The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_000962	Mycobacterium tuberculosis H37Rv, complete genome	4411532	2941188	2989268	4411532	tRNA,integrase,protease	Mycobacterium_phage(36.36%)	57	2969989:2970016	2980971:2980998
NP_217130.1|2941188_2943267_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
YP_177674.1|2943375_2943603_+	hypothetical protein	NA	NA	NA	NA	NA
YP_177895.1|2943599_2944985_-	PE-PGRS family protein PE_PGRS45	NA	NA	NA	NA	NA
NP_217132.1|2945329_2945830_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217133.1|2945846_2946287_-	transmembrane protein	NA	NA	NA	NA	NA
NP_217134.1|2946433_2947111_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217135.1|2947095_2947449_-	hypothetical protein	NA	NA	NA	NA	NA
NP_217136.1|2947461_2947887_-	transmembrane protein	NA	NA	NA	NA	NA
NP_217137.1|2947883_2948558_-	transcriptional regulator	NA	NA	NA	NA	NA
NP_217138.1|2948635_2949457_+	methyltransferase	NA	NA	NA	NA	NA
NP_217139.1|2949592_2950486_+	universal stress protein	NA	NA	NA	NA	NA
NP_217140.1|2950488_2951307_-	universal stress protein	NA	NA	NA	NA	NA
NP_217141.1|2951321_2952503_-|protease	zinc metalloprotease Rip3	protease	NA	NA	NA	NA
NP_217142.1|2952561_2952993_-	hypoxic response protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
NP_217143.1|2953506_2954748_-	hypothetical protein	NA	NA	NA	NA	NA
NP_217144.1|2955057_2955420_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217145.1|2955766_2956891_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217146.1|2956892_2957432_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217147.2|2957571_2958870_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
NP_217148.1|2958908_2959190_-	hypothetical protein	NA	NA	NA	NA	NA
NP_217149.1|2959334_2959820_-	hypothetical protein	NA	NA	NA	NA	NA
YP_177896.1|2960104_2962441_-	PE-PGRS family protein PE_PGRS46	NA	NA	NA	NA	NA
NP_217151.1|2962469_2962712_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217152.1|2962712_2963390_+	O-phosphotransferase	NA	NA	NA	NA	NA
NP_217153.1|2963585_2964242_+	transmembrane protein DedA	NA	NA	NA	NA	NA
NP_217154.1|2964404_2964851_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217155.1|2965025_2965358_-	integral membrane protein	NA	NA	NA	NA	NA
NP_217156.1|2965477_2965837_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
NP_217157.1|2965938_2966397_+	cadmium inducible protein CadI	NA	NA	NA	NA	NA
NP_217158.1|2966532_2966913_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
NP_217159.1|2966909_2968406_+	arsenic-transport integral membrane protein ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
NP_217160.1|2968532_2968850_-	hypothetical protein	NA	NA	NA	NA	NA
2969989:2970016	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
NP_217161.1|2970122_2970554_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217162.1|2970550_2971549_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
NP_217163.2|2971562_2972027_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217166.1|2973794_2975234_-	prophage protein	NA	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
NP_217167.1|2975241_2975775_-|protease	prophage protease	protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
NP_217168.1|2975927_2976554_-	prophage protein	NA	V9H0V4	Actinophage	47.2	1.6e-17
NP_217169.1|2976585_2976909_-	toxin	NA	NA	NA	NA	NA
NP_217170.1|2976988_2977234_-	antitoxin	NA	NA	NA	NA	NA
NP_217171.1|2977230_2978658_-	prophage protein	NA	NA	NA	NA	NA
NP_217172.1|2978659_2979052_-	prophage protein	NA	NA	NA	NA	NA
NP_217173.1|2979048_2979309_-	prophage protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
NP_217174.1|2979325_2979688_-	prophage protein	NA	NA	NA	NA	NA
NP_217175.1|2979690_2980818_-|integrase	prophage integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
NP_217176.1|2980962_2981190_-	hypothetical protein	NA	NA	NA	NA	NA
2980971:2980998	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
NP_217177.1|2981186_2981576_-	hypothetical protein	NA	NA	NA	NA	NA
NP_217178.1|2981481_2981754_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217179.1|2981852_2982086_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217180.1|2982096_2982351_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217181.1|2982698_2982980_+	hypothetical protein	NA	NA	NA	NA	NA
YP_177897.1|2983895_2984654_+|protease	ATP-dependent protease ATP-binding subunit ClpC	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
NP_217184.1|2984732_2985254_+	hypothetical protein	NA	NA	NA	NA	NA
NP_217185.1|2985282_2985753_+	GCN5-like N-acetyltransferase	NA	NA	NA	NA	NA
NP_217186.1|2985730_2986840_-	hypothetical protein	NA	NA	NA	NA	NA
NP_217187.1|2986838_2987615_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	NA	NA	NA	NA
NP_217188.1|2987681_2989268_+|protease	protease	protease	NA	NA	NA	NA
