The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_002927	Bordetella bronchiseptica RB50, complete genome	5339179	1757721	1803804	5339179	protease,integrase,portal,terminase,head,capsid,tail	Burkholderia_phage(19.23%)	56	1765713:1765732	1805399:1805418
WP_033447056.1|1757721_1758369_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_010926218.1|1758454_1759360_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003809956.1|1759371_1760499_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_003809958.1|1760586_1761213_-	fimbrial protein	NA	NA	NA	NA	NA
WP_033446615.1|1761460_1761670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926219.1|1761941_1763129_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010926220.1|1763125_1765723_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.4	2.2e-20
1765713:1765732	attL	TGCTGCATCATGGGAGTATG	NA	NA	NA	NA
WP_033451925.1|1765779_1766769_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	54.7	2.5e-94
WP_010926222.1|1766746_1766959_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_010926223.1|1767115_1767763_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	42.3	3.8e-35
WP_010926225.1|1767874_1768051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926228.1|1769785_1771720_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	46.8	1.3e-163
WP_010926229.1|1771721_1772207_-	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	63.6	1.6e-57
WP_010926231.1|1772546_1772774_-	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	49.2	1.4e-13
WP_010926232.1|1772770_1773292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926233.1|1773288_1773933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926234.1|1773929_1774754_-	ParB N-terminal domain-containing protein	NA	C7BGF1	Burkholderia_phage	65.8	6.5e-88
WP_010926235.1|1774774_1775146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926236.1|1775156_1775393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146090591.1|1775702_1776062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926238.1|1776366_1777050_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_080561918.1|1777135_1777348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926239.1|1777451_1777982_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	38.9	4.1e-27
WP_049803241.1|1777981_1778284_+	hypothetical protein	NA	Q6V7S5	Burkholderia_virus	38.8	2.0e-07
WP_010926241.1|1778276_1778579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926242.1|1778575_1779070_+	DUF1364 family protein	NA	NA	NA	NA	NA
WP_010926244.1|1780264_1780744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926245.1|1780740_1781109_+	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	48.1	7.5e-20
WP_146090592.1|1781123_1781606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926247.1|1781606_1782290_+	hypothetical protein	NA	Q3HR05	Burkholderia_phage	45.1	1.5e-29
WP_010926248.1|1782546_1782825_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	60.4	1.3e-08
WP_010926249.1|1782811_1783078_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_080561919.1|1783277_1784057_+	HNH endonuclease	NA	A0A2D1GPH3	Lactobacillus_phage	32.7	9.0e-15
WP_010926251.1|1784162_1784582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926252.1|1784559_1786329_+|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	74.2	5.9e-264
WP_010926253.1|1786325_1787621_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	59.5	1.1e-134
WP_010926254.1|1787632_1788508_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	60.2	4.5e-79
WP_010926255.1|1788512_1789712_+|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	56.1	2.2e-113
WP_010926256.1|1789761_1789995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926257.1|1789997_1790327_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	57.8	3.5e-21
WP_033452542.1|1790326_1790701_+|head,tail	head-tail adaptor protein	head,tail	H2BDB4	Pseudomonas_virus	50.8	2.0e-28
WP_155272940.1|1790766_1790922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926260.1|1790918_1791404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926261.1|1791403_1791775_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_010926262.1|1791837_1792335_+	hypothetical protein	NA	A0A2H4J511	uncultured_Caudovirales_phage	32.2	7.8e-12
WP_010926263.1|1792344_1792677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146090594.1|1793125_1793476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033452353.1|1793534_1796516_+|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	31.9	2.0e-25
WP_010926267.1|1796517_1796865_+	hypothetical protein	NA	Q2NPH3	Xanthomonas_virus	33.3	2.5e-09
WP_010926268.1|1796866_1797343_+	DUF1833 family protein	NA	I7GYA2	Xanthomonas_virus	25.9	1.1e-10
WP_010926269.1|1797342_1797729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104442497.1|1797863_1801562_+	hypothetical protein	NA	A5A3R1	Burkholderia_phage	24.9	9.5e-46
WP_010926271.1|1801566_1802343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926272.1|1802339_1802729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033452351.1|1802815_1803259_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	40.0	4.3e-14
WP_010926274.1|1803255_1803804_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	53.4	9.1e-30
1805399:1805418	attR	TGCTGCATCATGGGAGTATG	NA	NA	NA	NA
>prophage 2
NC_002927	Bordetella bronchiseptica RB50, complete genome	5339179	2336591	2371113	5339179	terminase,integrase,tail	Pseudomonas_phage(16.13%)	49	2335700:2335715	2345581:2345596
2335700:2335715	attL	TGGCGATCGGACAGCT	NA	NA	NA	NA
WP_010926402.1|2336591_2337581_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	2.0e-75
WP_010926403.1|2337577_2337778_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010926405.1|2337890_2338556_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	47.6	8.7e-51
WP_010926407.1|2339817_2340237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926408.1|2340325_2340973_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	1.2e-31
WP_010926409.1|2340969_2341956_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.8	4.0e-68
WP_010926410.1|2341959_2342142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|2342138_2342516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926412.1|2342518_2342728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926413.1|2342747_2343215_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	70.5	8.0e-43
WP_010926414.1|2343250_2343493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566311.1|2343689_2344712_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	51.9	3.9e-74
WP_010926415.1|2344850_2345480_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|2346034_2346286_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2345581:2345596	attR	AGCTGTCCGATCGCCA	NA	NA	NA	NA
WP_161781422.1|2346278_2346968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926418.1|2346985_2347240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926419.1|2347325_2347490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926420.1|2347577_2347886_+	DNA-binding protein	NA	A0A1S5NNI6	Burkholderia_phage	47.8	3.9e-14
WP_010926421.1|2347888_2348296_+	recombination protein NinB	NA	A0A0H5AUD0	Pseudomonas_phage	62.4	2.6e-29
WP_010926422.1|2348295_2348745_+	HNH endonuclease	NA	A0A2I7RKD9	Vibrio_phage	39.2	1.7e-21
WP_010926423.1|2348741_2349158_+	DUF1364 family protein	NA	A4JX58	Burkholderia_virus	42.9	1.4e-14
WP_004566303.1|2349157_2349982_+	hypothetical protein	NA	R9TJW3	Synechococcus_phage	45.3	1.9e-07
WP_004566302.1|2349978_2350350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566301.1|2350346_2351288_+	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	36.5	8.5e-52
WP_004566300.1|2351284_2351968_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	50.0	4.9e-33
WP_004566298.1|2352164_2352605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566297.1|2352923_2353295_+	DNA-binding protein	NA	A0A090DCM3	Clostridium_phage	36.7	6.2e-06
WP_004566296.1|2353281_2354559_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.2	9.2e-150
WP_004566295.1|2354561_2355980_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	41.5	1.2e-97
WP_004566294.1|2356008_2357061_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.8	6.3e-96
WP_033448595.1|2357066_2357309_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	51.9	1.9e-16
WP_004566293.1|2357432_2358035_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	44.3	5.5e-28
WP_004566292.1|2358061_2359030_+	hypothetical protein	NA	R9TJ64	Synechococcus_phage	71.7	6.6e-124
WP_003813425.1|2359039_2359297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566291.1|2359359_2359842_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	38.5	2.6e-12
WP_004566290.1|2359843_2360044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566289.1|2360043_2360439_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_004566288.1|2360435_2360834_+	HK97 gp10 family phage protein	NA	S4SIM9	Salmonella_phage	44.9	2.1e-23
WP_004566287.1|2360830_2361253_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004566286.1|2361260_2361761_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	7.5e-31
WP_157835999.1|2361861_2362017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003813414.1|2362015_2362531_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	1.2e-23
WP_010926424.1|2362543_2362873_+|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	43.1	3.8e-15
WP_003813411.1|2362890_2363181_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	41.9	6.3e-14
WP_010926425.1|2363208_2365809_+|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	36.4	4.5e-103
WP_010926426.1|2365818_2366178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033448593.1|2366244_2366778_+	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	56.5	1.2e-47
WP_004566282.1|2366774_2367164_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	49.2	3.3e-34
WP_004566281.1|2367156_2371113_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	41.1	1.2e-219
>prophage 3
NC_002927	Bordetella bronchiseptica RB50, complete genome	5339179	3222452	3230512	5339179	tRNA	uncultured_Mediterranean_phage(28.57%)	9	NA	NA
WP_010926718.1|3222452_3223331_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_010928874.1|3223348_3224128_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_003811017.1|3224112_3224871_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	6.2e-69
WP_003811015.1|3224996_3225644_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003811013.1|3225688_3226729_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	9.3e-92
WP_003811011.1|3226863_3228156_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_003811009.1|3228361_3229387_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010926719.1|3229522_3229906_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_003811006.1|3229924_3230512_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	46.8	2.1e-16
>prophage 4
NC_002927	Bordetella bronchiseptica RB50, complete genome	5339179	3728652	3750883	5339179	terminase,tail	Pseudomonas_phage(18.18%)	29	NA	NA
WP_004566281.1|3728652_3732609_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	41.1	1.2e-219
WP_004566282.1|3732601_3732991_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	49.2	3.3e-34
WP_033448593.1|3732987_3733521_-	DUF1833 family protein	NA	A0A0B5A6T7	Achromobacter_phage	56.5	1.2e-47
WP_010926426.1|3733587_3733947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926425.1|3733956_3736557_-|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	36.4	4.5e-103
WP_003813411.1|3736584_3736875_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	41.9	6.3e-14
WP_010926424.1|3736892_3737222_-|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	43.1	3.8e-15
WP_003813414.1|3737234_3737750_-|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	1.2e-23
WP_157835999.1|3737748_3737904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004566286.1|3738004_3738505_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	7.5e-31
WP_004566287.1|3738512_3738935_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004566288.1|3738931_3739330_-	HK97 gp10 family phage protein	NA	S4SIM9	Salmonella_phage	44.9	2.1e-23
WP_004566289.1|3739326_3739722_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_004566290.1|3739721_3739922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566291.1|3739923_3740406_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	38.5	2.6e-12
WP_003813425.1|3740468_3740726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566292.1|3740735_3741704_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	71.7	6.6e-124
WP_004566293.1|3741730_3742333_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	44.3	5.5e-28
WP_033448595.1|3742456_3742699_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	51.9	1.9e-16
WP_041936422.1|3742704_3743676_-	phage Mu F like family protein	NA	A0A0H5BBX3	Pseudomonas_phage	45.8	6.9e-89
WP_004566295.1|3743647_3745066_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	41.5	1.2e-97
WP_004566296.1|3745068_3746346_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.2	9.2e-150
WP_004566297.1|3746332_3746704_-	DNA-binding protein	NA	A0A090DCM3	Clostridium_phage	36.7	6.2e-06
WP_004566298.1|3747022_3747463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566300.1|3747659_3748343_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	50.0	4.9e-33
WP_004566301.1|3748339_3749281_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	36.5	8.5e-52
WP_004566302.1|3749277_3749649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004566303.1|3749645_3750470_-	hypothetical protein	NA	R9TJW3	Synechococcus_phage	45.3	1.9e-07
WP_004566304.1|3750469_3750883_-	DUF1364 family protein	NA	A4JX58	Burkholderia_virus	39.1	8.1e-15
>prophage 5
NC_002927	Bordetella bronchiseptica RB50, complete genome	5339179	3829666	3869378	5339179	tRNA,transposase,integrase,plate,capsid,tail	Pseudomonas_phage(29.41%)	50	3820223:3820241	3875237:3875255
3820223:3820241	attL	GCCGGCGTTGTTGACCAGC	NA	NA	NA	NA
WP_010926868.1|3829666_3831022_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003813603.1|3831081_3831408_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_003813605.1|3831412_3833047_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003813607.1|3833043_3833352_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_010926869.1|3833597_3834599_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	31.4	1.0e-23
WP_010926870.1|3834601_3835393_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	76.7	1.2e-123
WP_010926871.1|3835567_3835921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926873.1|3836174_3836975_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	37.3	5.6e-28
WP_010926874.1|3836971_3837550_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	36.5	1.3e-29
WP_033452121.1|3837546_3838614_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.2	2.1e-75
WP_010926876.1|3838613_3838964_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.5	9.9e-30
WP_010926877.1|3839027_3839669_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	45.6	2.5e-39
WP_010926878.1|3839658_3840762_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	43.3	2.1e-73
WP_010926879.1|3840745_3842005_-	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	33.2	8.5e-55
WP_010926880.1|3842004_3844209_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	42.9	3.9e-87
WP_010926882.1|3844352_3844745_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_010926883.1|3844741_3845116_-	hypothetical protein	NA	A0A2H4J9F8	uncultured_Caudovirales_phage	41.6	2.4e-18
WP_010926884.1|3845131_3846559_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	40.0	1.6e-73
WP_010926885.1|3846564_3846747_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_104442499.1|3846746_3847406_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_033452139.1|3847438_3847867_-	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	35.9	3.0e-12
WP_010926888.1|3847967_3848240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926889.1|3848311_3849259_-|capsid	major capsid protein	capsid	G8GWE7	Rhodobacter_phage	47.6	5.0e-76
WP_010926890.1|3849314_3849674_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_010926891.1|3849719_3850727_-	hypothetical protein	NA	Q5ZQY0	Pseudomonas_phage	53.5	3.5e-35
WP_010926892.1|3850961_3851519_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	33.5	1.1e-09
WP_010926893.1|3851660_3853001_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	40.1	1.1e-63
WP_104442500.1|3852993_3854448_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	56.2	1.6e-145
WP_010926895.1|3854528_3856211_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	47.7	1.2e-120
WP_010926896.1|3856210_3856762_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	54.3	1.6e-29
WP_010926897.1|3856765_3857065_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	61.2	3.4e-23
WP_010926898.1|3857075_3857372_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	44.7	2.9e-14
WP_010926900.1|3857474_3857891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033452133.1|3857887_3858520_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.7	1.3e-67
WP_010926902.1|3858522_3858903_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	61.9	9.1e-29
WP_010926904.1|3859488_3860100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085963112.1|3860103_3860544_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	43.4	4.8e-21
WP_010926906.1|3860645_3860870_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033452116.1|3861030_3861507_+	hypothetical protein	NA	A0A0S4L5L2	Pseudomonas_phage	48.1	9.7e-36
WP_010926908.1|3861503_3861809_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	51.0	3.3e-21
WP_010926909.1|3861827_3862721_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	53.6	3.9e-70
WP_010926910.1|3862723_3864499_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	52.7	2.1e-176
WP_010926911.1|3864509_3865694_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	52.2	2.5e-101
WP_010926912.1|3865684_3866005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104442501.1|3866207_3866807_+	hypothetical protein	NA	A0A0M5MXL4	Ralstonia_phage	55.0	5.6e-49
WP_010926915.1|3866803_3867424_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	58.6	3.9e-61
WP_010926916.1|3867543_3867825_+	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	46.1	5.7e-12
WP_146090596.1|3867885_3868287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926918.1|3868366_3868783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926919.1|3868787_3869378_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	55.6	1.5e-30
3875237:3875255	attR	GCTGGTCAACAACGCCGGC	NA	NA	NA	NA
