_4498899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|4498908_4499127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|4499222_4499456_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154437.1|4499467_4499656_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	3.9e-25
WP_000301194.1|4499823_4502238_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.9	0.0e+00
WP_000104130.1|4502228_4503089_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001090717.1|4503085_4503670_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|4503666_4503894_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|4503893_4504127_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|4504194_4504536_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956189.1|4504499_4504700_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	95.5	8.7e-31
WP_000460852.1|4504707_4505217_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|4505249_4505492_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|4505608_4506241_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|4506244_4507270_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000902197.1|4507376_4507730_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
WP_001681810.1|4508376_4508634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681808.1|4508644_4509535_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000354257.1|4509534_4510281_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000052242.1|4510582_4512553_-	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
WP_000431675.1|4512572_4513877_-	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000467404.1|4513899_4514595_-	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_001023498.1|4514620_4515415_-	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000720235.1|4515424_4516492_-	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_000632616.1|4516536_4518273_-	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_010989299.1|4519049_4521545_-	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000127915.1|4521568_4522615_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_000466893.1|4522617_4523895_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_001210944.1|4524139_4524679_-	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_001120833.1|4525532_4527044_+	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_000488995.1|4527027_4528617_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4528780_4529794_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4535024:4535040	attR	TAAATCACGTAAATGAC	NA	NA	NA	NA
>prophage 15
NC_003198	Salmonella enterica subsp. enterica serovar Typhi str. CT18, complete genome	4809037	4681891	4694545	4809037	integrase	Enterobacteria_phage(50.0%)	13	4672426:4672439	4685557:4685570
4672426:4672439	attL	GTTAATGTTAAAAC	NA	NA	NA	NA
WP_000152561.1|4681891_4683382_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
WP_000772672.1|4683852_4685118_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000573583.1|4685180_4686257_-	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
4685557:4685570	attR	GTTTTAACATTAAC	NA	NA	NA	NA
WP_000700163.1|4686253_4687312_-	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000493739.1|4687301_4688465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214423.1|4688740_4689307_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000468230.1|4689322_4689562_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_001779443.1|4689565_4690309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525138.1|4690591_4690777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|4691104_4691656_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|4691652_4691880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|4691876_4692197_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783716.1|4692211_4694545_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	86.5	0.0e+00
>prophage 1
NC_003384	Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence	218160	104514	125897	218160	integrase,transposase	Escherichia_phage(22.22%)	24	114519:114535	125893:125909
WP_001086279.1|104514_105696_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|105910_106123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447661.1|106429_106705_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	96.7	1.1e-44
WP_001119134.1|106623_107127_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	98.8	8.2e-94
WP_000807689.1|107708_108464_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|109948_111022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005046357.1|111278_111767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|112434_112827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493077.1|113239_113443_+	hypothetical protein	NA	NA	NA	NA	NA
114519:114535	attL	AAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001166627.1|114530_114986_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|115057_115423_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|115438_115714_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|115741_116167_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|116205_117891_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|117908_118274_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087808.1|118270_118507_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|118490_118610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|118572_118785_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001389365.1|119022_119787_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|119929_120196_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|120416_120890_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|121045_122059_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|122364_122922_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|122924_125897_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
125893:125909	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 2
NC_003384	Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence	218160	143084	184438	218160	transposase	Escherichia_phage(50.0%)	38	NA	NA
WP_001352368.1|143084_144293_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000502663.1|144631_147967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817917.1|148262_148484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537778.1|148733_149120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447552.1|149131_149557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534813.1|149590_150064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000406154.1|150146_150437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974326.1|151051_152449_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001447551.1|152711_153518_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_000412211.1|154526_155186_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|155386_155764_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|156074_157079_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|159702_160407_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_164920270.1|160412_160673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|160706_161411_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|161910_162771_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|162920_163322_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|163368_164073_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|164828_165680_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|165987_166803_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|166863_167667_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|167666_168503_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|168563_169268_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|170657_171326_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|171361_171598_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|171594_171957_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|171974_173669_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|173720_174143_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732293.1|174178_174454_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|174467_174818_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|174889_175324_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427614.1|175402_176407_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001089068.1|177934_179140_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|179221_179845_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001447544.1|179822_180509_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|180516_180903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|180895_181216_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001352368.1|183229_184438_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 1
NC_003385	Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM2, complete sequence	106516	28	106516	106516	integrase,terminase,tail	Salmonella_phage(91.96%)	123	1567:1583	62368:62384
WP_000859650.1|28_334_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
WP_000699340.1|374_650_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
WP_000737807.1|718_1129_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
WP_000801005.1|1112_1484_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
1567:1583	attL	TAACCAATTTGTTTTCT	NA	NA	NA	NA
WP_000715582.1|1646_2489_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
WP_000589750.1|2492_2693_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_160859102.1|2784_3816_-	recombinase	NA	J9Q736	Salmonella_phage	99.4	4.0e-196
WP_000920226.1|3863_4130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_001108398.1|4129_5074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
WP_000045710.1|5134_6163_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
WP_000102109.1|6282_6714_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
WP_000459729.1|6959_7550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050470735.1|7643_8069_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.7e-71
WP_000645855.1|8083_11602_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
WP_000127343.1|11782_13018_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
WP_000030420.1|13114_15277_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	86.4	0.0e+00
WP_000790461.1|15386_15599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224608.1|15860_16247_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000798892.1|16238_17345_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.1e-25
WP_001117719.1|17605_18097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869626.1|18261_18507_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	41.6	2.1e-10
WP_000131231.1|18506_18887_-	hypothetical protein	NA	Q716B1	Shigella_phage	67.2	6.7e-40
WP_000159906.1|18902_19106_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	49.2	4.4e-06
WP_011011090.1|19115_19949_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.1	2.4e-90
WP_000336844.1|20002_20557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747129.1|20834_21389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062551.1|21467_22196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000067984.1|23768_24074_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
WP_000613550.1|24070_24223_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
WP_000605637.1|24222_24435_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.6e-33
WP_000413053.1|24594_25917_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
WP_011011093.1|25951_26209_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
WP_000642525.1|26509_27304_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
WP_000209842.1|27487_28540_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
WP_024134088.1|28541_29657_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.8	2.1e-214
WP_011011095.1|29815_31156_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
WP_000078184.1|31216_31942_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
WP_001238819.1|32223_33279_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
WP_000966077.1|33348_34104_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
WP_162199642.1|34152_34506_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.2e-45
WP_000161333.1|34511_35177_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
WP_001287064.1|35507_36059_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
WP_162199640.1|36109_36277_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.0	1.3e-16
WP_000147960.1|36269_36521_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	89.2	1.9e-30
WP_000856755.1|36522_37215_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.1e-125
WP_000064174.1|37228_37552_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
WP_000270398.1|37666_40219_-|tail	tail fiber domain-containing protein	tail	A0A0A0YQM3	Citrobacter_virus	52.5	2.3e-152
WP_001293197.1|44704_45292_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
WP_000528167.1|45279_46077_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	95.8	1.2e-155
WP_000511444.1|46069_46768_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	98.7	4.6e-135
WP_000440566.1|46857_47193_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_000081619.1|47234_51818_-	tape measure protein	NA	J9Q712	Salmonella_phage	93.1	0.0e+00
WP_000952684.1|51825_52050_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|52175_52493_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000072376.1|52552_53299_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
WP_000469441.1|53373_53757_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_000523626.1|53758_54232_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_001027662.1|54222_54567_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000057119.1|54664_55498_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
WP_000801184.1|55497_55932_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_001115046.1|55975_56899_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
WP_001130336.1|56973_57849_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
WP_001055287.1|57875_58772_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
WP_000423989.1|58794_60369_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
WP_001007302.1|60402_61659_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
WP_000215412.1|61661_62303_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
WP_000176291.1|62498_62765_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
62368:62384	attR	TAACCAATTTGTTTTCT	NA	NA	NA	NA
WP_000129634.1|62774_63665_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
WP_001113021.1|63670_63925_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_000049963.1|63917_64556_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
WP_000164561.1|64552_65221_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_011011100.1|65220_65919_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.6	1.9e-125
WP_000218382.1|65983_67543_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
WP_001291547.1|67545_67824_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_000683475.1|67883_68306_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_000182009.1|68310_68838_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
WP_000072873.1|69472_70123_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
WP_000234274.1|70207_70435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009195.1|71066_71549_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
WP_072089478.1|71754_71952_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.8	8.6e-31
WP_000218787.1|72162_72555_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
WP_000786235.1|72683_72995_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
WP_000559556.1|73071_73386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160859106.1|73480_73696_-	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	4.1e-34
WP_158643032.1|73766_74081_+	DUF4084 domain-containing protein	NA	NA	NA	NA	NA
WP_000104663.1|74070_74313_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
WP_000132517.1|75749_76940_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
WP_000916329.1|76949_77267_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
WP_000534979.1|77351_77618_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.1e-31
WP_000860613.1|77806_78010_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
WP_000218758.1|78070_78358_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
WP_000861921.1|78674_79217_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
WP_000086990.1|79213_79855_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
WP_000766011.1|79946_80318_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
WP_001291673.1|80598_81288_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
WP_001090446.1|81346_83032_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
WP_000333240.1|83173_83746_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
WP_000462606.1|83854_84697_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000872126.1|84805_84994_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_024134091.1|85003_85498_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
WP_011011108.1|85640_86249_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
WP_000262979.1|86834_87065_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_000559567.1|87267_87861_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
WP_024134092.1|88046_88889_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.9e-107
WP_000208226.1|89017_89575_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_000564632.1|89584_90004_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
WP_000386471.1|90067_90712_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_160859086.1|90711_91182_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	2.0e-89
WP_160859100.1|91184_91580_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	3.9e-67
WP_000025635.1|91599_92703_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.4	3.4e-217
WP_000673231.1|92830_93760_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
WP_011011111.1|93842_94985_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
WP_000623686.1|95092_97408_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_000047571.1|97485_98055_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
WP_000009516.1|98067_98814_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
WP_160859089.1|98803_99307_-	SMC family ATPase	NA	J9Q741	Salmonella_phage	99.4	8.2e-86
WP_000174806.1|100949_102035_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
WP_000832167.1|102263_102767_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
WP_001288958.1|102798_103293_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
WP_000364575.1|103368_104013_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
WP_001293470.1|104757_105813_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
WP_154080930.1|106018_106159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024134093.1|106341_106516_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	93.3	9.5e-26
